RML NCBI Resources

907 views
777 views

Published on

NCBI has developed a powerful suite of online biomedical and bioinformatics resources, including old friends like PubMed and OMIM and newer resources such as Genome. This collection of databases and tools are widely used by scientists and medical professionals across the world. With such a wealth of information, it is easy to get overwhelmed. Join us for an overview to NCBI resources for the information professional with an emphasis on biodata connectivity. No science degree required!

Published in: Education, Technology
0 Comments
3 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
907
On SlideShare
0
From Embeds
0
Number of Embeds
75
Actions
Shares
0
Downloads
0
Comments
0
Likes
3
Embeds 0
No embeds

No notes for slide
  • DNA fingerprint of M. tuberculosis
  • Nathan Sawaya, LEGO Artist
  • Nathan Sawaya, LEGO Artist
  • About 4000 major organisms vs. the 250,000 that are present in all of GenBank
  • Figure ©1979 by T. C. Hsu; all text material ©2007 by Steven M. Carr
  • http://survivingtheworkday.com
  • http://survivingtheworkday.com
  • http://survivingtheworkday.com
  • www.biojobblog.com
  • www.biojobblog.com
  • www.biojobblog.com
  • Crystal structure of putative aminotransferase (YP_614685.1) from SILICIBACTER SP. TM1040 at 1.80 A resolution. To be published
  • http://www.therealtimscott.com/twas-information-overload-killed-business-dear-watson/
  • cba-ramblings.blogspot.com
  • cba-ramblings.blogspot.com
  • cba-ramblings.blogspot.com
  • http://www.alz.org/alzheimers_disease_4719.asp
  • http://www.alz.org/alzheimers_disease_4719.asp
  • Reference Sequence How people access Expresseion Genomic assemblies maps region in map viewer look at gene cluster on ch19 compare across two other genomes Polymorphisms Genotypes reference HuRef Homologus Blast – panda Genome Reference Consortium human
  • Reference Sequence How people access Expresseion Genomic assemblies maps region in map viewer look at gene cluster on ch19 compare across two other genomes Polymorphisms Genotypes reference HuRef Homologus Blast – panda Genome Reference Consortium human
  • Reference Sequence How people access Expresseion Genomic assemblies maps region in map viewer look at gene cluster on ch19 compare across two other genomes Polymorphisms Genotypes reference HuRef Homologus Blast – panda Genome Reference Consortium human
  • OMIM OMIM Link         HGNC         HGNC Listing sv         Sequence View pr         Proteins dl         Download sequence region: corresponding contig region ev Evidence viewer mm         Model Maker hm         Homologene STS UniSTS SNP         SNPs linked to gene
  • OMIM OMIM Link         HGNC         HGNC Listing sv         Sequence View pr         Proteins dl         Download sequence region: corresponding contig region ev Evidence viewer mm         Model Maker hm         Homologene STS UniSTS SNP         SNPs linked to gene
  • Takes expresed sequences and clusters together based on sequence similarity Cluster should REPRESENT an expressed gene
  • Virtual northern blog
  • http://www.petwebsite.com/rabbits/rabbit_care.htm
  • Changes howprotein is processed, not so much structure Color by hydrophobicity!! When interact with lipid, interior partilaly unfolds to interact with lipid.
  • http://www.alz.org/alzheimers_disease_4719.asp
  • http://www.alz.org/alzheimers_disease_4719.asp
  • http://www.alz.org/alzheimers_disease_4719.asp
  • http://www.alz.org/alzheimers_disease_4719.asp
  • RML NCBI Resources

