Bioinformatica 27-10-2011-p4-files

FBW 29-10-2008 Wim Van Criekinge

Programming
Variables
Flow control (if, regex …)
Loops
input/output
Subroutines/object

Three Basic Data Types
Scalars - $
Arrays of scalars - @
Associative arrays of scalers or Hashes - %

[m]/PATTERN/[g][i][o]
s/PATTERN/PATTERN/[g][i][e][o]
tr/PATTERNLIST/PATTERNLIST/[c][d][s]

The ‘structure’ of a Hash
An array looks something like this:
A hash looks something like this:
@array =
Index Value Key (name) Value
%phone =

First, create a list of keys. Fortunately, there is a function for that:
keys %hash (returns a list of keys)
Next, visit each key and print its associated value:
foreach (keys %hash){
print “The key $_ has the value $hash{$_}n”;
}
One complication. Hashes do not maintain any sort of order. In other words, if you put key/value pairs into a hash in a particular order, you will not get them out in that order!!
Printing a hash (continued)

my %AA1 = (
'UUU','F',
'UUC','F',
'UUA','L',
'UUG','L',
'UCU','S',
'UCC','S',
'UCA','S',
'UCG','S',
'UAU','Y',
'UAC','Y',
'UAA','*',
'UAG','*',
'UGU','C',
'UGC','C',
'UGA','*',
'UGG','W',
'CUU','L',
'CUC','L',
'CUA','L',
'CUG','L',
'CCU','P',
'CCC','P',
'CCA','P',
'CCG','P',
'CAU','H',
'CAC','H',
'CAA','Q',
'CAG','Q',
'CGU','R',
'CGC','R',
'CGA','R',
'CGG','R',
'AUU','I', 'AUC','I', 'AUA','I', 'AUG','M', 'ACU','T', 'ACC','T', 'ACA','T', 'ACG','T', 'AAU','N', 'AAC','N', 'AAA','K', 'AAG','K', 'AGU','S', 'AGC','S', 'AGA','R', 'AGG','R', 'GUU','V', 'GUC','V', 'GUA','V', 'GUG','V', 'GCU','A', 'GCC','A', 'GCA','A', 'GCG','A', 'GAU','D', 'GAC','D', 'GAA','E', 'GAG','E', 'GGU','G', 'GGC','G', 'GGA','G', 'GGG','G' );

There is more than one right way to do it. Unfortunately, there are also many wrong ways.
1. Always check and make sure the output is correct and logical
Consider what errors might occur, and take steps to ensure that you are accounting for them.
2. Check to make sure you are using every variable you declare.
Use Strict !
3. Always go back to a script once it is working and see if you can eliminate unnecessary steps.
Concise code is good code.
You will learn more if you optimize your code.
Concise does not mean comment free. Please use as many comments as you think are necessary.
Sometimes you want to leave easy to understand code in, rather than short but difficult to understand tricks. Use your judgment.
Remember that in the future, you may wish to use or alter the code you wrote today. If you don’t understand it today, you won’t tomorrow.
Programming in general and Perl in particular

Develop your program in stages. Once part of it works, save the working version to another file (or use a source code control system like RCS) before continuing to improve it.
When running interactively, show the user signs of activity. There is no need to dump everything to the screen (unless requested to), but a few words or a number change every few minutes will show that your program is doing something.
Comment your script. Any information on what it is doing or why might be useful to you a few months later.
Decide on a coding convention and stick to it. For example,
for variable names, begin globals with a capital letter and privates (my) with a lower case letter
indent new control structures with (say) 2 spaces
line up closing braces, as in: if (....) { ... ... }
Add blank lines between sections to improve readibility
Programming in general and Perl in particular

>ultimate-sequence
ACTCGTTATGATATTTTTTTTGAACGTGAAAATACTTTTCGTGCTATGGAAGGACTCGTTATCGTGAAGTTGAACGTTCTGAATGTATGCCTCTTGAAATGGAAAATACTCATTGTTTATCTGAAATTTGAATGGGAATTTTATCTACAATGTTTTATTCTTACAGAACATTAAATTGTGTTATGTTTCATTTCACATTTTAGTAGTTTTTTCAGTGAAAGCTTGAAAACCACCAAGAAGAAAAGCTGGTATGCGTAGCTATGTATATATAAAATTAGATTTTCCACAAAAAATGATCTGATAAACCTTCTCTGTTGGCTCCAAGTATAAGTACGAAAAGAAATACGTTCCCAAGAATTAGCTTCATGAGTAAGAAGAAAAGCTGGTATGCGTAGCTATGTATATATAAAATTAGATTTTCCACAAAAAATGATCTGATAA

