life sciences infrastructure

           john wilbanks
vp for science @ creative commons

       innovation summit
       ...
what we don’t know:
how to deliver drugs to cells
   disease mechanisms
   toxicity mechanisms
what we don’t know:
           how to deliver drugs to cells
              disease mechanisms
              toxicity mecha...
drug discovery, development, and approval




       the messaging doesn’t help

        look, it’s a linear process!
drug discovery, development, and approval




$800,000,000-$1,ooo,000,000 per success

               15-17 years
drug discovery, development, and approval




     think of the total number of transactions

and how to disaggregate them...
drug discovery, development, and approval




infrastructure needed: legal, technical, social, business

         not: “op...
drug discovery, development, and approval




“open science” - commons-based, technologically enabled, lots
           of ...
national systems are vastly unequal - the financial barriers to
  playing are so high - but that’s changing as the cost of ...
Open Access Content




              innovation

Open Source                      Open Access
Knowledge Management       ...
moving to a digital infrastructure for publishing
       and using knowledge in science

    or, why “paper” is the wrong ...
the impact of copyrights on innovation in
          scientific publishing:
http://orpheus-1.ucsd.edu/acq/license/cdlelsevier2004.pdf
legal infrastructure   technical infrastructure
legal infrastructure            technical infrastructure

       social infrastructure: carrots and sticks
Open Access Content




              innovation

Open Source                      Open Access
Knowledge Management       ...
Alzheimer’s
         Disease



                                                Multiple
                                 ...
Alzheimer’s
  Disease              Multiple
                       Sclerosis

              Autism



Huntington’s
  Disea...
Alzheimer’s
         Disease



                                             Multiple
                                    ...
change requires a new legal infrastructure
       to encourage collaboration


         traits of legal protocols:

      ...
ibridge
contractual
reconstruction
    of the
   research
  exemption
Provider Lab
                                  MTA



                                          Recipient Lab
tracking    ...
Open Access Content




              innovation

Open Source                      Open Access
Knowledge Management       ...
knowledge management
what you get
DRD1, 1812      adenylate cyclase activation
ADRB2, 154      adenylate cyclase activation
ADRB2, 154      arrestin mediate...
PDSPki
                             Reactome
        Gene
       Ontology




                                            ...
PDSPki
                                                  NeuronDB
                       Reactome
     Gene
    Ontology
 ...
running code

                                                                  Mesh: Pyramidal Neurons
            prefix...
DRD1, 1812         adenylate cyclase activation
ADRB2, 154         adenylate cyclase activation
ADRB2, 154         arresti...
DRD1, 1812         adenylate cyclase activation
ADRB2, 154         adenylate cyclase activation
ADRB2, 154         arresti...
http://hcls1.csail.mit.edu:8890/sparql/?query=prefix%20go%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2FGO%23%3E%
0Aprefix%20r...
“view source” effect:
beneficial output of releasing control
                 prefix go: <http://purl.org/obo/owl/GO#>
     ...
the cost of doing this has dropped to the point that a
         non profit can do it and give it away
infrastructure we need:

              API to the public domain
               “one-click” for research
default rule: the ...
china, brazil, EU: innovation law (bayh-dole variants)
                     OECD GBRCN
    US massive investment in bio-it...
the biology “peace dividend”:

we know a lot less about evolved systems like human
 bodies than we need, but the technolog...
atgaccatgattacgccaagcgcgcaatta
accctcactaaagggaacaaaagctgga
gctccaccgcggtggcggcagcactagag
ctagtggatcccccgggctgtagaaattcg
a...
if we can’t deal with the data we create in a classic
drug discovery context, how will we deal with the
    data that come...
DNA Discovery Explorer Kit




 retail: $79.95 + shipping
     ages ten and up
thank you

     wilbanks@creativecommons.org
       http://sciencecommons.org

funded by: Kauffman Foundation, MacArthur
  ...
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Innovation Summit 08 Science Commons
Upcoming SlideShare
Loading in …5
×