    1. 1. NCBI Tools for Information andScientific Discovery July 25, 2012 RML Rendezvous webcast Jackie Wirz, PhD
    2. 2. Welcome to RML Rendezvous • *6 to mute your phone, especially for noisy backgrounds, *6 also unmutes • Please don’t place your phone on hold • Feel free to ask public questions via phone or ‘Everyone’ in chat box • For private questions, select ‘Presenters’ from the chat box •Additional questions?
    3. 3. Where are you from?https://www.surveymonkey.com/s/PNRinfo•USA - ZIP code, international – country name•Click as many job categories as apply•Used for demographics reporting onlyThank you!
    4. 4. 1. databases2. discovery!3. real example4. poll/Q&A
    5. 5. asdfsciencecan becomplex
    6. 6. sciencecan beamazing
    7. 7. scienceis aboutdiscovery
    8. 8. NCBIis aboutdiscovery
    9. 9. NCBI
    10. 10. NCBI “ ...advances science and health by providing ” access to biomedical and genomic information
    11. 11. NCBI Sequences Expression Genome maps Structures Protein Domains Homology (gene, protein, structure) Pathways Genetic Variation
    12. 12. NCBIhttp://www.ncbi.nlm.nih.gov/
    13. 13. NCBIhttp://www.ncbi.nlm.nih.gov/gquery/
    14. 14. NCBI
    15. 15. NCBI
    16. 16. NCBI?
    17. 17. NCBItoolsdatabases
    18. 18. NCBItoolsdatabases
    19. 19. NCBItools ( nex t ti medatabases
    20. 20. databases
    21. 21. databases
    22. 22. databases**a brief survey of selected dbs
    23. 23. 1literature
    24. 24. PubMedBookshelfOMIM
    25. 25. PubMedhttp://www.ncbi.nlm.nih.gov/pubmed 21,953,042 2,491,646 5,632
    26. 26. PubMed 21,953,042 2,491,646 5,632http://blogs.discovermagazine.com/discoblog/category/ncbi-rofl/ 1
    27. 27. Bookshelfhttp://www.ncbi.nlm.nih.gov/books 1027
    28. 28. Bookshelf
    29. 29. OMIMhttp://www.ncbi.nlm.nih.gov/omim
    30. 30. OMIM
    31. 31. Lesch-NyhanOMIM
    32. 32. Lesch-NyhanOMIM
    33. 33. PubMedBookshelfOMIM
    34. 34. 2 sequences
    35. 35. NucleotideGenBankRefSeq
    36. 36. DNA RNA Protein
    37. 37. NCBI
    38. 38. NCBI
    39. 39. NCBI SNPDatabasesPrimary GEO GenBank Protein
    40. 40. http://www.ncbi.nlm.nih.gov/nuccore
    41. 41. attggctgccgcgcggggcggggagcggggtcggctcagtggccctgagaccctagctctgctctcggtccgctcgctgtccgctagcccgctgcgatgttgcgcgctgccgcccgcttcgggccccgcctgggccgccgcctcttgtcagccgccgccacccaggccgtgcctgcccccaaccagcagcccgaggtcttctgcaaccagattttcataaacaatgaatggcacgatgccgtcagcaggaaaacattccccaccgtcaatccgtccactggagaggtcatctgtcaggtagctgaaggggacaaggaagatgtggacaaggcagtgaaggccgcccgggccgccttccagctgggctcaccttggcgccgcatggacgcatcacacaggggccggctgctgaaccgcctggccgatctgatcgagcgggaccggacctacctggcggccttggagaccctggacaatggcaagccctatgtcatctcctacctggtggatttggacatggtcctcaaatgtctccggtattatgccggctgggctgataagtaccacgggaaaaccatccccattgacggagacttcttcagctacacacgccatgaacctgtgggggtgtgcgggcagatcattccgtggaatttcccgctcctgatgcaagcatggaagctgggcccagccttggcaactggaaacgtggttgtgatgaaggtagctgagcagacacccctcaccgccctctatgtggccaacctgatcaaggaggctggctttccccctggtgtggtcaacattgtgcctggatttggccccacggctggggccgccattgcctcccatgaggatgtggacaaagtggcattcacaggctccactgagattggccgcgtaatccaggttgctgctgggagcagcaacctcaagagagtgaccttggagctgggggggaagagccccaacatcatcatgtcagatgccgatatggattgggccgtggaacaggcccacttcgccctgttcttcaaccagggccagtgctgctgtgccggctcccggaccttcgtgcaggaggacatctatgatgagtttgtggagcggagcgttgcccgggccaagtctcgggtggtcgggaacccctttgatagcaagaccgagcaggggccgcaggtggatgaaactcagtttaagaagatcctcggctacatcaacacggggaagcaagagggggcgaagctgctgtgtggtgggggcattgctgctgaccgtggttacttcatccagcccactgtgtttggagatgtgcaggatggcatgaccatcgccaaggaggagatcttcgggccagtgatgcagatcctgaagttcaagaccatagaggaggttgttgggagagccaacaattccacgtacgggctggccgcagctgtcttcacaaaggatttggacaaggccaattacctgtcccaggccctccaggcgggcactgtgtgggtcaactgctatgatgtgtttggagcccagtcaccctttggtggctacaagatgtcggggagtggccgggagttgggcgagtacgggctgcaggcatacactgaagtgaaaactgtcacagtcaa