File input / output
Opening a filehandle
In order to use a filehandle other than STDIN, STDOUT and STDERR, the filehandle needs to be opened. The open function opens a file or device and associates it with a filehandle.
It returns 1 upon success and undef otherwise.
Examples
# open a filehandle for reading: open (SOURCE_FILE, "filename");
# or open (SOURCE_FILE, "<filename");
# open a filehandle for writing: open (RESULT_FILE, ">filename");
# open a filehandle for appending: open (LOGFILE, ">>filename";

File input / output
Closing a filehandle
When you are finished with a filehandle, you may close it with the close function. The close function closes the file or device associated with the filehandle.
Example:
close (MY_FILE_HANDLE); Filehandles are automatically closed when the program exits, or when the filehandle is reopened.

File input / output
The die function
Sometimes the open function fails. For example, opening a file for input might fail because the file does not exist, and opening a file for output might fail because the file does not have a write permission. A perl program will nevertheless use the filehandle, and will not warn you that all input and output activities are actually meaningless.
Therefore, it is recommended to explicitly check the result of the open command, and if it fails to print an error message and exit the program.
This is easily done using the die function.
Example:
my $k = open (FILEHANDLE, "filename"); unless ($k) { die ( "cannot open file filename: $!" ) ; } # in case file "filename" cannot be opened, # the argument of die will be printed on # the screen and the program will exit. # $! is a special variable that contains the respective # error message sent by the operating system.. A short hand:
open (FILEHANDLE, "filename") || die "cannot open file filename: $!";

Using filehandles for writing
Example:
#!/usr/local/bin/perl use strict;
use warnings;
open (OUTF, ">out_file") || die "cannot open out_file: $!"; open (LOGF, ">>log_file") || die "cannot open log_file: $!";
print OUTF "Here is my program outputn";
print LOGF "First task of my program completedn";
print "Nice, isn't it?n"; # will be printed on the screen close (OUTF);
close (LOGF);

When <FILEHANDLE> is assigned into an array variable, all lines up to the end of the file are read at once. Each line becomes a separate element of the array.
#!/usr/local/bin/perl
use strict;
use warnings;
my $infile = "CEACAM3.txt";
open (FH, $infile) || die "cannot open "$infile": $!";
my @lines = <FH>;
chomp (@lines); # chomp each element of @lines
close (FH);
# to process the lines you might wish to iterate
# over the @lines array with a foreach loop:
my $line;
foreach $line (@lines) {
# process $line. here we just print it.
print "$linen";
}
Using filehandles for reading (2/3)

use strict;
use warnings;
my ($line1, $line2, $line3);
$line1 = <FH>; # read first line
print $line1; # proccess line (here we only print it)
$line2 = <FH>; # read next line
$line3 = <FH>; # read next line
close (FH);

Using a while loop, read one line at a time and assign it into a scalar variable, as long as the variable is not an empty string (which will happen at end-of-file).
Note that a blank line read from the file will not result in an empty string, since it still contains the terminating n.
use strict;
use warnings;
my $line; # or, in one line:
while ($line = <FH>) { # while (my $line = <FH>) {
chomp ($line);
print "$linen"; # process line. here we just print it.
}
close (FH);

Demo: Prosite Parser

1. Swiss-Knife.pl
Database
http://www.ebi.ac.uk/swissprot/FTP/ftp.html
How many entries are there ?
Average Protein Length (in aa and MW)
Relative frequency of amino acids
Compare to the ones used to construct the PAM scoring matrixes from 1978 – 1991

Amino acid frequencies
1978 1991
L 0.085 0.091
A 0.087 0.077
G 0.089 0.074
S 0.070 0.069
V 0.065 0.066
E 0.050 0.062
T 0.058 0.059
K 0.081 0.059
I 0.037 0.053
D 0.047 0.052
R 0.041 0.051
P 0.051 0.051
N 0.040 0.043
Q 0.038 0.041
F 0.040 0.040
Y 0.030 0.032
M 0.015 0.024
H 0.034 0.023
C 0.033 0.020
W 0.010 0.014
Second step: Frequencies of Occurence

