Your SlideShare is downloading. ×
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling

205

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
205
On Slideshare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
1
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Mesenchymal stem cells improve cardiac conduction byupregulation of connexin 43 through paracrine signalingShwetha Mureli, Christopher P. Gans, Dan J. Bare, David L. Geenen, Nalin M. Kumarand Kathrin BanachAm J Physiol Heart Circ Physiol 304:H600-H609, 2013. First published 15 December 2012;doi: 10.1152/ajpheart.00533.2012You might find this additional info useful...Supplementary material for this article can be found at: http://ajpheart.physiology.org/http://ajpheart.physiology.org/content/suppl/2013/02/07/ajpheart.005 33.2012.DC1.htmlThis article cites 59 articles, 25 of which you can access for free at: Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013 http://ajpheart.physiology.org/content/304/4/H600.full#ref-list-1Updated information and services including high resolution figures, can be found at: http://ajpheart.physiology.org/content/304/4/H600.fullAdditional material and information about American Journal of Physiology - Heart and CirculatoryPhysiology can be found at: http://www.the-aps.org/publications/ajpheartThis information is current as of April 1, 2013.American Journal of Physiology - Heart and Circulatory Physiology publishes original investigations on thephysiology of the heart, blood vessels, and lymphatics, including experimental and theoretical studies ofcardiovascular function at all levels of organization ranging from the intact animal to the cellular, subcellular, andmolecular levels. It is published 24 times a year (twice monthly) by the American Physiological Society, 9650Rockville Pike, Bethesda MD 20814-3991. Copyright © 2013 the American Physiological Society. ESSN:1522-1539. Visit our website at http://www.the-aps.org/.
  • 2. Am J Physiol Heart Circ Physiol 304: H600–H609, 2013.First published December 15, 2012; doi:10.1152/ajpheart.00533.2012.Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling Shwetha Mureli,1,2* Christopher P. Gans,1* Dan J. Bare,1 David L. Geenen,1 Nalin M. Kumar,3 and Kathrin Banach1 1 Center for Cardiovascular Research, Department of Medicine, Section of Cardiology, University of Illinois at Chicago, Chicago, Illinois; 2Department of Bioengineering, University of Illinois at Chicago, Chicago, Illinois; and 3Department of Ophthalmology and Visual Sciences, University of Illinois at Chicago, Chicago, Illinois Submitted 13 July 2012; accepted in final form 7 December 2012 Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013 Mureli S, Gans CP, Bare DJ, Geenen DL, Kumar NM, Banach predominates in the cardiac muscle, and establish intercellularK. Mesenchymal stem cells improve cardiac conduction by upregu- coupling within the adult myocardium (9, 22, 46).lation of connexin 43 through paracrine signaling. Am J Physiol Heart When nonexcitable cells such as fibroblasts establish inter-Circ Physiol 304: H600 –H609, 2013. First published December 15, cellular coupling with cardiomyocytes through gap junction2012; doi:10.1152/ajpheart.00533.2012.—Mesenchymal stem cells channels, they reduce the spontaneous activity and conduction(MSCs) were shown to improve cell survival and alleviate cardiac velocity of the cardiac tissue by increasing the myocytesarrhythmias when transplanted into cardiac tissue; however, little is capacitive load (18, 28). By bridging the conduction betweenknown about the mechanism by which MSCs modify the electrophys- spatially separated cardiomyocytes (7, 19), they can furtheriological properties of cardiac tissue. We aimed to distinguish theinfluence of cell-cell coupling between myocytes and MSCs from that increase the heterogeneity of the excitation wave-front andof MSC-derived paracrine factors on the spontaneous activity and increase the propensity for cardiac arrhythmia (54). Theseconduction velocity (␪) of multicellular cardiomyocyte preparations. consequences suggest that MSC transplantation into the myo-HL-1 cells were plated on microelectrode arrays and their spontane- cardium is proarrhythmic. However, MSCs have also beenous activity and ␪ was determined from field potential recordings. In shown to preserve impulse conduction (37), reduce the induc-heterocellular cultures of MSCs and HL-1 cells the beating frequency ibility of ventricular arrhythmias (54), and improve atrio-was attenuated (t0h: 2.26 Ϯ 0.18 Hz; t4h: 1.98 Ϯ 0.26 Hz; P Ͻ 0.01) ventricular conduction block (57). The preservation of conduc-concomitant to the intercellular coupling between MSCs and cardio- tion cannot simply be explained by the integration of the MSCsmyocytes. In HL-1 monolayers supplemented with MSC conditioned into the tissue; therefore, we hypothesize that significant ben-media (ConM) or tyrode (ConT) ␪ significantly increased in a time- efit through MSCs is mediated by paracrine signaling. Thedependent manner (ConT: t0h: 2.4 cm/s Ϯ 0.2; t4h: 3.1 Ϯ 0.4 cm/s), number of paracrine factors secreted by MSCs is extensivewhereas the beating frequency remained constant. Connexin (Cx)43 (29), and some of them were shown to facilitate angiogenesismRNA and protein expression levels also increased after ConM or and cardiomyogenesis, to inhibit cardiac remodeling, and toConT treatment over the same time period. Enhanced low-density stimulate endogenous cardiac progenitor cells (45, 55). Modi-lipoprotein receptor-related protein 6 (LRP6) phosphorylation after fications of the MSC secretome further showed that theirConT treatment implicates the Wnt signaling pathway. Suppression cardioprotective effect is sensitive to the composition of sig-of Wnt secretion from MSCs (IWP-2; 5 ␮mol/l) reduced the efficacy naling molecules secreted (11, 20, 40, 44), and the use ofof ConT to induce phospho-LRP6 and to increase ␪. Inhibition of conditioned media alone was shown to exhibit a protective␤-catenin (cardamonin; 10 ␮mol/l) or GSK3-␣/␤ (LiCl; 5 mmol/l)also suppressed changes in ␪, further supporting the hypothesis that effect during ischemia/reperfusion injury (5). VEGF (30),MSC-mediated Cx43 upregulation occurs in part through secreted IGF-1 (23), and secreted frizzled-related protein that is signif-Wnt ligands and activation of the canonical Wnt signaling pathway. icantly upregulated in the secretome of Akt overexpressing MSCs have been directly linked to cardiac repair (4, 39).mesenchymal stem cells; connexin 43; conditioned media; Wnt; Decreased