Molecular profiling 2012
Upcoming SlideShare
Loading in...5
×
 

Molecular profiling 2012

on

  • 1,611 views

Next Generation Molecular Profiling

Next Generation Molecular Profiling

Statistics

Views

Total Views
1,611
Views on SlideShare
883
Embed Views
728

Actions

Likes
0
Downloads
54
Comments
0

2 Embeds 728

http://www.bioinformatics.be 727
http://www.linkedin.com 1

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Molecular profiling 2012 Molecular profiling 2012 Presentation Transcript

  • Next Generation Molecular Profiling
  • Lab for Bioinformatics and computational genomics 10 “genome hackers” mostly engineers (statistics) 42 scientists technicians, geneticists, clinicians >100 people hardware engineers,mathematicians, molecular biologists
  • Next Generation Molecular Profiling
  • Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  • Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  • Personalized Medicine• The use of diagnostic tests (aka biomarkers) to identify in advance which patients are likely to respond well to a therapy• The benefits of this approach are to – avoid adverse drug reactions – improve efficacy – adjust the dose to suit the patient – differentiate a product in a competitive market – meet future legal or regulatory requirements• Potential uses of biomarkers – Risk assessment – Initial/early detection – Prognosis – Prediction/therapy selection – Response assessment – Monitoring for recurrence
  • BiomarkerFirst used in 1971 … An objective and « predictive » measure … at the molecular level … of normal and pathogenic processes and responses to therapeutic interventionsCharacteristic that is objectively measured and evaluated as an indicator of normal biologic or pathogenic processes or pharmacologic response to a drugA biomarker is valid if: – It can be measured in a test system with well established performance characteristics – Evidence for its clinical significance has been established
  • Rationale 1:Why now ? Regulatory path becoming more clear There is more at stake than efficient drug development. FDA « critical path initiative » Pharmacogenomics guideline Biomarkers are the foundation of « evidence based medicine » - who should be treated, how and with what. Without Biomarkers advances in targeted therapy will be limited and treatment remain largely emperical. It is imperative that Biomarker development be accelarated along with therapeutics
  • Why now ?First and maturing second generation molecular profiling methodologies allow to stratify clinical trial participants to include those most likely to benefit from the drug candidate—and exclude those who likely will not—pharmacogenomics- basedClinical trials should attain more specific results with smaller numbers of patients. Smaller numbers mean fewer costs (factor 2-10)An additional benefit for trial participants and internal review boards (IRBs) is that stratification, given the correct biomarker, may reduce or eliminate adverse events.
  • Molecular ProfilingThe study of specific patterns (fingerprints) of proteins,DNA, and/or mRNA and how these patterns correlatewith an individuals physical characteristics orsymptoms of disease.
  • Generic Health advice• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
  • Generic Health advice (UNLESS)• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolarance)• Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
  • Generic Health advice (UNLESS)• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
  • Generic Health advice (UNLESS)• Exercise (Hypertrophic Cardiomyopathy)• Drink your milk (MCM6 Lactose intolerance)• Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency)• & your grains (HLA-DQ2 – Celiac disease)• & your iron (HFE - Hemochromatosis)• Get more rest (HLA-DR2 - Narcolepsy)
  • EGFR based therapy in mCRC
  • Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  • Before molecular profiling …
  • Before molecular profiling …
  • Before molecular profiling …
  • First Generation Molecular Profiling• Flow cytometry correlates surface markers, cell size and other parameters• Circulating tumor cell assays (CTC’s) quantitate the number of tumor cells in the peripheral blood.• Exosomes are 30-90 nm vesicles secreted by a wide range of mammalian cell types.• Immunohistochemistry (IHC) measures protein expression, usually on the cell surface.
  • First Generation Molecular Profiling• Gene sequencing for mutation detection• Microarray for m-RNA message detection• RT-PCR for gene expression• FISH analysis for gene copy number• Comparative Genome Hybridization (CGH) for gene copy number
  • Basics of the ―old‖ technology• Clone the DNA.• Generate a ladder of labeled (colored) molecules that are different by 1 nucleotide.• Separate mixture on some matrix.• Detect fluorochrome by laser.• Interpret peaks as string of DNA.• Strings are 500 to 1,000 letters long• 1 machine generates 57,000 nucleotides/run• Assemble all strings into a genome.
  • Genetic Variation Among PeopleSingle nucleotide polymorphisms (SNPs) GATTTAGATCGCGATAGAG GATTTAGATCTCGATAGAG 0.1% difference among people
  • The genome fits as an e-mail attachment
  • First Generation Molecular Profiling• Gene sequencing for mutation detection• Microarray for m-RNA message detection• RT-PCR for gene expression• FISH analysis for gene copy number• Comparative Genome Hybridization (CGH) for gene copy number
