Your SlideShare is downloading. ×
0
Genomics:
Experimental methods
Slides available
www.bioinformatics.be
Lab for Bioinformatics and
computational genomics

10 “genome hackers”
mostly engineers (statistics)

42 scientists
techni...
Overview

Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation M...
Overview

Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation M...
Personalized Medicine
• The use of diagnostic tests (aka biomarkers) to identify in advance
which patients are likely to r...
Biomarker

First used in 1971 … An objective and
« predictive » measure … at the molecular
level … of normal and pathogeni...
Rationale 1:
Why now ? Regulatory path becoming more clear
There is more at stake than
efficient drug
development. FDA
« c...
Why now ?

First and maturing second generation molecular
profiling methodologies allow to stratify clinical
trial partici...
Molecular Profiling

The study of specific patterns (fingerprints) of proteins,
DNA, and/or mRNA and how these patterns co...
Generic Health advice

• Exercise (Hypertrophic Cardiomyopathy)
• Drink your milk (MCM6 Lactose intolarance)
• Eat your gr...
Generic Health advice (UNLESS)

• Exercise (Hypertrophic Cardiomyopathy)
• Drink your milk (MCM6 Lactose intolarance)
• Ea...
Generic Health advice (UNLESS)

• Exercise (Hypertrophic Cardiomyopathy)
• Drink your milk (MCM6 Lactose intolerance)
• Ea...
Generic Health advice (UNLESS)

• Exercise (Hypertrophic Cardiomyopathy)
• Drink your milk (MCM6 Lactose intolerance)
• Ea...
EGFR based therapy in mCRC
Overview

Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation M...
Before molecular profiling …
Before molecular profiling …
Before molecular profiling …
First Generation Molecular Profiling

• Flow cytometry correlates surface markers,
cell size and other parameters
• Circul...
First Generation Molecular Profiling

• Gene sequencing for mutation detection
• Microarray for m-RNA message detection
• ...
Basics of the ―old‖ technology

• Clone the DNA.
• Generate a ladder of labeled (colored)
molecules that are different by ...
Genetic Variation
Among People
Single nucleotide polymorphisms
(SNPs)

GATTTAGATCGCGATAGAG
GATTTAGATCTCGATAGAG

0.1% diffe...
The genome fits as an e-mail attachment
First Generation Molecular Profiling

• Gene sequencing for mutation detection
• Microarray for m-RNA message detection
• ...
mRNA Expression Microarray
First Generation Molecular Profiling

• Gene sequencing for mutation detection
• Microarray for m-RNA message detection
• ...
Overview

Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation M...
Basics of the ―new‖ technology

• Get DNA.
• Attach it to something.
• Extend and amplify signal with some color
scheme.
•...
Next Generation Technologies

• Roche (454)
–Emulsion PCR
–Polymerase
–Natural Nucleotides

• 100-500 Mb for 5-15k
–1% err...
One additional insight ...
% of Paired K-mers with Uniquely
Assignable Location

Read Length is Not As Important For Resequencing

100%
90%
80%
70%
6...
Short Read Techologies

• Illumina GA (HiSeq, MySeq)

• ABI SOLID
Other second generation technology: (ABI) SOLID
So what ?
Second generation DNA/RNA profiling
Second Generation DNA profiling

• Enrichment Sequencing
• ChIP-Seq (Chromosome
Immunoprecipitation)
• A substitute for Ch...
Paired End Reads are Important!
Known Distance

Repetitive DNA
Read 1Unique DNA 2
Read

Single read maps to
multiple posit...
Paired End Reads are Important!
Known Distance

Repetitive DNA
Read 1Unique DNA 2
Read

Single read maps to
multiple posit...
Second Generation DNA profiling

• Exome Sequencing (aka known as
targeted exome capture) is an
efficient strategy to sele...
Second Generation DNA profiling
Second Generation DNA profiling
Bioinformatics tools
Bioinformatics tools
Second Generation RNA profiling

