Mit Open Science Talk

Loading...

Flash Player 9 (or above) is needed to view presentations.
We have detected that you do not have it on your computer. To install it, go here.

0 comments

Post a comment

    Post a comment
    Embed Video
    Edit your comment Cancel

    Favorites, Groups & Events

    Mit Open Science Talk - Presentation Transcript

    1. building the research web john wilbanks 13 november 2007 open science and open publishing mit csail
    2. science commons: explicit contractual rights, granted in advance, to use and re-use knowledge (papers, tools, data) readable by non-lawyers and machines proto-infrastructure for knowledge sharing technical platform: semantic web
    3. most of what is known is thrown away (cognitive problem) most of what is known is poorly fitted for use and reuse by machines and so+ware (design problem) most of what is known is poorly licensed for redesign and reuse by machines and so+ware (legal problem) very few research materials are actually available (social problem)
    4. based on what’s been published in journals and databases, what signal transduction genes might be active in pyramidal neurons?
    5. what you get
    6. DRD1, 1812 adenylate cyclase activation ADRB2, 154 adenylate cyclase activation ADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathway DRD1IP, 50632 dopamine receptor signaling pathway DRD1, 1812 dopamine receptor, adenylate cyclase activating pathway DRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathway GRM7, 2917 G-protein coupled receptor protein signaling pathway GNG3, 2785 G-protein coupled receptor protein signaling pathway GNG12, 55970 G-protein coupled receptor protein signaling pathway DRD2, 1813 G-protein coupled receptor protein signaling pathway ADRB2, 154 G-protein coupled receptor protein signaling pathway CALM3, 808 G-protein coupled receptor protein signaling pathway HTR2A, 3356 G-protein coupled receptor protein signaling pathway DRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messenger SSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messenger MTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messenger CNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messenger HTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messenger GRIK2, 2898 glutamate signaling pathway GRIN1, 2902 glutamate signaling pathway GRIN2A, 2903 glutamate signaling pathway what you want GRIN2B, 2904 glutamate signaling pathway ADAM10, 102 integrin-mediated signaling pathway GRM7, 2917 negative regulation of adenylate cyclase activity LRP1, 4035 negative regulation of Wnt receptor signaling pathway ADAM10, 102 Notch receptor processing ASCL1, 429 Notch signaling pathway HTR2A, 3356 serotonin receptor signaling pathway ADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization) PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathway EPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathway NRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathway CTNND1, 1500 Wnt receptor signaling pathway `
    7. and if you want the tools associated with those genes? cell lines? plasmids? reagents? methods and protocols? unpublished data sets?
    8. the research web Open Access Content Open Source Open Access Knowledge Management Research Tools
    9. old collaboration: reading the canon on paper querying single-access databases human as mediator artisanal tool manufacturing tightly controlled distribution new collaboration: reading the canon with machines integrating databases computer as mediator industrial tool manufacturing standardized distribution
    10. the research web Open Access Content
    11. legal framework for research: the paper metaphor (ownership and access)
    12. “Therefore, learned man, without wishing to be inopportune, I beg you most emphatically to communicate your discovery to the learned world” Letter to Copernicus, 1 November 1536 Archbishop of Capua Nikolaus Cardinal von Schönberg
    13. copyrights allow ownership of papers by the nature of the medium, not the nature of the work the nature of the work is profoundly integrative: one set of facts per “paper” are connected to elements of knowledge throughout science
    14. http://orpheus-1.ucsd.edu/acq/license/cdlelsevier2004.pdf