GenBankagtgcctcagaagaactcataagaatcatgcaagcttcctccctcagccattgatggaaagttcagcaagatcagcaacaaaaccaagaaaaatgatccttgcgtgctgaatatctgaaaagagaaatttttcctacaaaatctcttgggtcaagaaagttctagaatttgaattgataaacatggtgggttggctgagggtaagagtatatgaggaaccttttaaacgacaacaatactgctagctttcaggatgatttttaaaaaatagattcaaatgtgttatcctctctctgaaacgcttcctataactcgagtttataggggaagaaaaagctattgtttacaattatatcaccattaaggcaactgctacaccctgctttgtattctgggctaagattcattaaaaactagctgctcttaacttacaaaaaaaaaaaa
    42. 42. GenBank FormatGenBank
    43. 43. LOCUS Locus name, size, type, division, modification date Search tips: Locus names can change! Division names are historical, not taxonomical!
    44. 44. DEFINITION As the author sees fit… Search tip: No Controlled Vocabulary in Definitions!
    45. 45. CESSION/Version Accession numbers do not change, even if information in the record is changed at the authors request. Version and GI numbers change
    46. 46. s, Source, Organism Organism: Tied into Taxonomy Browser Search tip: Keywords are often blank When performing a “keyword” style search, use [all] , [word] or [title]
    47. 47. cted References Newest First Last reference covers submission information
    48. 48. eatures I Source, gene, misc features
    49. 49. eatures II CDS: links, translation
    50. 50. equence
    51. 51. GenBank FormatGenBank (also for protein)
    52. 52. 132,015,054
    53. 53. 132,015,054+ HARD WORK- redundancy
    54. 54. 132,015,054+ HARD WORK- redundancy RefSeq
    55. 55. RefSeq
    56. 56. RefSeqsprovides a single record for each natural biological molecule for major organisms ranging fromviruses to bacteria to eukaryotes
    57. 57. RefSeqsbio molprovides a single record for each DNA molecule for natural biological RNA major organisms ranging fromviruses to bacteria to eukaryotes Protein
    58. 58. RefSeqsbio molprovides a single record for each HELLO DNA molecule for my name is natural biological RNA major organisms ranging from XX_123456viruses to bacteria to eukaryotes Protein
    59. 59. bio moleculesIncomplete Genomic DNA (NC)(NG) mRNAModel mRNA (NM)(XM)Model protein Curated Protein(XP) (NP)
    60. 60. NG_012250.1NM_000690.2AY621070.1EU414258.1EU414257.1EU414256.1EU414255.1EU414254.1EU414253.1EU414252.1EU414251.1EU414250.1EU414249.1AF164120.1EU373813.1 NG_012250.1EU373812.1EU373811.1EU373810.1 NM_000690.2 NP_000681.2EU373809.1EU373808.1EU373807.1EU373806.1EU373805.1EU373804.1AH002599.1M20456.1 M20455.1M20454.1 M20453.1M20452.1 M20451.1M20450.1 M20449.1M20448.1 M20447.1M20446.1 M20445.1M20444.1CR456991.1AB385105.1CU678321.1CU678320.1AF073514.1 http://www.ncbi.nlm.nih.gov/nuccore
    61. 61. NucleotideGenBankRefSeq
    62. 62. 3genes/genome
    63. 63. Genome/BioProjectGeneHomoloGene
    64. 64. Genome/BioProject
    65. 65. http://www.ncbi.nlm.nih.gov/genome