Besides the 6000 protein coding-genes …
140 ribosomal RNA genes
275 transfer RNA gnes
40 ...
Second Generation RNA profiling

RNA genes can be hard to detects
UGAGGUAGUAGGUUGUAUAGU
C.elegans let-27; 21 nt
(Pasquinel...
Second Generation RNA profiling

Although details of the methods vary, the concept
behind RNA-seq is simple:
• isolate all...
Second Generation RNA profiling

• Comparing to microarray
– Microarray
• Closed technology: Prior knowledge required
• Af...
ncRNAs in human genome

tRNA
18S rRNA
5.8S rRNA
28S rRNA
5S rRNA
snoRNA
miRNA
U1
U2
U4
U5
U6
U4atac
U6atac
U11
U12

600
20...
Mapping Structural Variation in Humans
>1 kb segments
- Thought to be Common
12% of the genome
(Redon et al. 2006)
- Likel...
Size Distribution of CNV in a Human Genome
Next next generation sequencing
Third generation sequencing
Now sequencing
Ultra-low-cost SINGLE molecule sequencing
Pacific Biosciences: A Third Generation Sequencing Technology

Eid et al 2008
Complete genomics
Nanopore Sequencing
Second Generation Protein profiling

• Proteomics MS-MS-based
exclusively in discovery mode
• Automate diagnostics assay
g...
MS/MS identification
pipeline

pipeline overview

Bonanza

Bonanza + IggyPep

Goal
filter dataset
prior to
database
Goal
s...
Second Generation Protein profiling

• Proteomics MS-MS-based
exclusively in discovery mode
• Automate diagnostics assay
g...
Overview

Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation M...
Genome-wide methylation
…. by next generation sequencing
# markers

3 000 000

MethylCap_Seq

6 000
EpiHealth

50
Deep_Seq...
Molecular
Unification
E
P
I

Whole-genome
Bisulphite seq

G
E
N
E
T
I
C

Whole-genome
sequencing

Enrichment seq
(MBD, RRB...
Overview

Personalized Medicine,
Biomarkers …
… Molecular Profiling
First Generation Molecular Profiling
Next Generation M...
Bioinformatics, a life science discipline …

Math

Informatics

(Molecular)
Biology
Bioinformatics, a life science discipline …

Math

Computer Science

Theoretical Biology

Informatics
Computational Biolog...
Bioinformatics, a life science discipline …

Math

Theoretical Biology

Computer Science

Bioinformatics

Informatics
Comp...
Bioinformatics, a life science discipline … management of expectations

Math

Theoretical Biology

Computer Science
NP
Dat...
Bioinformatics, a life science discipline … management of expectations

Math

Theoretical Biology

Computer Science
NP
Dat...
Translational Medicine: An inconvenient truth

• 1% of genome codes for proteins, however
more than 90% is transcribed
• L...
Translational Medicine: An inconvenient truth

• 1% of genome codes for proteins, however
more than 90% is transcribed
• L...
Cellular programming

Epigenetic (meta)information = stem cells
Cellular reprogramming

Tumor
Tumor
Development
and
Growth

Epigenetically
altered, selfrenewing cancer
stem cells
Cellular reprogramming

Gene-specific
Epigenetic
reprogramming
Wobblebase Mission
provide tools to both specialists (researchers,
bioinformaticians, health care providers) and
individua...
PGM: Personal Genomics Manifesto

Everybody who wants to get his genome sequenced has the human right to do so.
No third p...
Wobblebase Mission
•

change the
diagnostic/healthcare industry
forever by setting a new
standard and empowering the
user
Choosing the Red Pill
The Technical Feasibility Argument
The Quality Argument
The Price Argument
The Logistics around the ...
Notifications
Updates are the single moste
important feature of Wobblebase
#Rs1805007
Bioinformatics
Analysis
pipelines