    15. “By open access to the literature, we mean its free availability on the public internet, permitting users to read, download, copy, distribute, print, search, or link to the full texts of these articles, crawl them for indexing, pass them as data to so+ware, or use them for any other lawful purpose, without financial, legal or technical barriers other than those inseparable from gaining access to the internet itself.” image from the public library of science licensed to the public under CC-BY 3.0
    16. “The only constraint on reproduction and distribution, and the only role for copyright in this domain, should be to give authors control over the integrity of their work and the right to be properly acknowledged and cited” - the Budapest Open Access Initiative image from the public library of science licensed to the public under CC-BY 3.0
    17. <License rdf:about=\"http://creativecommons.org/licenses/by/3.0/\"> <permits rdf:resource=\"http://creativecommons.org/ns#Reproduction\" /> <permits rdf:resource=\"http://creativecommons.org/ns#Distribution\" /> <permits rdf:resource=\"http://creativecommons.org/ns#DerivativeWorks\" /> <requires rdf:resource=\"http://creativecommons.org/ns#Notice\" /> <requires rdf:resource=\"http://creativecommons.org/ns#Attribution\" /> </License> creates another dimension for search: “find me stuff I know I have the right to use”
    18. FLOSS: GNU/ License LINUX cc:license
    19. cc:license a commons for data: create zones of certainty “freedom to integrate” no quid pro quo
    20. the research web Open Access Research Tools
    21. legal framework for research: the artisanal metaphor (pre-industrial culture of tool-making)
    22. Alzheimer’s Disease Multiple Sclerosis Autism research silos: Huntington’s same genes, same cells, same brain Disease
    23. Alzheimer’s Disease Multiple Sclerosis Autism Huntington’s Disease bilateral contracts and deals
    24. Alzheimer’s Disease Multiple Sclerosis Autism Huntington’s Disease “one to many” offers / networks
    25. industrial tool manufacture and distribution Provider Lab MTA Recipient Lab tracking deposit fulfillment Depository searching / ordering
    26. cc:license apply these methods to physical materials as well: available via standard, one-click contracts discoverable by digital identifiers fulfilled by third parties to the transaction acknowledged by citation-inspired systems
    27. usage modes: A) public offer (one-to-many) B) private negotiation (eliminate inherent disadvantages in expertise)
    28. thanks to the metadata, efficient to discover resources: while reading papers while browsing databases
    29. the research web Open Source Knowledge Management
    30. technical framework for research: the “one database per child” metaphor (it depends on what the meaning of “gene” is)
    31. 27,266 papers 128,437 papers 41,985 papers 4,563 papers 10,365 papers “knowledge = product” is causing systemic failures to exploit opportunities afforded by the network
    32. 27,266 papers 128,437 papers 41,985 papers 4,563 papers 10,365 papers “knowledge = network” better reflects the reality of knowledge
    33. “find me genes involved in signal transduction that are related to pyramidal neurons”
    34. gp145trkB does not require p75LNGFR to form a functional receptor for BDNF in hippocampal pyramidal neurons
    35. is this a creative expression or a forced move? gp145trkB does not require p75LNGFR to form a functional receptor for BDNF in hippocampal pyramidal neurons
    36. PDSPki Reactome Gene Ontology NeuronDB BAMS Entrez Gene Antibodies Allen Brain BrainPharm Atlas Literature SWAN Homologene PubChem AlzGene Mammalian MESH Phenotype slide derived from W3C HCLS
    37. slide courtesy of kei chung, yale Pathological Change Agent involves involves inhibits Neuronal Property Pathological Agent Neuron inhibits inhibits has Drug is_located_in Receptor Compartment is_located_in Channel
    38. PDSPki NeuronDB Reactome Gene Ontology BAMS Allen Brain BrainPharm Antibodies Atlas Entrez Gene MESH Literature PubChem Mammalian Phenotype SWAN AlzGene Homologene slide courtesy of W3C HCLS