  • mRNA Expression Microarray
  • First Generation Molecular Profiling• Gene sequencing for mutation detection• Microarray for m-RNA message detection• RT-PCR for gene expression• FISH analysis for gene copy number• Comparative Genome Hybridization (CGH) for gene copy number
  • Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  • Basics of the ―new‖ technology• Get DNA.• Attach it to something.• Extend and amplify signal with some color scheme.• Detect fluorochrome by microscopy.• Interpret series of spots as short strings of DNA.• Strings are 30-300 letters long• Multiple images are interpreted as 0.4 to 1.2 GB/run (1,200,000,000 letters/day).• Map or align strings to one or many genome.
  • Next Generation Technologies• Roche (454) –Emulsion PCR –Polymerase –Natural Nucleotides• 100-500 Mb for 5-15k –1% error rate –Homopolymers
  • One additional insight ...
  • Read Length is Not As Important For Resequencing 100% % of Paired K-mers with Uniquely 90% 80% Assignable Location 70% 60% E.COLI 50% HUMAN 40% 30% 20% 10% 0% 8 10 12 14 16 18 20 Length of K-mer Reads (bp)Jay Shendure
  • Short Read Techologies• Illumina GA (HiSeq, MySeq)• ABI SOLID
  • Other second generation technology: (ABI) SOLID
  • So what ?
  • Second generation DNA/RNA profiling
  • Second Generation DNA profiling• Enrichment Sequencing • ChIP-Seq (Chromosome Immunoprecipitation) • A substitute for ChIP-chip • Eg. to find the binding sequence of proteins (TFBS)
  • Paired End Reads are Important! Known Distance Repetitive DNA Read 1Unique DNA 2 Read Single read maps to multiple positions
  • Paired End Reads are Important! Known Distance Repetitive DNA Read 1Unique DNA 2 Read Single read maps to multiple positions
  • Second Generation DNA profiling• Exome Sequencing (aka known as targeted exome capture) is an efficient strategy to selectively sequence the coding regions of the genome to identify novel genes associated with rare and common disorders.• 160K exons
  • Second Generation DNA profiling
  • Second Generation DNA profiling
  • Bioinformatics tools
  • Bioinformatics tools
  • Second Generation RNA profiling Besides the 6000 protein coding-genes … 140 ribosomal RNA genes 275 transfer RNA gnes 40 small nuclear RNA genes >100 small nucleolar genes Function of RNA genes pRNA in 29 rotary packaging motor (Simpson et el. Nature 408:745-750,2000) Cartilage-hair hypoplasmia mapped to an RNA Contents-Schedule (Ridanpoa et al. Cell 104:195-203,2001) The human Prader-Willi ciritical region (Cavaille et al. PNAS 97:14035-7, 2000)
  • Second Generation RNA profiling RNA genes can be hard to detects UGAGGUAGUAGGUUGUAUAGU C.elegans let-27; 21 nt (Pasquinelli et al. Nature 408:86-89,2000) Often small Sometimes multicopy and redundant Often not polyadenylated (not represented in ESTs) Immune to frameshift and nonsense mutations No open reading frame, no codon bias Often evolving rapidly in primary sequence
  • Second Generation RNA profiling Although details of the methods vary, the concept behind RNA-seq is simple: • isolate all mRNA • convert to cDNA using reverse transcriptase • sequence the cDNA • map sequences to the genome The more times a given sequence is detected, the more abundantly transcribed it is. If enough sequences are generated, a comprehensive and quantitative view of the entire transcriptome of an organism or tissue can be obtained.
  • Second Generation RNA profiling• Comparing to microarray – Microarray • Closed technology: Prior knowledge required • Affected by pseudo-genes (homologous of real genes) • Low sensitivity – RNA-Seq • Open technology: No prior knowledge required • Not affected by pseudo-genes because exact sequence is measured • Other information could be yielded (SNP, Alternative splicing)
  • ncRNAs in human genome tRNA 600 SRP RNA 1 18S rRNA 200 RNase P RNA 1 5.8S rRNA 200 Telomerase RNA 1 28S rRNA 200 RNase MRP 1 5S rRNA 200 Y RNA 5 snoRNA 300 miRNA 250 Vault 4 U1 40 7SK RNA 1 U2 30 Xist 1 U4 30 H19 1 U5 30 BIC 1 U6 20 U4atac 5 Antisense RNAs 1000s? U6atac 5 Cis reg regions 100s? U11 5 U12 5 Others ?
  • Mapping Structural Variation in Humans >1 kb segments - Thought to be Common 12% of the genome (Redon et al. 2006) - Likely involved in phenotype variation and disease CNVs - Until recently most methods for detection were low resolution (>50 kb)
  • Size Distribution of CNV in a Human Genome
  • Next next generation sequencing Third generation sequencing Now sequencing
  • Ultra-low-cost SINGLE molecule sequencing
  • Pacific Biosciences: A Third Generation Sequencing Technology Eid et al 2008
  • Complete genomics
  • Nanopore Sequencing
  • Second Generation Protein profiling• Proteomics MS-MS-based exclusively in discovery mode• Automate diagnostics assay generation (next generation proteomics) • Aptamers as alternative to antibodies • ImmunoPCR
  • MS/MS identificationpipeline overview pipeline Goal filter dataset Goal prior to multi-tiered database Goal search database Bonanza define PTMs search profile prior to database search Bonanza + IggyPep
  • Second Generation Protein profiling• Proteomics MS-MS-based exclusively in discovery mode• Automate diagnostics assay generation (next generation proteomics) • Aptamers as alternative to antibodies • ImmunoPCR
  • Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  • Defining Epigenetics Genome DNA  Reversible changes in gene expression/function  Without changes in DNA Chromatin sequence Epigenome  Can be inherited from precursor cells Gene Expression  Allows to integrate intrinsic with environmental signals Phenotype (including diet) CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • CONFIDENTIALMethylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • Epigenetic Regulation:Post Translational Modifications to Histones and Base Changes in DNA  Epigenetic modifications of histones and DNA include: – Histone acetylation and methylation, and DNA methylation Histone Methylation Me Me Histone Me Acetylation Ac DNA Methylation CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • MGMT BiologyO6 Methyl-GuanineMethyl TransferaseEssential DNA Repair EnzymeRemoves alkyl groups from damaged guaninebasesHealthy individual: - MGMT is an essential DNA repair enzyme Loss of MGMT activity makes individuals susceptible to DNA damage and prone to tumor developmentGlioblastoma patient on alkylator chemotherapy: - Patients with MGMT promoter methylation show have longer PFS and OS with the use of alkylating agents as chemotherapy CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • MGMT PromoterMethylation PredictsBenefit form DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation Median Overall Survival 25 21.7 months 20 plus temozolomide 15 12.7 months 10 radiotherapy radiotherapy 5 Adapted from Hegi et al. NEJM 2005 0 352(10):1036-8. Non-Methylated Methylated Study with 207 patients MGMT Gene MGMT Gene CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • Genome-wide methylationby methylation sensitive restriction enzymes CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • Genome-wide methylationby probes CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • Genome-wide methylation…. by next generation sequencing # markers Discovery Verification Validation # samples CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • MBD_SeqCondensed Chromatin DNA Sheared Immobilized Methyl Binding Domain DNA Sheared CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • MBD_Seq Immobilized Methyl binding domain MgCl2 Next Gen Sequencing GA Illumina: 100 million reads CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • MBD_SeqMGMT = dual core CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • Genome-wide methylation…. by next generation sequencing # markers 1-2 million MBD_Seq methylation cores Discovery # samples CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • Data integrationCorrelation tracksexpression expression Corr =-1 Corr = 1 methylation methylation CONFIDENTIAL 99
  • Correlation trackin GBM @ MGMT +1 -1 CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker 100 I NEXT-GEN | PharmacoDX |
  • Genome-wide methylation…. by next generation sequencing # markers MBD_Seq Discovery 454_BT_Seq Verification MSP Validation # samples CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX |
  • Deep Sequencing unmethylated alleles methylated alleles less methylation more methylation CONFIDENTIALGCATCGTGACTTACGACTGATCGATGGATGCTA
  • Deep MGMTHeterogenic complexity CONFIDENTIAL Methylation I Epigenetics | Oncology | Biomarker I NEXT-GEN | PharmacoDX | CRC
  • 104
  • CONFIDENTIALMethylation I Epigenetics | Oncology | Biomarker 105 I NEXT-GEN | PharmacoDX | CRC
  • Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  • Bioinformatics, a life science discipline … Math (Molecular) Informatics Biology
  • Bioinformatics, a life science discipline … Math Computer Science Theoretical Biology (Molecular) Informatics Biology Computational Biology
  • Bioinformatics, a life science discipline … Math Computer Science Theoretical Biology Bioinformatics (Molecular) Informatics Biology Computational Biology
  • Bioinformatics, a life science discipline … management of expectations Math Computer Science Theoretical Biology NP AI, Image Analysis Datamining structure prediction (HTX) Bioinformatics Interface Design Expert Annotation Sequence Analysis (Molecular)Informatics Biology Computational Biology
  • Bioinformatics, a life science discipline … management of expectations Math Computer Science Theoretical Biology NP AI, Image Analysis Datamining structure prediction (HTX) Bioinformatics Discovery Informatics – Computational Genomics Interface Design Expert Annotation Sequence Analysis (Molecular)Informatics Biology Computational Biology
  • Translational Medicine: An inconvenient truth • 1% of genome codes for proteins, however more than 90% is transcribed • Less than 10% of protein experimentally measured can be ―explained‖ from the genome • 1 genome ? Structural variation • > 200 Epigenomes ?? • Space/time continuum …
  • Translational Medicine: An inconvenient truth • 1% of genome codes for proteins, however more than 90% is transcribed • Less than 10% of protein experimentally measured can be ―explained‖ from the genome • 1 genome ? Structural variation • > 200 Epigenomes … • ―space/time‖ continuum
  • Cellular programming Epigenetic (meta)information = stem cells
  • Cellular reprogrammingTumor Tumor Development and GrowthEpigeneticallyaltered, self-renewing cancerstem cells
  • Cellular reprogramming Gene-specific Epigenetic reprogramming
  • biobixwvcriekibiobix.bebioinformatics.be 119