infarct size after ischemia-reperfusion injury fol-microelectrode array lowing MSC transplantation may result from either enhanced myocyte survival or through a mechanism of replacement by differentiated MSCs or endogenous stem cells. However, asIN CLINICAL TRIALS BONE MARROW -derived mesenchymal stem previously demonstrated, MSC-mediated paracrine signalingcells (MSCs) are transplanted into cardiac infarct regions as a significantly influences the calcium handling properties of indi-potential mechanism for cell replacement (55). Numerous in vidual cardiomyocytes and affects their survival (14), therebyvivo and in vitro studies demonstrate a beneficial effect of changing cellular excitability and contractility. Changes in exci-MSC transplantation including reduced infarct size, preserved tation-contraction coupling can modulate excitation spread andsystolic function, and reduced left ventricular remodeling (5, the potential for arrhythmic activity. In addition, components27, 53, 56). A significant portion of the transplanted MSCs of the MSC secretome like VEGF (36) and Wnt1 (33) havedisappears from the infarct shortly after transplantation (32). been reported to modulate cardiac gap junction expression (3,However, it was demonstrated that the remaining MSCs ex- 43), further supporting the hypothesis that MSCs can inducepress connexin 43 (Cx43) (50), the gap junction isoform that changes in cardiac excitation spread. Therefore, our aim in the current study was to determine Address for reprint requests and other correspondence: K. Banach, Section whether MSCs mediate changes in cardiac excitability and exci-of Cardiology, Dept. of Medicine, Univ. of Illinois at Chicago, 840 South tation spread and identify whether these changes occur throughWood St. (MC 715), Chicago, IL 60612-7323 (e-mail: kbanach@uic.edu). heterocellular coupling or paracrine signaling.H600 0363-6135/13 Copyright © 2013 the American Physiological Society http://www.ajpheart.org
  • 3. MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES H601MATERIALS AND METHODS primer sets were verified to amplify cDNA synthesized from known positive tissues (data not shown). Mouse bone marrow-derived MSCs were isolated and cultured as SDS-PAGE and Western blotting. One-hundred percent confluentpreviously described (8, 14, 21). The use of mice for this study was HL-1 cells plated on 35-mm tissue culture dishes were recoveredfull in compliance with the National Institutes of Health Guide for the following experimental treatment (0.5 or 4 h) with the addition of hotCare and Use of Laboratory Animals and approved by the Institu- 1-X Laemmli sample buffer lacking ␤-mercaptoethanol (␤-ME) andtional Animal Care and Use Committee of the University of Illinois at bromophenol blue dye. The samples were then heated to 95°C for 5Chicago. Conditioned medium was obtained from 80% confluent min and stored at Ϫ20°C until further processing. Sample proteinMSCs after overnight culture. Conditioned tyrode (ConT) was ob- determinations were made with a BCA protein assay kit (Pierce)tained by overnight incubation (15 h) of 80% confluent MSC culture followed by the addition of ␤-mercaptoethanol and dye to the finaldishes (10 cm) with tyrode solution (10 ml) at 37°C (in mmol/l) concentrations appropriate for the 1-X sample buffer and heated ascontaining 130 NaCl, 5.4 KCl, 1 CaCl2, 1.5 MgCl2, 10 NaHCO3, 10 before. The HL-1 cell lysates were separated for protein analysis usingglucose, 25 HEPES, 4 L-glutamine, and 0.1 nonessential amino acids either precast 10% or 4 –20% Novex tris-glycine gels (Invitrogen)(pH 7.4) (14). following standard electrophoresis protocols for SDS-PAGE and Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013 HL-1 cells, a murine cell line with an atrial-like phenotype, was Western blotting. Typically, 35 ␮g of protein was loaded per sample;cultured in Claycomb medium (SAFC Bioscience) supplemented with however, for the detection of phospho-low-density lipoprotein recep-FBS (10%), L-glutamine (2 mmol/l), and norepinephrine (0.1 mmol/l) tor-related protein 6 (LRP6) 120 ␮g of total protein was required.as previously described (13, 18). To monitor excitation spread in Primary antibodies used for Western blotting were anti-phospho-Akt-spontaneously active HL-1 monolayers the cells (0.3 ϫ 106 cell/ml) Ser473 (No. 4058), phospho-ERK1/2 (No. 4370), phospho-LRP6-were plated on multi-electrode arrays (MEAs; Multi Channel Sys- Ser1490 (No. 2568), GAPDH (No. 5174) from Cell Signaling Tech-tems, Reutlingen, Germany) for field potential recordings (13, 17, 18, nology, anti-connexin 43 (71-0700; Invitrogen), and anti-␤-catenin24). MEAs consisted of 60 electrodes with a diameter of Ø ϭ 30 ␮m (C7207; Sigma-Aldrich). Species-specific horseradish peroxidase-and an interelectrode distance of 200 ␮m. Experiments were con- conjugated secondary antibodies were used, and visualization wasducted at 37°C, and data acquisition and analysis was performed as accomplished using Western Lighting Plus-chemiluminescence re-previously described (17, 18) by using Cardio 2D and Cardio 2Dϩ agents (PerkinElmer) and Kodak BioMax film.software (Multi Channel Systems, Reutlingen, Germany), respec- Statistical analysis. Experimental values were compared with con-tively. For coculture assays, 0.2 ϫ 106 MSCs were added to the HL-1 trols using the unpaired two-tailed Student’s t-test. Nonlinear regres-monolayers, and electrophysiological changes were determined in sion was performed using GraphPad Prism software. Data are pre-30-min intervals. For experiments evaluating ConT, the culture me- sented as means Ϯ SE. Absolute and percent change values for ␪ anddium on each MEA was replaced by Ctrl tyrode solution to establish beating frequency are presented in the text. Differences were consid-baseline activity. After 30 min cells were transferred either to Ctrl or ered significant at P Ͻ 0.05.ConT for the duration of the experiment (4 h). LiCl (5 mmol/l; Sigma-Aldrich), cardamonin (10 ␮mol/l; EMD-Millipore), and PD98059 (Cell RESULTSSignaling Technology) were used for the inhibition of GSK-3␤,␤-catenin, and ERK1/2, respectively. Wnt3a, an activator of the canonical MSCs modulate the spontaneous activity of HL-1 cells. It hasWnt-signaling pathway, was obtained from Wnt3a overexpressing L- been demonstrated that nonexcitable cells such as fibroblastscells (49). change the spontaneous activity of cardiomyocyte monolayers Coculture and dye diffusion assay. To determine the time course of (18, 38). To determine the influence of MSCs on the electro-intercellular