    39. running code Mesh: Pyramidal Neurons prefix go: <http://purl.org/obo/owl/GO#> prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> prefix owl: <http://www.w3.org/2002/07/owl#> prefix mesh: <http://purl.org/commons/record/mesh/> prefix sc: <http://purl.org/science/owl/sciencecommons/> prefix ro: <http://www.obofoundry.org/ro/ro.owl#> Pubmed: Journal Articles select ?genename ?processname where { graph <http://purl.org/commons/hcls/pubmesh> { ?paper ?p mesh:D017966 . ?article sc:identified_by_pmid ?paper. ?gene sc:describes_gene_or_gene_product_mentioned_by ?article. } graph <http://purl.org/commons/hcls/goa> Entrez Gene: Genes { ?protein rdfs:subClassOf ?res. ?res owl:onProperty ro:has_function. ?res owl:someValuesFrom ?res2. ?res2 owl:onProperty ro:realized_as. ?res2 owl:someValuesFrom ?process. graph <http://purl.org/commons/hcls/20070416/classrelations> {{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166} union {?process rdfs:subClassOf go:GO_0007166 }} GO: Signal Transduction ?protein rdfs:subClassOf ?parent. ?parent owl:equivalentClass ?res3. ?res3 owl:hasValue ?gene. } graph <http://purl.org/commons/hcls/gene> { ?gene rdfs:label ?genename } graph <http://purl.org/commons/hcls/20070416> { ?process rdfs:label ?processname} }
    40. DRD1, 1812 adenylate cyclase activation ADRB2, 154 adenylate cyclase activation ADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathway DRD1IP, 50632 dopamine receptor signaling pathway DRD1, 1812 dopamine receptor, adenylate cyclase activating pathway DRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathway GRM7, 2917 G-protein coupled receptor protein signaling pathway GNG3, 2785 G-protein coupled receptor protein signaling pathway GNG12, 55970 G-protein coupled receptor protein signaling pathway DRD2, 1813 G-protein coupled receptor protein signaling pathway ADRB2, 154 G-protein coupled receptor protein signaling pathway CALM3, 808 G-protein coupled receptor protein signaling pathway HTR2A, 3356 G-protein coupled receptor protein signaling pathway DRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messenger SSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messenger MTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messenger CNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messenger HTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messenger GRIK2, 2898 glutamate signaling pathway GRIN1, 2902 glutamate signaling pathway GRIN2A, 2903 glutamate signaling pathway GRIN2B, 2904 glutamate signaling pathway ADAM10, 102 integrin-mediated signaling pathway GRM7, 2917 negative regulation of adenylate cyclase activity LRP1, 4035 negative regulation of Wnt receptor signaling pathway ADAM10, 102 Notch receptor processing ASCL1, 429 Notch signaling pathway HTR2A, 3356 serotonin receptor signaling pathway ADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization) PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathway EPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathway NRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathway CTNND1, 1500 Wnt receptor signaling pathway ` Many of the genes are indeed related to Alzheimer’s Disease through gamma secretase (presenilin) activity
    41. http://hcls1.csail.mit.edu:8890/sparql/?query=prefix%20go%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2FGO%23%3E% 0Aprefix%20rdfs%3A%20%3Chttp%3A%2F%2Fwww.w3.org%2F2000%2F01%2Frdf-schema%23%3E%0Aprefix%20owl%3A%20% 3Chttp%3A%2F%2Fwww.w3.org%2F2002%2F07%2Fowl%23%3E%0Aprefix%20mesh%3A%20%3Chttp%3A%2F%2Fpurl.org% 2Fcommons%2Frecord%2Fmesh%2F%3E%0Aprefix%20sc%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fscience%2Fowl% 2Fsciencecommons%2F%3E%0Aprefix%20ro%3A%20%3Chttp%3A%2F%2Fwww.obofoundry.org%2Fro%2Fro.owl%23%3E%0A% 0Aselect%20%3Fgenename%20%3Fprocessname%0Awhere%0A%7B%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons %2Fhcls%2Fpubmesh%3E%0A%20%20%20%20%20%7B%20%3Fpaper%20%3Fp%20mesh%3AD017966%20.%0A%20%20%20% 20%20%20%20%3Farticle%20sc%3Aidentified_by_pmid%20%3Fpaper.%0A%20%20%20%20%20%20%20%3Fgene%20sc% 3Adescribes_gene_or_gene_product_mentioned_by%20%3Farticle.%0A%20%20%20%20%20%7D%0A%20%20%20graph%20% 3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fgoa%3E%0A%20%20%20%20%20%7B%20%3Fprotein%20rdfs% 3AsubClassOf%20%3Fres.%0A%20%20%20%20%20%20%20%3Fres%20owl%3AonProperty%20ro%3Ahas_function.%0A%20%20% 20%20%20%20%20%3Fres%20owl%3AsomeValuesFrom%20%3Fres2.%0A%20%20%20%20%20%20%20%3Fres2%20owl% 3AonProperty%20ro%3Arealized_as.%0A%20%20%20%20%20%20%20%3Fres2%20owl%3AsomeValuesFrom%20%3Fprocess.%0A %20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%2Fclassrelations%3E%0A%20%20%20% 20%20%7B%7B%3Fprocess%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2Fobo%23part_of%3E%20go%3AGO_0007166%7D %0A%20%20%20%20%20%20%20union%0A%20%20%20%20%20%20%7B%3Fprocess%20rdfs%3AsubClassOf%20go% 3AGO_0007166%20%7D%7D%0A%20%20%20%20%20%20%20%3Fprotein%20rdfs%3AsubClassOf%20%3Fparent.%0A%20%20% 20%20%20%20%20%3Fparent%20owl%3AequivalentClass%20%3Fres3.%0A%20%20%20%20%20%20%20%3Fres3%20owl% 3AhasValue%20%3Fgene.%0A%20%20%20%20%20%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org% 2Fcommons%2Fhcls%2Fgene%3E%0A%20%20%20%20%20%7B%20%3Fgene%20rdfs%3Alabel%20%3Fgenename%20%7D%0A% 20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%3E%0A%20%20%20%20%20%7B%20% 3Fprocess%20rdfs%3Alabel%20%3Fprocessname%7D%0A%7D&format=&maxrows=50