Innovation Summit 08 Science Commons

1,196 views
1,153 views

Published on

Published in: Health & Medicine, Business
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
1,196
On SlideShare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
17
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Innovation Summit 08 Science Commons

  1. 1. life sciences infrastructure john wilbanks vp for science @ creative commons innovation summit 11 january 2008 palo alto, ca
  2. 2. what we don’t know: how to deliver drugs to cells disease mechanisms toxicity mechanisms
  3. 3. what we don’t know: how to deliver drugs to cells disease mechanisms toxicity mechanisms it’s a knowledge problem, and thus more money doesn’t translate to more drugs
  4. 4. drug discovery, development, and approval the messaging doesn’t help look, it’s a linear process!
  5. 5. drug discovery, development, and approval $800,000,000-$1,ooo,000,000 per success 15-17 years
  6. 6. drug discovery, development, and approval think of the total number of transactions and how to disaggregate them outside the context of a massive single corporate entity?
  7. 7. drug discovery, development, and approval infrastructure needed: legal, technical, social, business not: “open source biology” a la GPL
  8. 8. drug discovery, development, and approval “open science” - commons-based, technologically enabled, lots of small transactions and collaborations infrastructure to enable the emergence of open innovation systems in the life sciences
  9. 9. national systems are vastly unequal - the financial barriers to playing are so high - but that’s changing as the cost of life sciences research drops significant collaboration is needed to take life science innovation to the “next level” - reproducible drug discovery collaborative innovation is a non-miraculous approach to increasing the odds of reproducible discovery legal, technical, and policy elements are required to wrench life sciences into the network form of collaboration
  10. 10. Open Access Content innovation Open Source Open Access Knowledge Management Research Tools
  11. 11. moving to a digital infrastructure for publishing and using knowledge in science or, why “paper” is the wrong metaphor
  12. 12. the impact of copyrights on innovation in scientific publishing:
  13. 13. http://orpheus-1.ucsd.edu/acq/license/cdlelsevier2004.pdf
  14. 14. legal infrastructure technical infrastructure
  15. 15. legal infrastructure technical infrastructure social infrastructure: carrots and sticks
  16. 16. Open Access Content innovation Open Source Open Access Knowledge Management Research Tools
  17. 17. Alzheimer’s Disease Multiple Sclerosis Autism Huntington’s distinct “silos” of funded research Disease
  18. 18. Alzheimer’s Disease Multiple Sclerosis Autism Huntington’s Disease bilateral contracts and deals
  19. 19. Alzheimer’s Disease Multiple Sclerosis Autism Huntington’s Disease “one to many” offers / networks
  20. 20. change requires a new legal infrastructure to encourage collaboration traits of legal protocols: legally accurate simple for scientists low transaction costs facilitate interoperability business friendly
  21. 21. ibridge
  22. 22. contractual reconstruction of the research exemption
  23. 23. Provider Lab MTA Recipient Lab tracking deposit fulfillment biobank searching / ordering takes a full e-commerce infrastructure
  24. 24. Open Access Content innovation Open Source Open Access Knowledge Management Research Tools
  25. 25. knowledge management
  26. 26. what you get