coupling between HL-1 cells and MSCs, MSCs were physiological properties of multicellular cardiomyocyte prep-loaded with calcein acetoxymethyl ester (Calcein AM; 2.5 ␮mol/l; 60 arations monolayers of HL-1 cells were established on MEAs.min at 37°C; Invitrogen) and Vybrant-DiD (2.5 ␮mol/l; 30 min at After 1 day in culture HL-1 monolayers exhibited a typical37°C; Invitrogen) in serum free DMEM and 200 ␮mol/l probenecid spontaneous beating frequency of 2.26 Ϯ 0.18 Hz (n ϭ 10) and(Sigma) (47). Dye loaded MSCs (0.3 ϫ 106) were transferred to HL-1 a conduction velocity (␪) of 1.5 Ϯ 0.15 cm/s (n ϭ 4). At thismonolayers grown on glass-bottom tissue culture dishes. Dye diffu- time 0.2 ϫ 106 MSCs dissociated in MSC medium were addedsion between MSCs and HL-1 cells was monitored by confocalmicroscopy and analyzed using ImageJ (National Institutes of Health, to the MEA. In Ctrl MEAs the beating frequency of the HL-1Bethesda, MD) (18). Data were analyzed as the percentage of MSCs monolayers exhibited a slight increase over time in culturecoupled to HL-1 cells per optical field. (t5h ϭ 2.92 Ϯ 0.34 Hz; n ϭ 4), whereas cultures supplemented Quantitative RT-PCR. Total RNA was isolated from MSCs or HL-1 with MSCs exhibited a decrease in beating frequency, startingcells using the RNeasy Mini Kit (Qiagen) according to the manufactur- 2 h after coculture (Fig. 1A). After 5 h the frequency decreaseder’s protocol. Total RNA was treated with DNAase I (Fermentas Life to t5h of 1.98 Ϯ 0.26 Hz (n ϭ 7) or 0.82 Ϯ 0.09 whenSciences) to remove residual genomic DNA. Treated total RNA was then normalized to the frequency at t0 and was significantly reducedused as template for complementary DNA (cDNA) synthesis using the compared with that of time matched homo-cellular HL-1RevertAid First Strand cDNA Synthesis Kit (Fermentas Life Sciences). monolayers (t5h: 1.22 Ϯ 0.06, n ϭ 4; P Ͻ 0.01). The MSC-The cDNA synthesis reaction was performed using random hexamer mediated suppression of the spontaneous activity was alsoprimers supplied by the manufacturer. cDNA was used as template in reflected in the increased likelihood of cessation of beating inquantitative PCR reactions with gene-specific primers and SYBR Ad- the cultures (not shown). In HL-1 MEAs at t5h cessation ofvantage qPCR premix (Clontech). The primer 18S was used for normal- spontaneous activity was observed in only 14.8% of the cul-ization (5=AATTGACGGAAGGGCACCAC3=; 5=GTGCAGCCCCG-GACAT CTTAAG3=). A primer set spanning the intron of connexin 46 tures. Some HL-1/MSC-MEAs, however, stopped beating al-(Cx46) (5=GGTGGTGGTGGTGGTAAAAG3=;5=CTACTGGGG- ready after t3h of coculture, with 71.3% of the cultures quies-AGAGCAGGACA3=) served as a negative control for genomic DNA cent at t5h.contamination. Expression of target genes was normalized to expression HL-1 cells and MSCs establish intercellular coupling via gapof 18S using QGene software (21). Cx43 (5=TCCAAGGAGTTCCAC- junctions. Others and we have previously demonstrated that non-CACTT3=; 5=GGACCTTGTCC AGCAGCTT3=) and Cx45 (5=TGGG- excitable cells like fibroblasts can change cardiomyocyte excit-TAACAGGAGTTCTGGTG3=; 5=CAAATGTCG AATGGTTGTGG3=) ability by establishing heterocellular coupling through gap junc- AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org
  • 4. H602 MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES A B * p < 0.01 : HL-1 : HL-1 + MSCs # beating frequency [norm] 1.4 # p < 0.05 * * 1.4 [norm] 1.2 1.2 1.0 1.0Fig. 1. Mesenchymal stem cells (MSCs) estab-lish intercellular coupling with cardiomyocytes 0.8 0.8and modify their electrophysiological properties.Addition of MSCs to a monolayer of spontane- 0.6 0.6ously beating HL-1 cells attenuates their beatingfrequency over time (A), whereas no change in ␪ 0 1 2 3 4 5 0 1 2 3 4 5 Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013was determined (B). Three-dimensional recon-struction of z-stack images (C, left) obtained by time [h] time [h]confocal microscopy shows calcein/AM-loaded C DMSCs on top of an HL-1 monolayer (C, right). 70Dye transfer through gap junction channels was MSCdetermined between the 2 cell types. Heterocel- coupled MSCs [%] 60lular coupling between MSCs and HL-1 cellsoccurs rapidly over the first hours of coculture HL-1 50(D; solid line) and is suppressed by carbenox- 40olone (dotted line). MSC 30 20 10 20 µm 0 z axis 0 1 2 3 4 5 6 7 24 70 µm time [h]tion channels (18, 38). To determine whether and in which time coupling induced decrease in ␪, we treated HL-1 monolayers withframe the spontaneous beating rate of HL-1 cells is altered by either MSC culture media (ConM: Fig. 2A), or tyrode that washeterocellular coupling with MSCs, we plated calcein/AM-loaded conditioned by mouse or human MSCs (14) (Fig. 2B). NeitherMSCs onto a monolayer of HL-1 cells. Heterocellular coupling ConM (ConM: t0h: 2.41 Ϯ 0.11 Hz; t4h: 2.46 Hz Ϯ 0.07; n ϭ 17),was identified when calcein fluorescence was detected in HL-1 mouse ConT (ConT: t0h: 3.34 Ϯ 0.37 Hz; t4h: 3.93 Ϯ 0.27 Hz;cells and a dye-loaded MSC was identified on top of the mono- n ϭ 13), or human ConT (ConTh: t0h: 2.776 Ϯ 0.293 Hz; t4h:layer (see Fig. 1C). Intercellular dye diffusion was detected as 2.844 Ϯ 0.523 Hz; n ϭ 5) induced a change in the spontaneousearly as 20 min after coculture was established, and the number of beating of the HL-1 monolayers compared with Ctrl culturescoupled cells increased over the initial 4 h (Fig. 1D: t4h: 46.23 Ϯ (Ctrl: t0h: 4.13 Ϯ 0.19 Hz; t4h: 4.17 Ϯ 0.16 Hz; n ϭ 27). However,2.99%; n ϭ 13 cultures with a total of 570 cells analyzed), in contrast with HL-1/MSC cocultures, treatment of HL-1 mono-whereas only a gradual increase in the number of coupled cells layers with ConM (ConM: t0h: 1.2 cm/s Ϯ 0.05; t4h: 1.9 Ϯ 0.1was determined after that (t24h: 60.07 Ϯ 4.8%; n ϭ 13). Dye cm/s; n ϭ 17; P Ͻ 0.05), ConT (ConT: t0h: 1.84 Ϯ 0.57 cm/s;diffusion between MSCs and HL-1 cells was significantly atten- t4h: 2.93 Ϯ 0.74 cm/s; n ϭ 13; P Ͻ 0.05), or ConTh (ConTh: t0h:uated when the coculture was established in the presence of the 1.08 Ϯ 0.07 cm/s; t4h: 1.57 Ϯ 0.18 cm/s; n ϭ 5; P Ͻ 0.05) sig-gap junction inhibitor carbenoxolone (100 ␮mol/l; t4h: 1.75 Ϯ nificantly increased ␪ over time (Fig. 2, A and B). No significant1%; n ϭ 3). The results support the hypothesis that the hetero- change was determined in HL-1 monolayers that were treatedcellular coupling established between MSCs and HL-1 cells with media or tyrode alone (HL-1 ϩ tyrode: t0h: 1.49 Ϯ 0.33changes the spontaneous beating rate of the HL-1 monolayer, cm/s; t4h: 1.72 Ϯ 0.49 cm/s; n ϭ 26). The