Social
network
twitter

Wobblebase

Updates
Notifications

eHealth
(fixed
vocabulary)
C...
biobix
wvcrieki

biobix.be
bioinformatics.be
108
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Genomics experimental-methods
Upcoming SlideShare
Loading in...5
×

Genomics experimental-methods

2,030

Published on

Genomics: experimental methods

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
2,030
On Slideshare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
38
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Transcript of "Genomics experimental-methods"

  1. 1. Genomics: Experimental methods Slides available www.bioinformatics.be
  2. 2. Lab for Bioinformatics and computational genomics 10 “genome hackers” mostly engineers (statistics) 42 scientists technicians, geneticists, clinicians >100 people hardware engineers, mathematicians, molecular biologists
  3. 3. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  4. 4. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  5. 5. Personalized Medicine • The use of diagnostic tests (aka biomarkers) to identify in advance which patients are likely to respond well to a therapy • The benefits of this approach are to – avoid adverse drug reactions – improve efficacy – adjust the dose to suit the patient – differentiate a product in a competitive market – meet future legal or regulatory requirements • Potential uses of biomarkers – Risk assessment – Initial/early detection – Prognosis – Prediction/therapy selection – Response assessment – Monitoring for recurrence
  6. 6. Biomarker First used in 1971 … An objective and « predictive » measure … at the molecular level … of normal and pathogenic processes and responses to therapeutic interventions Characteristic that is objectively measured and evaluated as an indicator of normal biologic or pathogenic processes or pharmacologic response to a drug A biomarker is valid if: – It can be measured in a test system with well established performance characteristics – Evidence for its clinical significance has been established
  7. 7. Rationale 1: Why now ? Regulatory path becoming more clear There is more at stake than efficient drug development. FDA « critical path initiative » Pharmacogenomics guideline Biomarkers are the foundation of « evidence based medicine » - who should be treated, how and with what. Without Biomarkers advances in targeted therapy will be limited and treatment remain largely emperical. It is imperative that Biomarker development be accelarated along with therapeutics
  8. 8. Why now ? First and maturing second generation molecular profiling methodologies allow to stratify clinical trial participants to include those most likely to benefit from the drug candidate—and exclude those who likely will not—pharmacogenomicsbased Clinical trials should attain more specific results with smaller numbers of patients. Smaller numbers mean fewer costs (factor 2-10) An additional benefit for trial participants and internal review boards (IRBs) is that stratification, given the correct biomarker, may reduce or eliminate adverse events.
  9. 9. Molecular Profiling The study of specific patterns (fingerprints) of proteins, DNA, and/or mRNA and how these patterns correlate with an individual's physical characteristics or symptoms of disease.
  10. 10. Generic Health advice • Exercise (Hypertrophic Cardiomyopathy) • Drink your milk (MCM6 Lactose intolarance) • Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency) • & your grains (HLA-DQ2 – Celiac disease) • & your iron (HFE - Hemochromatosis) • Get more rest (HLA-DR2 - Narcolepsy)
  11. 11. Generic Health advice (UNLESS) • Exercise (Hypertrophic Cardiomyopathy) • Drink your milk (MCM6 Lactose intolarance) • Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency) • & your grains (HLA-DQ2 – Celiac disease) • & your iron (HFE - Hemochromatosis) • Get more rest (HLA-DR2 - Narcolepsy)
