secuenciación por el medoto de sanger

1,544 views
1,229 views

Published on

Secuenciación por el método de Sanger, método automático y método de pirosecuenciación

Published in: Education
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
1,544
On SlideShare
0
From Embeds
0
Number of Embeds
4
Actions
Shares
0
Downloads
0
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

secuenciación por el medoto de sanger

  1. 1. SECUENCIACION DE ADN(METODO DE SANGER,MÉTODO AUTOMÁTICO Y PIROSECUENCIACION)UNIVERSIDAD DEL ATLANTICOBIOLOGIA MOLECULARGRUPO #2
  2. 2. :Secuenciación por el método de Sanger,método automático y método depirosecuenciación
  3. 3. OBJETIVOS• Explicar losconceptos desecuenciación deADN por el métodode Sanger.• Identificar elmétodo de Sangercomo técnica propiade la ingenieríagenética en ladeterminación de lasecuencia de ADN.
  4. 4. INTRODUCCION• La secuenciación de ADN es un conjunto demétodos y técnicas utilizadas tanto biológicacomo químicamente para determinar el orden delos nucleótidos en un oligonucleótido.• El método de secuenciación ideado por Sanger estábasado en el empleo dideoxinucleótidos quecarecen de uno de los grupos hidroxilo
  5. 5. COMPUESTOS NECESARIOS PARAOBTENER LAS BASES NITROGENADAS- El ADN molde o segmento que se deseasecuenciar.- Una enzima que replique el ADN.- Un cebador o primer.- Los cuatro nucleótidos trifosfato (dATP,dCTP, dGTP y dTTP).- Por último, se necesitan nucleótidosdidesoxi (ddATP, ddTTP, ddCTP y ddGTP)
  6. 6. cebador desoxinucleotidos didesoxinucleótidos
  7. 7. PROCESO DE SECUENCIACIONDE ADNEn primer lugar, deben realizarse encuatro tubos diferentes, cuatromezclas de reacción.se producen una serie de moléculasde ADN de nueva síntesis dediferente longitud que terminantodas en el mismo nucleótidoLos fragmentos de ADN de nuevasíntesis obtenidos en cada mezclade reacción se separan por tamañosmediante electroforesis en gelesUna vez terminada la electroforesis,el gel se pone en contacto con unapelícula fotográfica deautorradiografía
  8. 8. 1 23 4
  9. 9. Teniendo en cuenta que el ADN de nueva síntesis crece en la dirección 5 3, sicomenzamos a leer el gel por los fragmentos de menor tamaño (extremo 5) y avanzamosaumentando el tamaño de los fragmentos (hacia 3), obtendremos la secuencia del ADN denueva síntesis en la dirección 5 3.
  10. 10. La Reacción con ddATP5’TTATCG3’AATAGCATGGTACTGATCTTACGCTAT5’5’TTATCGTACCATGACTAGATGCGA5’TTATCGTACCA5’TTATCGTACCATGACTA5’TTATCGTA5’TTATCGTACCATGA5’TTATCGTACCATGACTAGATGCGATA5’TTATCGTACCATGACTAGAPol.5’TTATCGTA Ya nopuedes!Pol.5’TTATCGTACCATGAOtravez!Pol.5’TTATCGTACCATGACTAGANoDe nuevo!Pol.5’TTATCGTACCATGACTAGATGCGATAA que la!
  11. 11. GRACIAS…

×