results support thethereby demonstrating that it is attributed primarily to heterocel- hypothesis that paracrine factors secreted by MSCs modulatelular coupling. cardiac conduction velocity. Homo- and heterocellular HL-1 monolayers exhibited a gradual An increase in ␪ of cardiomyocyte monolayers can be inducedincrease in ␪ over time (t5h: HL-1: 1.9 Ϯ 0.1 cm/s, n ϭ 4; by enhanced depolarizing currents that drive the upstroke of theHL-1/MSC: 1.6 Ϯ 0.16 cm/s, n ϭ 6) representing a 1.35- and action potential or a decrease in the intercellular resistance due to1.16-fold increase, respectively, over a 5-h period (P Ͻ 0.3). No an increased number of gap junction channels. To determine thesignificant difference of ␪ was determined between homo- and contribution of the voltage-dependent sodium current to changesheterocellular cultures at any time of the experiment (Fig. 1B). in ␪ we increased the extracellular potassium [K]o from 4.8This result was in contrast with our previous experiments using mmol/l to 8.5 mmol/l (17) in cultures that were treated with ConMheterocellular cultures of HL-1 cells and fibroblasts where inter- for 4 h. In Ctrl and ConM-treated HL-1 monolayers (not shown)cellular coupling induced a decrease in ␪ (18). To test the hypoth- the increase in [K]o resulted in a decrease of the beating frequencyesis that paracrine factors secreted by MSCs compensate for the compared with t0 (Ctrl: t4h: 24.2 Ϯ 6.3%, n ϭ 4 ; ConM: t4h: AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org
  • 5. MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES H603A B 2.0 2.0 : Ctrl : ConM : Ctrl : ConT : h-ConT * * * * * &[norm] [norm] 1.5 1.5 * & * 1.0 1.0 Fig. 2. Paracrine factors secreted by MSCs in- 0.5 0.5 crease the conduction velocity of HL-1 mono- 0 1 2 3 4 1 2 3 4 layers. Conditioned culture medium from MSCs Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013 time [h] time [h] (ConM; A) as well as tyrode conditioned in the presence of mouse MSCs (ConT; B) and humanC D MSCs (h-ConT; B) increased ␪ in HL-1 mono- layers in a time-dependent manner (*P Ͻ 0.05 and &P Ͻ 0.05 compared with Ctrl). Contour plots of an HL-1 monolayer at 0.5 h (C) and 4 h (D) after addition of ConT are also shown. 0.5 h 4h20.3 Ϯ 6.5%, n ϭ 5). Although ␪ was decreased for Ctrl To determine whether MSC-secreted factors enhance thepreparations over time, it remained significantly increased in intercellular coupling, we determined the expression of cardiacConM-treated HL-1 monolayers (CtrlK: 0.8 Ϯ 0.07 cm/s, n ϭ 4; connexin isoforms in control and ConM-treated HL-1 mono-ConMK: 1.4 Ϯ 0.1 cm/s, n ϭ 5; P Ͻ 0.01). In addition, no layers by quantitative RT-PCR. In accordance with their atrialchanges in protein level of Nav1.5 were determined after 4 h phenotype, mRNA for Cx40, Cx43, and Cx45 was confirmedtreatment with either ConM (Fig. 3C) or ConT (Fig. 3D). The in HL-1 cells (17). Cx43 was expressed at the highest abun-result supports the hypothesis that paracrine signaling from MSCs dance (8-fold higher levels than Cx45). After 4 h treatment ofincreases ␪ by a mechanism independent of voltage-dependent HL-1 cells with ConM, Cx43 mRNA levels were significantlysodium current. increased compared with Ctrl-treated cells (Cx43: 1.829 ϮA 2.5 * p<0.05 B 0.6 : Ctrl & mRNA [ConM /Ctrl] * : ConM 2.0 * Cx43 [a.u.] : Ctrl Fig. 3. MSC-conditioned medium increases 0.4 : ConT 1.5 connexin (Cx)43 expression in cardiomyocytes. mRNA content of Cx43 and Cx45 determined 1.0 by quantitative RT-PCR in HL-1 cells after 4 h 0.2 of treatment with ConM showed a significant 0.5 increase in Cx43 but not Cx45 (A). Densitomet- ric quantitation of Cx43 blots (B) shown (C and 0.0 0.0 D) revealed a significant increase in the ratio of Cx43 Cx45 phosphorylated vs. nonphosphorylated Cx43 inC D both ConM- and ConT-treated groups (* and Ctrl + + + Ctrl + + + &P Ͻ 0.05 compared with respective Ctrl). ConM + + + ConT + + + Western blotting results of ConM (C)- and ConT (D)-treated HL-1 cells probed for Cx43 Cx43 Cx43 and Nav1.5 protein levels are shown. GAPDH is shown as a loading control (n ϭ 3 for each WB: AB WB: AB group). Nav1.5 Nav1.5 GAPDH GAPDH AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org
  • 6. H604 MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES A Ctrl + + degradation complex (26). Phosphorylation and consequently the inactivation of GSK3-␤ is regulated by different signal- ConT + + + + + + transduction pathways, including a phosphatidylinositol 3-kinase (PI3K)/Akt and a Wnt-dependent signaling cascade (6). To de- carda - + - + - + + termine whether inhibition of GSK3-␤ can mimic the ConT- mediated effect, we supplemented Ctrl solution and ConT with Cx43 lithium (LiCl; 5 mmol/l), an inhibitor of GSK3-␤. Addition of WB: AB LiCl to Ctrl solution induced a time-dependent increase in ␪ (Fig. 5B: CtrlLi: t4h: 2.67 Ϯ 0.07 cm/s; n ϭ 7; P Ͻ 0.05) and -catenin increased Cx43 protein levels (Fig. 5A); the addition of LiCl to ConT on the other hand did not have an additive effect (ConTLi: t4h: 2.90 Ϯ 0.13 cm/s; n ϭ 10; ConT: t4h: 2.93 Ϯ 0.20 cm/s; n ϭ GAPDH 13), indicating that ConT and LiCl converge on the same down- Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013 stream signaling mechanism. We have previously demonstrated that ConT induces GSK3-␤ B 100 phosphorylation through the PI3K/Akt pathway in isolated mouse : Ctrl * ventricular myocytes (14). Because PI3K/Akt is a downstream : Ctrl + carda target of VEGF signaling, we determined its role in the regulation : ConT change [%] of Cx43 expression. However, supplementation of ConT with the 60 : ConT + carda * PI3K inhibitor wortmannin (50 –100 nmol/l; Fig. 6A), or supple- 20 mentation of ConT with a VEGF R2/Flk-1 antibody (1 ␮g/ml) (43) (ConT ϩ anti-VEGFR: t4h: 2.33 Ϯ 0.13 cm/s; n ϭ 4; ConT: t4h: 2.93 Ϯ 0.20 cm/s; n ϭ 13) (Fig. 6C) did not prevent the ConT-induced upregulation of Cx43 or an increase of ␪ in HL-1 cells, respectively. GSK3-␤ phosphorylation is also a downstream target of the canonical Wnt pathway after stimulation of the frizzled recep- -20 1h 4h time [h]Fig. 4. ␤-Catenin inhibition prevents the ConT-mediated increase in Cx43protein levels. Western blotting analysis of Cx43 protein levels (A) after 4 h of A Ctrl + + + + + +ConT or Ctrl treatment in the presence or absence of cardamonin (Carda: 10␮mol/l; n ϭ 3 for each) is shown. Cardamonin prevented the ConT-mediated LiCl - + - + - +increase of ␪ in HL-1 monolayers (B; *P Ͻ 0.05 compared with Ctrl). Cx43 WB: AB0.243; n ϭ 3; P Ͻ 0.05). The effect was specific to Cx43, andno change in Cx45 