Joris Veltman

927 views

Published on

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
927
On SlideShare
0
From Embeds
0
Number of Embeds
4
Actions
Shares
0
Downloads
7
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Joris Veltman

  1. 1. Joris Veltman<br />(onderzoeker)<br />
  2. 2. Personalized genomic medicine<br />Joris Veltman<br />j.veltman@antrg.umcn.nl<br />www.genomicdisorders.nl<br />
  3. 3. Het probleem; Ineffectieve medicijnen!<br />
  4. 4. 1953<br />
  5. 5. Het humane genoom<br />receptenboek voor leven<br />6 miljard bouwstenen<br />2001<br />
  6. 6.
  7. 7. NIJMEGEN INTERNATIONALE EXPERT ERFELIJKE ZIEKTEN<br />VCAN<br />CFH<br />CHM<br />USH2Aisob<br />RPGRIP1<br />TECTA<br />NDP<br />EHMT1<br />EYS<br />MYCN<br />FXYD2<br />DFNB59 <br />TSPAN12<br />ABCA4<br />CDH7<br />ESRRB<br />P63<br />LARGE<br />PDE6C<br />SETBP1<br />RPGRIP1L<br />OFD1<br />17Q21<br />LRTOMT<br />TKS4<br />IKAROS<br />MAOA<br />SS18/SSX<br />CEP290<br />SENP1/MESDC2<br />ZNF674<br />CNTNAP2<br />GRXCR1 <br />TET2<br />CRB1<br />PRPS1<br />TBX4<br />RPGR<br />TRPN<br />L1/L2<br />LCA5<br />ROR2<br />EPCAM<br />COL4A3<br />
  8. 8. Complexiteit genonderzoek beperkt klinische impact!<br />Fout in bouwstenen DNA ? OF Fout in aantal chromosomen?<br />
  9. 9. Genomics wordt spotgoedkoop!<br />Kosten in kaart brengen 1 genoom<br />
  10. 10. Genoomdiagnostiek in 2015 <br />DNA<br />?<br />Genoomsequentie<br />< 1 uur<br />< 500 euro<br />
  11. 11. Nijmegen investeert in genoomsequencing<br />Roche, GS FLX Titanium<br />Since 11-2008<br />Life Technologies, SOLiD<br />Since 9-2009<br />
  12. 12. Van sequentie tot genoom:Veel puzzelwerk<br />Miljoenen korte sequenties per individu<br />Supercomputers en <br />Bioinformatica expertise!<br />Totale genoomsequentie 1 individu<br />
  13. 13. ACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAGTCGA<br />ATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCACA<br />CGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGA<br />TCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGCGGGGCAAACGCACCG<br />GCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCCAACCAC<br />GCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAATCGATCGATCGA<br />ATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCGCGCTCG<br />CTAGCTAGCTAGCTACGATACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTACGATCG<br />GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGTCGT<br />CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCACTCGCTA<br />CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCAGCTAGCTAGCTC<br />CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAAGCT<br />GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACGC<br />GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACACT<br />CACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATTCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGAC<br />GCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCACT<br />GCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAATCGATCGCG<br />ATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCGCGCTCGGCT<br />CTAGCTAGCTAGCTACGATACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGA<br />GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGGAC<br />CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCATCG<br />CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCATC<br />CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACGA<br />GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAATC<br />GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCCAC<br />CACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATTCGCGCGGGGGCAAACGCACCAACCACCACAGCGGGGGCAAAGGGGCCAA<br />GCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAATCGATCGAAACGCAC<br />ATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGCGCGCTCGGTGC<br />CTAGCTAGCTAGCTACGATACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGAT<br />GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACG<br />CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCAAGC<br />CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCATTAGCTA<br />CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAAACG<br />GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACCC<br />GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACTCGA<br />CACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGAT TCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCCAACT<br />GCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCT<br />GCTAGCTAGCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGTCGT<br />CACCAACCACCACAGTCGCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGGCAAACGCACCAACCACCACTCGCTA<br />CAGTCGATCGATCGATCGATCGCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCAGCTAGCTAGCTC<br />CCAACCACCACAGCGGGGGCAAAGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTAAGCT<br />GCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACCACCACAGTCGATCGATCGATCGATCGCGCTCGCTAGCTAGCTACGC<br />GCTACGATCGAATCGATCGATCGATCGCGCTCGCTAGCTAGCTAGCTACGATCGAACTCGCTCGCGCGGGGGCAAACGCACCAACACT<br />
  14. 14. NRC 13 feb 2010<br />
  15. 15. Personal genomics en impact op geneeskunde<br />
  16. 16. Waarom reageren mensen verschillend op medicijnen?Oftewel: Hoe verschillend zijn ze nu echt?<br />5,999 miljard<br />overeenkomsten<br />1 miljoen <br />verschillen<br />
  17. 17.
  18. 18. Wie ben ik en wat zijn mijn gezondheidsrisoco’s?<br />Hoe zit het bij mij?<br />
  19. 19.
  20. 20. Een ander probleem; Recessieve ziekten<br />Kans op<br />dragerschap<br />1: 1000<br />Kans op<br />dragerschap<br />1: 1000<br />Indien beide drager<br />Dan kans van 1 op 4!<br />Kans op ziekte<br />1: 4,000,000<br />
  21. 21. Personalizedmedicine and the role of genomics<br />PERSONALIZED GENOMIC MEDICINE<br />DE TOEKOMST VAN DE GENEESKUNDE!<br />
  22. 22. THANK YOU !<br />
  23. 23. NEXT<br />

×