  12. 12. Generic Health advice (UNLESS) • Exercise (Hypertrophic Cardiomyopathy) • Drink your milk (MCM6 Lactose intolerance) • Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency) • & your grains (HLA-DQ2 – Celiac disease) • & your iron (HFE - Hemochromatosis) • Get more rest (HLA-DR2 - Narcolepsy)
  13. 13. Generic Health advice (UNLESS) • Exercise (Hypertrophic Cardiomyopathy) • Drink your milk (MCM6 Lactose intolerance) • Eat your green beans (glucose-6-phosphate dehydrogenase Deficiency) • & your grains (HLA-DQ2 – Celiac disease) • & your iron (HFE - Hemochromatosis) • Get more rest (HLA-DR2 - Narcolepsy)
  14. 14. EGFR based therapy in mCRC
  15. 15. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  16. 16. Before molecular profiling …
  17. 17. Before molecular profiling …
  18. 18. Before molecular profiling …
  19. 19. First Generation Molecular Profiling • Flow cytometry correlates surface markers, cell size and other parameters • Circulating tumor cell assays (CTC’s) quantitate the number of tumor cells in the peripheral blood. • Exosomes are 30-90 nm vesicles secreted by a wide range of mammalian cell types. • Immunohistochemistry (IHC) measures protein expression, usually on the cell surface.
  20. 20. First Generation Molecular Profiling • Gene sequencing for mutation detection • Microarray for m-RNA message detection • RT-PCR for gene expression • FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for gene copy number
  21. 21. Basics of the ―old‖ technology • Clone the DNA. • Generate a ladder of labeled (colored) molecules that are different by 1 nucleotide. • Separate mixture on some matrix. • Detect fluorochrome by laser. • Interpret peaks as string of DNA. • Strings are 500 to 1,000 letters long • 1 machine generates 57,000 nucleotides/run • Assemble all strings into a genome.
  22. 22. Genetic Variation Among People Single nucleotide polymorphisms (SNPs) GATTTAGATCGCGATAGAG GATTTAGATCTCGATAGAG 0.1% difference among people
  23. 23. The genome fits as an e-mail attachment
  24. 24. First Generation Molecular Profiling • Gene sequencing for mutation detection • Microarray for m-RNA message detection • RT-PCR for gene expression • FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for gene copy number
  25. 25. mRNA Expression Microarray
  26. 26. First Generation Molecular Profiling • Gene sequencing for mutation detection • Microarray for m-RNA message detection • RT-PCR for gene expression • FISH analysis for gene copy number • Comparative Genome Hybridization (CGH) for gene copy number
  27. 27. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  28. 28. Basics of the ―new‖ technology • Get DNA. • Attach it to something. • Extend and amplify signal with some color scheme. • Detect fluorochrome by microscopy. • Interpret series of spots as short strings of DNA. • Strings are 30-300 letters long • Multiple images are interpreted as 0.4 to 1.2 GB/run (1,200,000,000 letters/day). • Map or align strings to one or many genome.
  29. 29. Next Generation Technologies • Roche (454) –Emulsion PCR –Polymerase –Natural Nucleotides • 100-500 Mb for 5-15k –1% error rate –Homopolymers
  30. 30. One additional insight ...
  31. 31. % of Paired K-mers with Uniquely Assignable Location Read Length is Not As Important For Resequencing 100% 90% 80% 70% 60% E.COLI 50% HUMAN 40% 30% 20% 10% 0% 8 Jay Shendure 10 12 14 16 18 20 Length of K-mer Reads (bp)
  32. 32. Short Read Techologies • Illumina GA (HiSeq, MySeq) • ABI SOLID
  33. 33. Other second generation technology: (ABI) SOLID
  34. 34. So what ?
  35. 35. Second generation DNA/RNA profiling
  36. 36. Second Generation DNA profiling • Enrichment Sequencing • ChIP-Seq (Chromosome Immunoprecipitation) • A substitute for ChIP-chip • Eg. to find the binding sequence of proteins (TFBS)
  37. 37. Paired End Reads are Important! Known Distance Repetitive DNA Read 1Unique DNA 2 Read Single read maps to multiple positions
  38. 38. Paired End Reads are Important! Known Distance Repetitive DNA Read 1Unique DNA 2 Read Single read maps to multiple positions