mRNA was determined (Cx45: 1.322 Ϯ0.115, n ϭ 3; Fig. 3A). The increase in Cx43 mRNA was also GAPDHreflected in the protein level. Immunoblotting of whole celllysates revealed an increase in Cx43 protein after 4-h treatmentof HL-1 cells with either ConM (Fig. 3C) or ConT (Fig. 3D). B 80 : CtrlDensitometric analysis of the Western blots (Fig. 3B) showed : Ctrl + LiCl *,&a small but significant increase in the ratio of phosphorylated 60 : ConT *versus nonphosphorylated Cx43, over the 4-h time period. : ConT + LiClInduction of Cx43 expression has been described downstream change [%]of the glycogen synthase kinase-3 (GSK-3)/␤-catenin signaling 40 *cascade (3). To evaluate whether ␤-catenin signaling is re-quired for the increase in ␪, we supplemented ConT withcardamonin (10 ␮mol/l). Cardamonin that was previously 20described to stabilize ␤-catenin in its degradation complex (12) 5significantly attenuated the ConT-induced increase in Cx43protein expression and ␪ (ConT ϩ carda: t4h: 1.52 Ϯ 0.20 cm/s,n ϭ 7; ConT: t4h: 2.52 Ϯ 0.20 cm/s, n ϭ 8; P Ͻ 0.05) (Fig. 4,A and B). In Ctrl cultures supplemented with cardamonin, a 0slight reduction in Cx43 protein levels was determined, how- 1h 4h timeever, without a significant change in ␪. The results support thehypothesis that ConT regulates Cx43 and concomitant changes Fig. 5. Lithium inhibition of GSK-3␤ mimicks the effect of ConT on ␪ andin ␪ through stimulation of ␤-catenin signaling. Cx43 protein expression. Supplementation of Ctrl tyrode with LiCl (4 h) led to an increase in Cx43 protein levels in HL-1 monolayers (A). A concomitant ConT-mediated upregulation of Cx43 depends on ␤-catenin and increase in ␪ (B) was seen in spontaneously beating HL-1 cells. The LiCl-GSK-3. ␤-Catenin is a downstream target of GSK3-␤, a serine/ induced increase in ␪ was not additive to the effect of ConT (*P Ͻ 0.05threonine kinase that phosphorylates and stabilizes ␤-catenin in its compared with Ctrl; &P Ͻ 0.05 compared with Ctrl ϩ Li). AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org
  • 7. MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES H605 time [4 h] 7D). It was previously demonstrated by mass spectroscopy A Ctrl + + studies and RNA expression profiling that Wnt3a is expressed ConM + + in MSCs (41). To determine whether the effect can be mim- ConMWM 50 nM 100 nM icked by Wnt3a, media from Wnt3a overexpressing L-cells (49) were added to HL-1 monolayers (Fig. 8A, Ctrl ϩ Wnt3a). p-Akt Also in this case an increase in ␪ compared with that of nontreated Ctrl cultures was determined (Ctrl ϩ Wnt3a: t4h: 1.88 Ϯ 0.18 cm/s, n ϭ 6; Ctrl: t4h: 1.85 Ϯ 0.11 cm/s, n ϭ 4; Cx43 P Ͻ 0.05) (Fig. 8A). These results support the hypothesis that WB: AB MSC ConT-induced changes are in part through activation of the canonical Wnt pathway. However, with significant LRP6 GAPDH phosphorylation remaining in ConTIWP-2 another mechanism of LRP activation remained likely, particularly since the IWP-2 Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013 concentration used was previously shown to predominately B Ctrl + + + block Wnt secretion (10). Recent evidence indicates the MAP ConM + + + kinases ERK1/2 in an alternative pathway of LRP6 phosphor- p-Akt ylation (31). We evaluated ERK1/2 activity in HL-1 lysates and found that both ConM and ConT significantly increased WB: AB p-ERK ERK1/2 phosphorylation at 30 min and 4 h of incubation (Fig. 6B and 7, A and C). Supplementation of ConT with the ERK1/2 inhibitor PD98059 (25 ␮mol/l) (35) significantly attenuated the GAPDH ConT-mediated increase in ␪ (ConT ϩ PD98059: t4h: 2.04 Ϯ 0.11 cm/s, n ϭ 4; P Ͻ 0.05) (Fig. 8B); no change was determined in Ctrl cultures with PD98059 (Ctrl ϩ PD98059: C 100 : Ctrl * t4h: 1.41 Ϯ 0.03 cm/s; n ϭ 3). These results strongly suggest : Ctrl + antiVEGFR that p-ERK1/2 can contribute to GSK3/␤-catenin-mediated change [%] 80 : ConT : ConT + antiVEGFR * Cx43 upregulation. 60 DISCUSSION 40 We demonstrated that MSCs modulate the excitability and conduction of multicellular cardiomyocyte preparations by two 20 different mechanisms. They can reduce spontaneous activity of cardiomyocyte monolayers by establishing intercellular coupling 0 through gap junction channels; however, paracrine signaling can time [4 h] also increase the conduction velocity of the cardiomyocyte mono-Fig. 6. A ConM-mediated increase in ␪ does not depend on phosphatidylino- layer through upregulation of Cx43 without altering the beatingsitol 3-kinase/Akt signaling. Western blotting analysis of ConM-mediated (4 h) frequency. An experimental examination supports an induction ofchanges in p-Akt and Cx43 in the presence and absence of wortmannin (WM; Cx43 expression through the canonical Wnt/GSK3/␤-catenin sig-50 and 100 nM; A) is shown. ConM (4 h) also increased p-ERK 1/2 whereaschanges in p-Akt were close to baseline (B). GAPDH is shown as a loading nal transduction pathway in a Wnt and potentially ERK1/2-control for both experiments. The change of ␪ in Ctrl and ConT-treated HL-1 dependent and -independent manner.cells with and without the addition of an anti-VEGF receptor (VEGF-R) Influence of nonexcitable cells on cardiac excitation spread.antibody (*P Ͻ 0.05 compared with Ctrl; C) is shown. Nonexcitable cells like fibroblasts and endothelial cells make up a significant portion of the ventricular muscle. Research has focused on the influence of these cells on the electrophysio-tor. To identify whether ConT activates Wnt receptor signal- logical properties of the cardiac muscle. In vitro models dem-ing, we determined the phosphorylation levels of LRP6. LRP6 onstrate that electrotonic coupling of the nonexcitable cells canis part of the Wnt receptor and becomes phosphorylated upon bridge excitation spread over spatially separated areas of myo-Wnt stimulation (52). In ConT-treated HL-1 cells (30 min) the cytes (19, 42) and cause a decrease in ␪ in a dose (cellLRP6 phosphorylation level was increased (Fig. 7A). To sup- number)-dependent manner (18, 38). In cocultures of MSCspress the release of Wnt, MSCs were treated with the small and neonatal cardiomyocytes a Ͼ20% decrease in conductionmolecule inhibitor of the Wnt pathway IWP-2 (5 ␮mol/l, 24 h) velocity was reported compared with homocellular cardiomy-before tyrode was conditioned in their presence (ConTIWP-2). ocyte cultures and re-entrant arrhythmias could be more easilyThe final concentration of IWP-2 in ConTIWP-2 was 0.5 ␮mol/l. induced in the vicinity of MSCs clusters (9). In our cocultureWhen HL-1 cells were treated with ConTIWP-2, LRP6 phos- model, although there was a significant decrease in the spon-phorylation was significantly reduced compared with that of taneous beat rate of HL-1 cells as a consequence of theConT-treated cells (Fig. 7, A and B). After 4 h of incubation, intercellular coupling, we did not observe a significant de-Cx43 expression was not significantly different from ConT- crease of ␪ as previously described for HL-1/fibroblast cocul-treated HL-1 cells (Fig. 7C); however, the ConT-induced tures (18). The lack of change in ␪ could be explained by theincrease in ␪ was attenuated (ConTIWP-2: t4h: 1.80 Ϯ 0.05 cm/s, fact that the direct effect (capacitive coupling) of the MSCs isn ϭ 7; ConT: t4h: 2.73 Ϯ 0.19 cm/s, n ϭ 16; P Ͻ 0.05) (Fig. masked or compensated by the upregulation of Cx43 through AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org
