• Save
secuenciación por el medoto de sanger
Upcoming SlideShare
Loading in...5
×
 

secuenciación por el medoto de sanger

on

  • 738 views

Secuenciación por el método de Sanger, método automático y método de pirosecuenciación

Secuenciación por el método de Sanger, método automático y método de pirosecuenciación

Statistics

Views

Total Views
738
Slideshare-icon Views on SlideShare
738
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    secuenciación por el medoto de sanger secuenciación por el medoto de sanger Presentation Transcript

    • SECUENCIACION DE ADN(METODO DE SANGER,MÉTODO AUTOMÁTICO Y PIROSECUENCIACION)UNIVERSIDAD DEL ATLANTICOBIOLOGIA MOLECULARGRUPO #2
    • :Secuenciación por el método de Sanger,método automático y método depirosecuenciación
    • OBJETIVOS• Explicar losconceptos desecuenciación deADN por el métodode Sanger.• Identificar elmétodo de Sangercomo técnica propiade la ingenieríagenética en ladeterminación de lasecuencia de ADN.
    • INTRODUCCION• La secuenciación de ADN es un conjunto demétodos y técnicas utilizadas tanto biológicacomo químicamente para determinar el orden delos nucleótidos en un oligonucleótido.• El método de secuenciación ideado por Sanger estábasado en el empleo dideoxinucleótidos quecarecen de uno de los grupos hidroxilo
    • COMPUESTOS NECESARIOS PARAOBTENER LAS BASES NITROGENADAS- El ADN molde o segmento que se deseasecuenciar.- Una enzima que replique el ADN.- Un cebador o primer.- Los cuatro nucleótidos trifosfato (dATP,dCTP, dGTP y dTTP).- Por último, se necesitan nucleótidosdidesoxi (ddATP, ddTTP, ddCTP y ddGTP)
    • cebador desoxinucleotidos didesoxinucleótidos
    • PROCESO DE SECUENCIACIONDE ADNEn primer lugar, deben realizarse encuatro tubos diferentes, cuatromezclas de reacción.se producen una serie de moléculasde ADN de nueva síntesis dediferente longitud que terminantodas en el mismo nucleótidoLos fragmentos de ADN de nuevasíntesis obtenidos en cada mezclade reacción se separan por tamañosmediante electroforesis en gelesUna vez terminada la electroforesis,el gel se pone en contacto con unapelícula fotográfica deautorradiografía
    • 1 23 4
    • Teniendo en cuenta que el ADN de nueva síntesis crece en la dirección 5 3, sicomenzamos a leer el gel por los fragmentos de menor tamaño (extremo 5) y avanzamosaumentando el tamaño de los fragmentos (hacia 3), obtendremos la secuencia del ADN denueva síntesis en la dirección 5 3.
    • La Reacción con ddATP5’TTATCG3’AATAGCATGGTACTGATCTTACGCTAT5’5’TTATCGTACCATGACTAGATGCGA5’TTATCGTACCA5’TTATCGTACCATGACTA5’TTATCGTA5’TTATCGTACCATGA5’TTATCGTACCATGACTAGATGCGATA5’TTATCGTACCATGACTAGAPol.5’TTATCGTA Ya nopuedes!Pol.5’TTATCGTACCATGAOtravez!Pol.5’TTATCGTACCATGACTAGANoDe nuevo!Pol.5’TTATCGTACCATGACTAGATGCGATAA que la!
    • GRACIAS…