  39. 39. Second Generation DNA profiling • Exome Sequencing (aka known as targeted exome capture) is an efficient strategy to selectively sequence the coding regions of the genome to identify novel genes associated with rare and common disorders. • 160K exons
  40. 40. Second Generation DNA profiling
  41. 41. Second Generation DNA profiling
  42. 42. Bioinformatics tools
  43. 43. Bioinformatics tools
  44. 44. Second Generation RNA profiling Besides the 6000 protein coding-genes … 140 ribosomal RNA genes 275 transfer RNA gnes 40 small nuclear RNA genes >100 small nucleolar genes Contents-Schedule Function of RNA genes pRNA in 29 rotary packaging motor (Simpson et el. Nature 408:745-750,2000) Cartilage-hair hypoplasmia mapped to an RNA (Ridanpoa et al. Cell 104:195-203,2001) The human Prader-Willi ciritical region (Cavaille et al. PNAS 97:14035-7, 2000)
  45. 45. Second Generation RNA profiling RNA genes can be hard to detects UGAGGUAGUAGGUUGUAUAGU C.elegans let-27; 21 nt (Pasquinelli et al. Nature 408:86-89,2000) Often small Sometimes multicopy and redundant Often not polyadenylated (not represented in ESTs) Immune to frameshift and nonsense mutations No open reading frame, no codon bias Often evolving rapidly in primary sequence
  46. 46. Second Generation RNA profiling Although details of the methods vary, the concept behind RNA-seq is simple: • isolate all mRNA • convert to cDNA using reverse transcriptase • sequence the cDNA • map sequences to the genome The more times a given sequence is detected, the more abundantly transcribed it is. If enough sequences are generated, a comprehensive and quantitative view of the entire transcriptome of an organism or tissue can be obtained.
  47. 47. Second Generation RNA profiling • Comparing to microarray – Microarray • Closed technology: Prior knowledge required • Affected by pseudo-genes (homologous of real genes) • Low sensitivity – RNA-Seq • Open technology: No prior knowledge required • Not affected by pseudo-genes because exact sequence is measured • Other information could be yielded (SNP, Alternative splicing)
  48. 48. ncRNAs in human genome tRNA 18S rRNA 5.8S rRNA 28S rRNA 5S rRNA snoRNA miRNA U1 U2 U4 U5 U6 U4atac U6atac U11 U12 600 200 200 200 200 300 250 40 30 30 30 20 5 5 5 5 SRP RNA 1 RNase P RNA 1 Telomerase RNA 1 RNase MRP 1 Y RNA 5 Vault 4 7SK RNA 1 Xist 1 H19 1 BIC 1 Antisense RNAs 1000s? Cis reg regions Others 100s? ?
  49. 49. Mapping Structural Variation in Humans >1 kb segments - Thought to be Common 12% of the genome (Redon et al. 2006) - Likely involved in phenotype variation and disease CNVs - Until recently most methods for detection were low resolution (>50 kb)
  50. 50. Size Distribution of CNV in a Human Genome
  51. 51. Next next generation sequencing Third generation sequencing Now sequencing
  52. 52. Ultra-low-cost SINGLE molecule sequencing
  53. 53. Pacific Biosciences: A Third Generation Sequencing Technology Eid et al 2008
  54. 54. Complete genomics
  55. 55. Nanopore Sequencing
  56. 56. Second Generation Protein profiling • Proteomics MS-MS-based exclusively in discovery mode • Automate diagnostics assay generation (next generation proteomics) • Aptamers as alternative to antibodies • ImmunoPCR
  57. 57. MS/MS identification pipeline pipeline overview Bonanza Bonanza + IggyPep Goal filter dataset prior to database Goal search define PTMs profile prior to database search Goal multi-tiered database search
  58. 58. Second Generation Protein profiling • Proteomics MS-MS-based exclusively in discovery mode • Automate diagnostics assay generation (next generation proteomics) • Aptamers as alternative to antibodies • ImmunoPCR
  59. 59. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  60. 60. Genome-wide methylation …. by next generation sequencing # markers 3 000 000 MethylCap_Seq 6 000 EpiHealth 50 Deep_Seq 5 Discovery <50 only models and fresh frozen Verification Validation > 50 # samples CONFIDENTIAL