  • 8. H606 MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES time 30 min time 4 h A Ctrl + + C Ctrl + + ConT + + + + + + ConT + + + + + +Fig. 7. ConT-mediated changes depend upon IWP-2 + + + IWP-2 + + +the activation of low-density lipoprotein re- p-LRP6 Cx43ceptor-related protein 6 (LRP6) through ago- WB: AB WB: ABnists of the canonical Wnt-signaling pathway.Changes in p-LRP6, p-ERK1/2, and Cx43 p-ERK1/2 p-ERK1/2after 30 min (A) or 4 h (C) of incubation withConT that was generated from control MSCs GAPDH GAPDHor MSCs treated with IWP-2 (ConTIWP-2) areshown. Densitometric quantitation (B) of the B 4 * D 80 *blot shown in A revealed significantly reducedp-LRP-6 (n ϭ 3), without significant reduc- * * : Ctrl * * : ConTtion in Cx43 protein. At both time points 3 : ConTIWP-2 60 Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013 p-LRP6/GAPDHp-ERK1/2 was increased well above control change [%] (rel. density)levels (n ϭ 3). GAPDH was used as a loadingcontrol. The ConTIWP-2-treated HL-1 mono- 2 40layer showed an attenuated increase in ␪ (D)compared with ConT-treated cultures (*P Ͻ0.05 between treatment groups indicated). Rel, 1 20relative. 0 0 Ctrl ConT ConT 1 Ctrl ConT ConT + IWP-2 + IWP-2paracrine signaling. However, because we were not yet able to the discrepancy in the coculture models could be the result ofisolate the effects induced by MSC/HL-1 intercellular cou- the fact that in our cultures MSCs only comprised 10% of totalpling, other explanations have to be considered. Coupling of cell number. This number is lower than the numbers that wereMSCs could be insufficient to induce changes in ␪. Because we previously tested in coculture models (9). In addition, in ourstill see a decrease in beating frequency this would mean that coculture model MSCs were added to an already established␪ is less sensitive to heterocellular coupling. This would still monolayer of cardiomyocytes and coculture was monitoredleave us to explain that no increase in ␪ was determined. The during the onset of heterocellular coupling. This is in contrastincrease in ␪ could be prevented if 1) the time of coculture is with other models where a mixture of MSCs and myocytes isinsufficient to secrete enough active factors to induce Cx43 plated (9). Under these conditions MSCs spatially separateupregulation or 2) coculture could change the MSC secretome. cardiomyocytes, which can increase the heterogeneity of theWe could previously demonstrate that MSC-mediated increase excitation wavefront. Our results would suggest that duringin cardiomyocyte Akt phosphorylation was readily induced integration of higher numbers of MSCs in a cardiomyocytewhen coculture was established and was unaffected from the preparation the effect of the capacitive coupling could overridepresence of cardiomyocyte (14). However, because Akt sig- the effect of the paracrine signaling on the conduction velocity;naling does not play a role in Cx43 upregulation, we cannot however, the previously established low retention of MSCsrule out that changes in the secretome occur. after transplantation suggests that paracrine signaling may play The paracrine effect of MSCs on ␪ described here was not the predominate role to affect positive changes in the myocar-previously examined; however, in agreement with our data, dium.MSCs have been shown to preserve impulse conduction (37), Influence of MSCs on HL-1 cell excitability and beating fre-reduce the inducibility of ventricular arrhythmias (54), and quency. During coculture of HL-1 cells and MSCs an attenu-improve atrioventricular conduction block (57). The reason for ation of the spontaneous beating frequency was determined. A 40 : Ctrl * C Extracellular space change [%] : Ctrl + Wnt3aFig. 8. Canonical Wnt signaling and ERK1/2 IWP-2 20 Wnts / ConT Ligandsignaling pathways affect Cx43 expression. (5 µM)Treatment of HL-1 monolayers with media ob- Plasmatained from Wnt3a overexpressing L1 cells sig- 0 membrane Frizzled LRP-6 P RTKnificantly increased the ␪ after 4 h (A; *P Ͻ 0.05 Cytoplasmcompared with Ctrl). PD98058, an ERK1/2 in- -20 1h 4hhibitor, attenuated the ConT-mediated increase B LiCl GSK3- ERKof ␪ in HL-1 monolayers (B; *P Ͻ 0.05 com- 80 : Ctrl *,& (20 mM) P change [%] : Ctrl + PD98059 *,&,pared with Ctrl; &P Ͻ 0.05 compared with : ConT #Ctrl ϩ PD98059; #P Ͻ 0.05 compared with 60 : ConT + PD98059 cardamonin PD98059ConT). A schematic summary of the experimen- -catenin (25 µM) 40 (10 µM)tal results illustrates the proposed signal trans-duction pathway (C). RTK, receptor tyrosine 20 Cx43kinase. 0 expression 1h 4h time [h] AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org
  • 9. MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES H607This change in the rate of diastolic depolarization could be due ConM might vary from that of ConT, but regarding the observedto the direct effect of heterocellular coupling on the origin of changes, both approaches had the same potency.excitation by depolarization of the HL-1 cells or the increase in MSCs express Wnt proteins that are activators of the canon-their capacitance. Alternatively, the coupling-induced changes ical (e.g., Wnt1, 2, 3, 8, and 8b) or noncanonical (Wnt4, 5a, 5b,could result in a shift of the origin of excitation to an unaf- 6, 7a, and 11) pathway (6, 48). They all play an important rolefected area or an area with increased pacemaker current. We in the regulation of MSC proliferation and suppression ofhave previously demonstrated that fibroblasts under the same differentiation (34). In our culture model Wnt-mediated sig-conditions reduce spontaneous beating of HL-1 monolayers naling is supported by the ConT-induced phosphorylation ofthrough depolarization and increase of HL-1 cell capacitance LRP6, the fact that