    66. 66. RegulatoryGene Intron Exon Intron http://www.ncbi.nlm.nih.gov/gene
    67. 67. Regulatory11,043,299 Intron Exon Intron
    68. 68. External links
    69. 69. HomoloGene
    70. 70. P3H1http://www.ncbi.nlm.nih.gov/homologene
    71. 71. Protein of Interest (P3H1)
    72. 72. GenomeGeneHomoloGene
    73. 73. 4 expression & structure
    74. 74. UniGene EST, GEOStructures CDD, MMDB, PubChem…
    75. 75. UniGene …an organized view of the transcriptome
    76. 76. UniGene HOW MUCH, WHERE IS IT?
    77. 77. http://www.ncbi.nlm.nih.gov/unigene
    78. 78. SELECTED PROTEIN SIMILARITIES MAPPING POSITION SEQUENCES mRNA EST
    79. 79. GENE EXPRESSION EST: estimated counting GEO: assayed
    80. 80. Structures CDD, MMDB, PubChem…
    81. 81. http://www.ncbi.nlm.nih.gov/structure
    82. 82. http://www.ncbi.nlm.nih.gov/cdd
    83. 83. http://pubchem.ncbi.nlm.nih.gov/
    84. 84. http://www.ncbi.nlm.nih.gov/biosystems
    85. 85. UniGene EST, GEOStructures CDD, MMDB, PubChem…
    86. 86. databases
    87. 87. discovery
    88. 88. bucket loadsof librarydatabases
    89. 89. lots of tools
    90. 90. Word weight PubMed Taxonomy 3-D 3D Structure VASTPhylogeny Gene BLAST Nucleotide Protein BLAST sequences sequences
    91. 91. Word weight PubMed SI MP LE 3-D 3D OO Taxonomy VAST T StructurePhylogeny Gene BLAST Nucleotide Protein BLAST sequences sequences
    92. 92. 10M 1M 100k 10k 1k
    93. 93. S tilltoo IM PL E* S* This chart is 9 years old
    94. 94. NCBIdiscovery initiative
    95. 95. NCBIdiscovery initiative
    96. 96. NCBIhigh quality DBdiscovery tools
    97. 97. Information Hubs• BioProject• Genome• GeneAnalysis Hubs• HomoloGene• UniGene• BLAST/VAST
    98. 98. wheredo Istart?
    99. 99. anywhere*
    100. 100. *but gene acts as a good hub
    101. 101. Apolipoprotein E APOE
    102. 102. HYPOTHESIS:A structural defect inAPOE protein causes early onsetAlzheimer’s disease
    103. 103. What GeneticsTo Disease Variants ExpressionDo Homologus Structure? Analysis
    104. 104. How Gene and RefSeqTo Genome Maps Allelic VariantsDo Expression Homologus G/PIt! Structure
    105. 105. APOE Sequence Viewer Gene Genes and More
    106. 106. Links inGeneRecord
    107. 107. L
    108. 108. Links toOutsideSources
    109. 109. .0016
    110. 110. (many databases here)
    111. 111. Dis ease DY S ITE S StateBO e lo p ment Dev
    112. 112. liverbrain
    113. 113. (many databases here)
    114. 114. Apolipoprotein E APOE
    115. 115. HYPOTHESIS:A structural defect inAPOE protein causes early onsetAlzheimer’s disease
    116. 116. CONCLUSION: The Cys130Arg mutation does notproduce a significant structural variant
    117. 117. asdfsciencecan becomplex...
    118. 118. …NCBI canhelp youwith that.
    119. 119. thankyou
    120. 120. NCBI Tools for Information andScientific Discovery July 25, 2012 RML Rendezvous webcast Jackie Wirz, PhD wirzj@ohsu.edu
    121. 121. Now it’syour turn…
    122. 122. Now It’s Your TurnWhat database other than PubMed do you think your patrons will find most useful? • Gene • BioProject • OMIM • PubChem
    123. 123. Now It’s Your TurnReminder: Where are you from?https://www.surveymonkey.com/s/PNRinfo
    124. 124. Thank You!See you next time on… August 22, 2012 1:00 PM Pacific https://webmeeting.nih.gov/rendezvous

    ×