Parser.pl
#! C:Perlbinperl.exe -w
# (Vergeet niet het pad van perl.exe hierboven aan te passen aan de plaats op je eigen computer)
# Voorbeeld van het gebruik van substrings en files
# in een parser van sequentie-informatie-records
use strict;
use warnings;
my ($sp_file,$line,$id,$ac,$de);
$sp_file= "sp.txt";
open (SP,$sp_file) || die "cannot open "$sp_file":$!";
while ($line=<SP>){
chomp($line);
my $field = substr ($line,0,2);
my $value = substr ($line,5);
if ($field eq "ID"){e
$id = $value
}
if ($field eq "AC"){
$ac = $value
}
if ($field eq "DE"){
$de = $value
}
}
print "Identification: $idn";
print "Accession No.: $acn";
print "Description: $den";

2. PAM-simulator.pl
Check transition matrix with and without randomizing the rows of evolutions
Adapt the program to simulate evolving DNA
Adapt the program so it generates random proteins taking into account the relative frequences found in step 1
Write the output to a multi-fasta file
>PAM1
AHFALKJHFDLKFJHALSKJFH
>PAM2
AHGALKJHFDLKFJHALSKJFH
>PAM3
AHGALKJHFDLKFJHALSKJFH
… ..

Initialize:
Generate Random protein (1000 aa)
Simulate evolution (eg 250 for PAM250)
Apply PAM1 Transition matrix to each amino acid
Use Weighted Random Selection
Iterate
Measure difference to orginal protein
Experiment: pam-simulator.pl

Dayhoff’s PAM1 mutation probability matrix (Transition Matrix)

Weighted Random Selection
Ala => Xxx (%)

PAM-Simulator

3. Palindromes
What is the longest palindroom in palin.fasta ?
Why are restriction sites palindromic ?
How long is the longest palindroom in the genome ?
Hints: http://www.man.poznan.pl/cmst/papers/5/art_2/vol5art2.html
Palingram.pl

Palin.fasta
>palin.fasta
ATGGCTTATTTATTTGCCCACAAGAACTTAGGTGCATTGAAATCTAAAGCTAATTGCTTATTTAGCTTTGCTTGGCCTTTTCACTTAAATAAAACATAGCATCAACTTCAGCAGGAATGGGTGCACATGCTGATCGAGGTGGAAGAAGGGCACATATGGCATCGGCATCCTTATGGCTAATTTTAAATGGAGAACTTTCTAAAGTCACGTTTTCACATGCAATATTCTTAACATTTTCAATTTTTTTTGTAACTAATTCTTCCCATCTACTATGTGTTTGCAAGACAATCTCAGTAGCAAACTCCTTATGCTTAGCCTCACCGTTAAAAGCAAACTTATTTGGGGGATCTCCACCAGGCATTTTATATATTTTGAACCACTCTACTGACGCGTTAGCTTCAAGTAAACCAGGCATCACTTCTTTTACGTCATCAATATCATTAAGCTTTGAAGCTAGAGGATCATTTACATCAATTGCTATTACTTAGCTTAGCCCTTCAAGTACTTGAAGGGCTAAGCTTCCAATCTGTTTCACCATTGTCAATCATAGCTAAGACACCCAGCAACTTAACTTGCAAAACAGATCCTCTTTCTGCAACTTTGTAACCTATCTCTATTACATCAACAGGATCACCATCACCAAATGCATTAGTGTGCTCATCAATAAGATTTGGATCCTCCCAAGTCTGTGGCAAAGCTCCATAATTCCAAGGATAACC

Palingram.pl
#!E:perlbinperl -w
$line_input = "edellede parterretrap trap op sirenes en er is popart test";
$line_input =~ s/s//g;
$l = length($line_input);
for ($m = 0;$m<=$l-1;$m++)
{
$line = substr($line_input,$m);
print "length=$m:$lt".$line."n";
for $n (8..25)
{
$re = qr /[a-z]{$n}/;
print "pattern ($n) = $ren";
$regexes[$n-8] = $re;
}
foreach (@regexes)
{
while ($line =~ m/$_/g)
{
$endline = $';
$match = $&;
$all = $match.$endline;
$revmatch = reverse($match);
if ($all =~ /^($revmatch)/)
{
$palindrome = $revmatch . "*" . $1 ;
$palhash{$palindrome}++;
}
}
}
}
print "Set van palingramn"; while(($key, $value) = each (%palhash)) { print "$key => $valuen"; }

Bioinformatica 27-10-2011-p4-files

by wvcrieki

Accessibility

Categories

Upload Details

Usage Rights

1 Embed 1

Statistics

Bioinformatica 27-10-2011-p4-files Presentation Transcript