the increase in ␪ can partially be reproduced(18). The fact that ConT alone had no impact on the sponta- by Wnt3a conditioned media and by the sensitivity of the changesneous activity indicates that paracrine signaling induced no to pharmacological regulation of GSK3-␣/␤ and ␤-catenin. Car-significant changes in HL-1 excitability under the assumption damonin reduced Cx43 expression levels and prevented changesthat the secretome remained unchanged. in ␪. In contrast with previous reports, however, no significant Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013 MSC mediated upregulation of Cx43. In cardiomyocyte mono- changes in total ␤-catenin protein levels were determined (12).layers the major factors affecting ␪ are the cellular excitability, This likely is explained by the slow turnover time of ␤-catenin andwhich is determined by the availability of Na channels and the our in comparison short cardamonin incubation time (25).intercellular resistance, which depends on the expression of Suppression of Wnt formation by IWP-2 attenuated LRP6gap junction channels. Although we have previously described phosphorylation and the increase of ␪; however, Cx43 proteina ConT-mediated increase in ICa,L in adult ventricular myo- levels at 4 h of treatment remained elevated compared withcytes (14), a change in cellular excitability is unlikely to fully Ctrl. A potential explanation is that expression and degradationexplain the increase in ␪ determined in this study. The signif- of Cx43 are both modulated by ConT. Even if Cx43 expressionicant upregulation of Cx43 expression over the time period is suppressed, an increased stability of Cx43 in the gap junctioncombined with no significant change in Na channel expression plaques as it is proposed through Akt-dependent phosphoryla-levels makes an increase in intercellular coupling the more tion (16) could lead to an increase in ␪. This would still belikely explanation for the increase in ␪. We also determined consistent with our experimental results that demonstrate nothat ConT induced a moderate increase in the phosphorylation significant effect of wortmannin on ␪, since in that caseof Cx43. Overall the Cx43 phosphorylation levels in HL-1 expression of Cx43 would still be increased.cells are low compared with the cardiac muscle where a Although we suppressed Wnt release from MSCs by IWP-2decrease in Cx43 phosphorylation is often linked to pathophys- treatment, we were not able to completely suppress ConT-iological remodeling (2). Phosphorylation of Cx43 can regulate mediated LRP6 phosphorylation. Besides the binding of Wntchannel assembly and electrical and metabolic coupling as well agonists, phosphorylation of LRP6 has been described throughas trafficking. We cannot rule out that the observed increase in receptor tyrosine kinases mediated ERK activation in a PI3K/Akt-phosphorylation of Cx43 changes the channels open probabil- independent manner (31). The LRP6 activation then could still induce ␤-catenin signaling and subsequently an increase in Cx43ity or its turnover; however, the change is relatively small to expression. A partial involvement of p-ERK1/2 in Cx43 upregu-those previously described and likely only contributes slightly lation is supported by our experiments (Fig. 8B).to the overall increase in ␪. Ischemia-reperfusion injury as well as cardiac hypertrophic MSC mediated paracrine signaling. MSCs secrete a broad growth are often related to decreased levels of Cx43 expres-spectrum of cytokines, chemokines, and growth factors (55). sion, which itself is linked to an increased propensity in cardiacSome of these factors have been described to modulate intercel- arrhythmia (58). A Wnt-mediated upregulation of Cx43 couldlular coupling through Cx43. For VEGF, upregulation of Cx43 therefore promote antiarrhythmic activity as it was described inthrough the Raf-1 MAPK pathway has been reported (43) and for a transgenic cardiomyopathic mouse model (3). It has to beIGF-1 a PI3K/Akt and ERK-mediated regulation of Cx43 was mentioned that the enhanced cardioprotective effect of Aktdemonstrated (1). Another signaling cascade involved in the overexpressing MSCs was linked to their increased secretion ofregulation of Cx43 protein levels is induced by the secreted Sfrp (39, 59). Sfrp suppresses Wnt signaling, which underpolypeptides of the Wnt family (3, 51). In these cases upregulation pathophysiological conditions suppresses Wnt-induced apo-of Cx43 is described through the Frizzled receptor via phosphor- ptosis (59). Additionally, it is proposed that the suppression ofylation of GSK3-␤ and subsequent increase in ␤-catenin signaling Wnt promotes stem cell differentiation thereby enhancing cell(3). Interestingly, our experimental results indicate that the PI3K/ replacement and vascularization (4, 15, 39). Whether the Wnt-Akt pathway is not involved in the regulation of Cx43 expression, dependent upregulation of Cx43 or the suppression of Wntalthough we have previously demonstrated that it has a significant signaling through Sfrp represents the mechanism of cardiopro-role in the ConT-mediated modulation of excitation-contraction tection during transplantation of MSCs will likely depend oncoupling in adult ventricular myocytes (14). This result underlines the physiological or pathophysiological phenotype of the car-the complexity of the signaling pathways induced by MSC- diac tissue.conditioned media/tyrode. We used conditioned media as well asconditioned tyrode for our experiments. Because the composition Conclusionof media is complex, we switched to tyrode to allow for a morecontrolled composition of the conditioned solution. The effect of We demonstrated that MSCs rapidly establish intercellularConM and ConT on ␪ and Cx43 expression was comparable; coupling with cardiac myocytes. Although the added capacitancetherefore, we decided to present the results together in this article. of the MSCs decreases the excitability of the myocytes, a reduc-However, we cannot rule out that the overall composition of tion in the conduction velocity of excitation spread is prevented by AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org