  27. 27. DRD1, 1812 adenylate cyclase activation ADRB2, 154 adenylate cyclase activation ADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathway DRD1IP, 50632 dopamine receptor signaling pathway DRD1, 1812 dopamine receptor, adenylate cyclase activating pathway DRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathway GRM7, 2917 G-protein coupled receptor protein signaling pathway GNG3, 2785 G-protein coupled receptor protein signaling pathway GNG12, 55970 G-protein coupled receptor protein signaling pathway DRD2, 1813 G-protein coupled receptor protein signaling pathway ADRB2, 154 G-protein coupled receptor protein signaling pathway CALM3, 808 G-protein coupled receptor protein signaling pathway HTR2A, 3356 G-protein coupled receptor protein signaling pathway DRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messenger SSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messenger MTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messenger CNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messenger HTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messenger GRIK2, 2898 glutamate signaling pathway GRIN1, 2902 glutamate signaling pathway GRIN2A, 2903 glutamate signaling pathway what you want GRIN2B, 2904 glutamate signaling pathway ADAM10, 102 integrin-mediated signaling pathway GRM7, 2917 negative regulation of adenylate cyclase activity LRP1, 4035 negative regulation of Wnt receptor signaling pathway ADAM10, 102 Notch receptor processing ASCL1, 429 Notch signaling pathway HTR2A, 3356 serotonin receptor signaling pathway ADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization) PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathway EPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathway NRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathway CTNND1, 1500 Wnt receptor signaling pathway `
  28. 28. PDSPki Reactome Gene Ontology NeuronDB BAMS Entrez Gene Antibodies Allen Brain BrainPharm Atlas Literature SWAN Homologene PubChem AlzGene Mammalian MESH Phenotype
  29. 29. PDSPki NeuronDB Reactome Gene Ontology BAMS Allen Brain BrainPharm Antibodies Atlas Entrez Gene MESH Literature PubChem Mammalian Phenotype SWAN AlzGene Homologene
  30. 30. running code Mesh: Pyramidal Neurons prefix go: <http://purl.org/obo/owl/GO#> prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> prefix owl: <http://www.w3.org/2002/07/owl#> prefix mesh: <http://purl.org/commons/record/mesh/> prefix sc: <http://purl.org/science/owl/sciencecommons/> prefix ro: <http://www.obofoundry.org/ro/ro.owl#> Pubmed: Journal Articles select ?genename ?processname where { graph <http://purl.org/commons/hcls/pubmesh> { ?paper ?p mesh:D017966 . ?article sc:identified_by_pmid ?paper. ?gene sc:describes_gene_or_gene_product_mentioned_by ?article. } graph <http://purl.org/commons/hcls/goa> Entrez Gene: Genes { ?protein rdfs:subClassOf ?res. ?res owl:onProperty ro:has_function. ?res owl:someValuesFrom ?res2. ?res2 owl:onProperty ro:realized_as. ?res2 owl:someValuesFrom ?process. graph <http://purl.org/commons/hcls/20070416/classrelations> {{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166} union {?process rdfs:subClassOf go:GO_0007166 }} GO: Signal Transduction ?protein rdfs:subClassOf ?parent. ?parent owl:equivalentClass ?res3. ?res3 owl:hasValue ?gene. } graph <http://purl.org/commons/hcls/gene> { ?gene rdfs:label ?genename } graph <http://purl.org/commons/hcls/20070416> { ?process rdfs:label ?processname} }
  31. 31. DRD1, 1812 adenylate cyclase activation ADRB2, 154 adenylate cyclase activation ADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathway DRD1IP, 50632 dopamine receptor signaling pathway DRD1, 1812 dopamine receptor, adenylate cyclase activating pathway DRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathway GRM7, 2917 G-protein coupled receptor protein signaling pathway GNG3, 2785 G-protein coupled receptor protein signaling pathway GNG12, 55970 G-protein coupled receptor protein signaling pathway DRD2, 1813 G-protein coupled receptor protein signaling pathway ADRB2, 154 G-protein coupled receptor protein signaling pathway CALM3, 808 G-protein coupled receptor protein signaling pathway HTR2A, 3356 G-protein coupled receptor protein signaling pathway DRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messenger SSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messenger MTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messenger CNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messenger HTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messenger GRIK2, 2898 glutamate signaling pathway GRIN1, 2902 glutamate signaling pathway GRIN2A, 2903 glutamate signaling pathway GRIN2B, 2904 glutamate signaling pathway ADAM10, 102 integrin-mediated signaling pathway GRM7, 2917 negative regulation of adenylate cyclase activity LRP1, 4035 negative regulation of Wnt receptor signaling pathway ADAM10, 102 Notch receptor processing ASCL1, 429 Notch signaling pathway HTR2A, 3356 serotonin receptor signaling pathway ADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization) PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathway EPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathway NRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathway CTNND1, 1500 Wnt receptor signaling pathway this functionality is not infrastructure for anyone outside of pharma, and it’s artisanally created inside pharma
  32. 32. DRD1, 1812 adenylate cyclase activation ADRB2, 154 adenylate cyclase activation ADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathway DRD1IP, 50632 dopamine receptor signaling pathway DRD1, 1812 dopamine receptor, adenylate cyclase activating pathway DRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathway GRM7, 2917 G-protein coupled receptor protein signaling pathway GNG3, 2785 G-protein coupled receptor protein signaling pathway GNG12, 55970 G-protein coupled receptor protein signaling pathway DRD2, 1813 G-protein coupled receptor protein signaling pathway ADRB2, 154 G-protein coupled receptor protein signaling pathway CALM3, 808 G-protein coupled receptor protein signaling pathway HTR2A, 3356 G-protein coupled receptor protein signaling pathway DRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messenger SSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messenger MTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messenger CNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messenger HTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messenger GRIK2, 2898 glutamate signaling pathway GRIN1, 2902 glutamate signaling pathway GRIN2A, 2903 glutamate signaling pathway GRIN2B, 2904 glutamate signaling pathway ADAM10, 102 integrin-mediated signaling pathway GRM7, 2917 negative regulation of adenylate cyclase activity LRP1, 4035 negative regulation of Wnt receptor signaling pathway ADAM10, 102 Notch receptor processing ASCL1, 429 Notch signaling pathway HTR2A, 3356 serotonin receptor signaling pathway ADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization) PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathway EPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathway NRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathway CTNND1, 1500 Wnt receptor signaling pathway ` Many of the genes are indeed related to Alzheimer’s Disease through gamma secretase (presenilin) activity
  33. 33. http://hcls1.csail.mit.edu:8890/sparql/?query=prefix%20go%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2FGO%23%3E% 0Aprefix%20rdfs%3A%20%3Chttp%3A%2F%2Fwww.w3.org%2F2000%2F01%2Frdf-schema%23%3E%0Aprefix%20owl%3A%20% 3Chttp%3A%2F%2Fwww.w3.org%2F2002%2F07%2Fowl%23%3E%0Aprefix%20mesh%3A%20%3Chttp%3A%2F%2Fpurl.org% 2Fcommons%2Frecord%2Fmesh%2F%3E%0Aprefix%20sc%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fscience%2Fowl% 2Fsciencecommons%2F%3E%0Aprefix%20ro%3A%20%3Chttp%3A%2F%2Fwww.obofoundry.org%2Fro%2Fro.owl%23%3E%0A% 0Aselect%20%3Fgenename%20%3Fprocessname%0Awhere%0A%7B%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons %2Fhcls%2Fpubmesh%3E%0A%20%20%20%20%20%7B%20%3Fpaper%20%3Fp%20mesh%3AD017966%20.%0A%20%20%20% 20%20%20%20%3Farticle%20sc%3Aidentified_by_pmid%20%3Fpaper.%0A%20%20%20%20%20%20%20%3Fgene%20sc% 3Adescribes_gene_or_gene_product_mentioned_by%20%3Farticle.%0A%20%20%20%20%20%7D%0A%20%20%20graph%20% 3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fgoa%3E%0A%20%20%20%20%20%7B%20%3Fprotein%20rdfs% 3AsubClassOf%20%3Fres.%0A%20%20%20%20%20%20%20%3Fres%20owl%3AonProperty%20ro%3Ahas_function.