    42. the “view source” effect prefix go: <http://purl.org/obo/owl/GO#> prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> prefix owl: <http://www.w3.org/2002/07/owl#> prefix mesh: <http://purl.org/commons/record/mesh/> prefix sc: <http://purl.org/science/owl/sciencecommons/> prefix ro: <http://www.obofoundry.org/ro/ro.owl#> select ?genename ?processname where { graph <http://purl.org/commons/hcls/pubmesh> mesh:D009369 { ?paper ?p . ?article sc:identified_by_pmid ?paper. ?gene sc:describes_gene_or_gene_product_mentioned_by ?article. } graph <http://purl.org/commons/hcls/goa> { ?protein rdfs:subClassOf ?res. ?res owl:onProperty ro:has_function. ?res owl:someValuesFrom ?res2. ?res2 owl:onProperty ro:realized_as. ?res2 owl:someValuesFrom ?process. graph <http://purl.org/commons/hcls/20070416/classrelations> {{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166} union go:GO_0006610 }} {?process rdfs:subClassOf ?protein rdfs:subClassOf ?parent. ?parent owl:equivalentClass ?res3. ?res3 owl:hasValue ?gene. } graph <http://purl.org/commons/hcls/gene> { ?gene rdfs:label ?genename } graph <http://purl.org/commons/hcls/20070416> { ?process rdfs:label ?processname} }
    43. building on a commons means “snap together” integration of the tools, data, and literature
    44. fragile existing infrastructure must stay open freedom to access the canon freedom to build the tools new infrastructure must persist agreements on names and meanings open names and meanings
    45. the research web Open Access Content Open Source Open Access Knowledge Management Research Tools
    46. “design for re-use” “follow the rule of least power”
    47. “you! in the lab! start innovating!”
    48. use the commons as the backbone of the research web: 1)evaluate what you believe against what is online 2) low-friction access to what is needed for further work use the commons as a method for integrating emerging and disruptive technologies into the research web
    49. atgaccatgattacgccaagcgcgcaatta accctcactaaagggaacaaaagctgga gctccaccgcggtggcggcagcactagag ctagtggatcccccgggctgtagaaattcg atatcaagcttatcgataccgtcgacctcga gggggggcccggtacccaattcgccctata gtgagtcgtattacgcgcgctcactggccgt cgttttacaacgtcgtgactgggaaaaccct ggcgttacccaacttaatcgccttgcagcac atccccctttcgccagctggcgtaatagc gaagaggcccgcaccgatcgcccttccca acagttgcgcagcctgaataataa
    50. codon devices
    51. if we can’t deal with the data we create in a classic drug discovery context, how will we deal with the data that comes from user-generated biology?
    52. retail: $79.95 + shipping ages ten and up
    53. thank you wilbanks@creativecommons.org http://sciencecommons.org
    54. acknowledgments Open Access: Investors and support: SPARC/Ass’n of Research Libraries MacArthur Foundation Carnegie-Mellon University Kauffman Foundation MIT MIT CSAIL Public Library of Science HighQ Foundation BioMed Central Omidyar Network Nature Precedings Teranode Corporation Springer Author Choice anonymous charitable foundations Global Biodiversity Information Facility in-kind supporters CODATA MTA: Neurocommons: iBridge Network W3C HCLS Addgene Millennium Pharmaceuticals (so+ware StrainInfo.net and curated content) Cure Huntington’s Disease Initiative Virtuoso So+ware Emory University Hewlett-Packard City of Hope Hospital

    + john wilbanksjohn wilbanks, 3 years ago

    custom

    1198 views, 0 favs, 0 embeds more stats

    Slides (in PDF export from Keynote) that I delivere more

    More info about this document

    © All Rights Reserved

    Go to text version

    • Total Views 1198
      • 1198 on SlideShare
      • 0 from embeds
    • Comments 0
    • Favorites 0
    • Downloads 16
    Most viewed embeds

    more

    All embeds

    less

    Flagged as inappropriate Flag as inappropriate
    Flag as inappropriate

    Select your reason for flagging this presentation as inappropriate. If needed, use the feedback form to let us know more details.

    Cancel
    File a copyright complaint
    Having problems? Go to our helpdesk?

    Categories