  61. 61. Molecular Unification E P I Whole-genome Bisulphite seq G E N E T I C Whole-genome sequencing Enrichment seq (MBD, RRBS) Probes (450-27K) Ultra Deep Enrichment Targeted Panels Enrichment seq (Exome) Enrichment Targeted Panels Deep Seq bp Full genome 109 108 RUO 107 106 105 104 103 Sequencing 102 101 1 Clinical CONFIDENTIAL
  62. 62. Overview Personalized Medicine, Biomarkers … … Molecular Profiling First Generation Molecular Profiling Next Generation Molecular Profiling Next Generation Epigenetic Profiling Concluding Remarks
  63. 63. Bioinformatics, a life science discipline … Math Informatics (Molecular) Biology
  64. 64. Bioinformatics, a life science discipline … Math Computer Science Theoretical Biology Informatics Computational Biology (Molecular) Biology
  65. 65. Bioinformatics, a life science discipline … Math Theoretical Biology Computer Science Bioinformatics Informatics Computational Biology (Molecular) Biology
  66. 66. Bioinformatics, a life science discipline … management of expectations Math Theoretical Biology Computer Science NP Datamining AI, Image Analysis structure prediction (HTX) Bioinformatics Interface Design Expert Annotation Sequence Analysis Informatics Computational Biology (Molecular) Biology
  67. 67. Bioinformatics, a life science discipline … management of expectations Math Theoretical Biology Computer Science NP Datamining AI, Image Analysis structure prediction (HTX) Bioinformatics Discovery Informatics – Computational Genomics Interface Design Expert Annotation Sequence Analysis Informatics Computational Biology (Molecular) Biology
  68. 68. Translational Medicine: An inconvenient truth • 1% of genome codes for proteins, however more than 90% is transcribed • Less than 10% of protein experimentally measured can be ―explained‖ from the genome • 1 genome ? Structural variation • > 200 Epigenomes ?? • Space/time continuum …
  69. 69. Translational Medicine: An inconvenient truth • 1% of genome codes for proteins, however more than 90% is transcribed • Less than 10% of protein experimentally measured can be ―explained‖ from the genome • 1 genome ? Structural variation • > 200 Epigenomes … • ―space/time‖ continuum
  70. 70. Cellular programming Epigenetic (meta)information = stem cells
  71. 71. Cellular reprogramming Tumor Tumor Development and Growth Epigenetically altered, selfrenewing cancer stem cells
  72. 72. Cellular reprogramming Gene-specific Epigenetic reprogramming
  73. 73. Wobblebase Mission provide tools to both specialists (researchers, bioinformaticians, health care providers) and individual consumers that unlock the power of genomic data to the USER enable personalized genomics today by simplifying the way we organize, visualize and manage genomic data.
  74. 74. PGM: Personal Genomics Manifesto Everybody who wants to get his genome sequenced has the human right to do so. No third party can own your genetic data, your genetic data is exclusively yours. Nobody can be forced to get his genome analyzed or to reveal his genome to a third party. Your genome should allways be treated as confidential, private information. People should be advised not to share their identity AND their entire genome on a public forum. People should be advised to use secure technologies that allow to maximally protect phenotypic and/or genotype data. People should be able to actively explore, manage and get updated interpretation on their genomic data.
  75. 75. Wobblebase Mission • change the diagnostic/healthcare industry forever by setting a new standard and empowering the user
  76. 76. Choosing the Red Pill The Technical Feasibility Argument The Quality Argument The Price Argument The Logistics around the sample on howto manage the data Argument The Ethical debate The Privacy/Security concern
  77. 77. Notifications Updates are the single moste important feature of Wobblebase
  78. 78. #Rs1805007
  79. 79. Bioinformatics Analysis pipelines Social network twitter Wobblebase Updates Notifications eHealth (fixed vocabulary) Comparison
  80. 80. biobix wvcrieki biobix.be bioinformatics.be 108
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×