%0A%20%20% 20%20%20%20%20%3Fres%20owl%3AsomeValuesFrom%20%3Fres2.%0A%20%20%20%20%20%20%20%3Fres2%20owl% 3AonProperty%20ro%3Arealized_as.%0A%20%20%20%20%20%20%20%3Fres2%20owl%3AsomeValuesFrom%20%3Fprocess.%0A %20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%2Fclassrelations%3E%0A%20%20%20% 20%20%7B%7B%3Fprocess%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2Fobo%23part_of%3E%20go%3AGO_0007166%7D %0A%20%20%20%20%20%20%20union%0A%20%20%20%20%20%20%7B%3Fprocess%20rdfs%3AsubClassOf%20go% 3AGO_0007166%20%7D%7D%0A%20%20%20%20%20%20%20%3Fprotein%20rdfs%3AsubClassOf%20%3Fparent.%0A%20%20% 20%20%20%20%20%3Fparent%20owl%3AequivalentClass%20%3Fres3.%0A%20%20%20%20%20%20%20%3Fres3%20owl% 3AhasValue%20%3Fgene.%0A%20%20%20%20%20%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org% 2Fcommons%2Fhcls%2Fgene%3E%0A%20%20%20%20%20%7B%20%3Fgene%20rdfs%3Alabel%20%3Fgenename%20%7D%0A% 20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%3E%0A%20%20%20%20%20%7B%20% 3Fprocess%20rdfs%3Alabel%20%3Fprocessname%7D%0A%7D&format=&maxrows=50
  34. 34. “view source” effect: beneficial output of releasing control prefix go: <http://purl.org/obo/owl/GO#> prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> prefix owl: <http://www.w3.org/2002/07/owl#> prefix mesh: <http://purl.org/commons/record/mesh/> prefix sc: <http://purl.org/science/owl/sciencecommons/> prefix ro: <http://www.obofoundry.org/ro/ro.owl#> select ?genename ?processname where { graph <http://purl.org/commons/hcls/pubmesh> mesh:D009369 { ?paper ?p . ?article sc:identified_by_pmid ?paper. ?gene sc:describes_gene_or_gene_product_mentioned_by ?article. } graph <http://purl.org/commons/hcls/goa> { ?protein rdfs:subClassOf ?res. ?res owl:onProperty ro:has_function. ?res owl:someValuesFrom ?res2. ?res2 owl:onProperty ro:realized_as. ?res2 owl:someValuesFrom ?process. graph <http://purl.org/commons/hcls/20070416/classrelations> {{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166} union go:GO_0006610 }} {?process rdfs:subClassOf ?protein rdfs:subClassOf ?parent. ?parent owl:equivalentClass ?res3. ?res3 owl:hasValue ?gene. } graph <http://purl.org/commons/hcls/gene> { ?gene rdfs:label ?genename } graph <http://purl.org/commons/hcls/20070416> { ?process rdfs:label ?processname} }
  35. 35. the cost of doing this has dropped to the point that a non profit can do it and give it away
  36. 36. infrastructure we need: API to the public domain “one-click” for research default rule: the right to hack (tools, data, papers) non-artisanal contract culture if we are successful: more eyes creating more knowledge less funding of redundant research use what is known to drive rates of innovation
  37. 37. china, brazil, EU: innovation law (bayh-dole variants) OECD GBRCN US massive investment in bio-it at NCBI, NIH “post-national” in many ways collaborative incentives, tax credits, letting scientists patent, private r&d resources, “credit database,” etc. costs are dropping, and a lot of countries have a chip on their shoulder: drug prices, developed world focus
  38. 38. the biology “peace dividend”: we know a lot less about evolved systems like human bodies than we need, but the technologies we have built for studying those systems are going to drive innovation we can’t even imagine
  39. 39. atgaccatgattacgccaagcgcgcaatta accctcactaaagggaacaaaagctgga gctccaccgcggtggcggcagcactagag ctagtggatcccccgggctgtagaaattcg atatcaagcttatcgataccgtcgacctcga gggggggcccggtacccaattcgccctata gtgagtcgtattacgcgcgctcactggccgt cgttttacaacgtcgtgactgggaaaaccct ggcgttacccaacttaatcgccttgcagcac atccccctttcgccagctggcgtaatagc gaagaggcccgcaccgatcgcccttccca acagttgcgcagcctgaataataa
  40. 40. if we can’t deal with the data we create in a classic drug discovery context, how will we deal with the data that comes from new sources and user- generated biology?
  41. 41. DNA Discovery Explorer Kit retail: $79.95 + shipping ages ten and up
  42. 42. thank you wilbanks@creativecommons.org http://sciencecommons.org funded by: Kauffman Foundation, MacArthur Foundation, Omidyar Network, HighQ

×