  • 10. H608 MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTESupregulation of Cx43 protein levels. Changes in Cx43 expression cells attenuates cardiac dysfunction after myocardial infarction. Circ Resare induced through paracrine signaling of MSCs involving the 108: 478 –489, 2011. 12. Cho M, Ryu M, Jeong Y, Chung YH, Kim DE, Cho HS, Kang S, Hanstimulation of the canonical Wnt signaling pathway. Conse- JS, Chang MY, Lee CK, Jin M, Kim HJ, Oh S. Cardamonin suppressesquently, during pathophysiological remodeling transplantation of melanogenesis by inhibition of Wnt/beta-catenin signaling. Biochem Bio-MSCs or treatment with MSC-conditioned medium could help phys Res Commun 390: 500 –505, 2009.maintain coordinated excitation spread by promoting Cx43 ex- 13. Claycomb WC, Lanson NA Jr, Stallworth BS, Egeland DB, Delcarpiopression. JB, Bahinski A, Izzo NJ, Jr. HL-1 cells: a cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyo-ACKNOWLEDGMENTS cyte. Proc Natl Acad Sci 95: 2979 –2984, 1998. 14. Desantiago J, Bare DJ, Semenov I, Minshall RD, Geenen DL, Wolska We thank Dr. Merrill (Department of Biochemistry and Molecular Genet- BM, Banach K. Excitation-contraction coupling in ventricular myocytesics, University of Illinois at Chicago) for providing us with conditioned media is enhanced by paracrine signaling from mesenchymal stem cells. J Molfrom Wnt3 overexpressing L-cells. Cell Cardiol 52: 1249 –1256, 2012. 15. Dufourcq P, Descamps B, Tojais NF, Leroux L, Oses P, Daret D,GRANTS Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 2013 Moreau C, Lamaziere JM, Couffinhal T, Duplaa C. Secreted frizzled- This work was supported by Grants from the National Institutes of Health related protein-1 enhances mesenchymal stem cell function in angiogen-HL-089617 and HL-089617-03S1 (to K. Banach). esis and contributes to neovessel maturation. Stem Cells 26: 2991–3001, 2008.DISCLOSURES 16. Dunn CA, Su V, Lau AF, Lampe PD. Activation of Akt, not connexin 43 protein ubiquitination, regulates gap junction stability. J Biol Chem No conflicts of interest, financial or otherwise, are declared by the author(s). 287: 2600 –2607, 2012. 17. Fahrenbach JP, Ai X, Banach K. Decreased intercellular couplingAUTHOR CONTRIBUTIONS improves the function of cardiac pacemakers derived from mouse embry- Author contributions: S.M., C.P.G., D.J.B., and K.B. conception and design onic stem cells. J Mol Cell Cardiol 45: 642–649, 2008.of research; S.M., C.P.G., D.J.B., and D.L.G. performed experiments; S.M., 18. Fahrenbach JP, Mejia-Alvarez R, Banach K. The relevance of non-C.P.G., D.J.B., and N.M.K. analyzed data; S.M., C.P.G., D.J.B., N.M.K., and excitable cells for cardiac pacemaker function. J Physiol 585: 565–578,K.B. interpreted results of experiments; S.M., D.J.B., and K.B. prepared 2007.figures; S.M. and K.B. edited and revised manuscript; S.M., C.P.G., D.J.B., 19. Gaudesius G, Miragoli M, Thomas SP, Rohr S. Coupling of cardiacD.L.G., N.M.K., and K.B. approved final version of manuscript; K.B. drafted electrical activity over extended distances by fibroblasts of cardiac origin.manuscript. Circ Res 93: 421, 2003. 20. Gnecchi M, He H, Melo LG, Noiseaux N, Morello F, de Boer RA,REFERENCES Zhang L, Pratt RE, Dzau VJ, Ingwall JS. Early beneficial effects of bone marrow-derived mesenchymal stem cells overexpressing Akt on 1. Aberg ND, Blomstrand F, Aberg MA, Bjorklund U, Carlsson B, cardiac metabolism after myocardial infarction. Stem Cells 27: 971–979, Carlsson-Skwirut C, Bang P, Ronnback L, Eriksson PS. Insulin-like 2009. growth factor-I increases astrocyte intercellular gap junctional communi- 21. Grajales L, Garcia J, Banach K, Geenen DL. Delayed enrichment of cation and connexin43 expression in vitro. J Neurosci Res 74: 12–22, mesenchymal cells promotes cardiac lineage and calcium transient devel- 2003. opment. J Mol Cell Cardiol 48: 735–745, 2010. 2. Ai X, Pogwizd SM. Connexin 43 downregulation and dephosphorylation 22. Hahn JY, Cho HJ, Kang HJ, Kim TS, Kim MH, Chung JH, Bae JW, in nonischemic heart failure is associated with enhanced colocalized Oh BH, Park YB, Kim HS. Pre-treatment of mesenchymal stem cells protein phosphatase type 2A. Circ Res 96: 54 –63, 2005. with a combination of growth factors enhances gap junction formation, 3. Ai Z, Fischer A, Spray DC, Brown AM, Fishman GI. Wnt-1 regulation cytoprotective effect on cardiomyocytes, and therapeutic efficacy for of connexin43 in cardiac myocytes. J Clin Invest 105: 161, 2000. myocardial infarction. J Am Coll Cardiol 51: 933–943, 2008. 4. Alfaro MP, Pagni M, Vincent A, Atkinson J, Hill MF, Cates J, 23. Haider H, Jiang S, Idris NM, Ashraf M. IGF-1-overexpressing mesen- Davidson JM, Rottman J, Lee E, Young PP. The Wnt modulator sFRP2 chymal stem cells accelerate bone marrow stem cell mobilization via enhances mesenchymal stem cell engraftment, granulation tissue forma- paracrine activation of SDF-1alpha/CXCR4 signaling to promote myocar- tion and myocardial repair. Proc Natl Acad Sci USA 105: 18366 –18371, dial repair. Circ Res 103: 1300 –1308, 2008. 2008. 24. Halbach M, Egert U, Hescheler J, Banach K. Estimation of action 5. Angoulvant D, Ivanes F, Ferrera R, Matthews PG, Nataf S, Ovize M. potential changes from field potential recordings in multicellular mouse Mesenchymal stem cell conditioned media attenuates in vitro and ex vivo cardiac myocyte cultures. Cell Physiol Biochem 13: 271–284, 2003. myocardial reperfusion injury. J Heart Lung Transplant 30: 95–102, 2011. 6. Archbold HC, Yang YX, Chen L, Cadigan KM. How do they do Wnt 25. Hannoush RN. Kinetics of Wnt-driven beta-catenin stabilization revealed they do?: regulation of transcription by the Wnt/beta-catenin pathway. by quantitative and temporal imaging. PLos One 3: e3498, 2008. Acta Physiol (Oxf) 204: 74 –109, 2012. 26. Haq S, Michael A, Andreucci M, Bhattacharya K, Dotto P, Walters B, 7. Beeres SL, Atsma DE, van der Laarse A, Pijnappels DA, van Tuyn J, Woodgett J, Kilter H, Force T. Stabilization of beta-catenin by a Fibbe WE, de Vries AA, Ypey DL, van der Wall EE, Schalij MJ. Wnt-independent mechanism regulates cardiomyocyte growth. Proc Natl Human adult bone marrow mesenchymal stem cells repair experimental Acad Sci USA 100: 4610 –4615, 2003. conduction block in rat cardiomyocyte cultures. J Am Coll Cardiol 46: 27. Herrmann JL, Abarbanell AM, Wang Y, Weil BR, Poynter JA, 1943–1952, 2005. Manukyan MC, Meldrum DR. Transforming growth factor-alpha en- 8. Boomsma RA, Swaminathan PD, Geenen DL. Intravenously injected hances stem cell-mediated postischemic myocardial protection. Ann Tho- mesenchymal stem cells home to viable myocardium after coronary rac Surg 92: 1719 –1725, 2011. occlusion and preserve systolic function without altering infarct size. Int J 28. Jacquemet V, Henriquez CS. Loading effect of fibroblast-myocyte Cardiol 122: 17–28, 2007. coupling on resting potential, impulse propagation, and repolarization: 9. Chang MG, Tung L, Sekar RB, Chang CY, Cysyk J, Dong P, Marban insights from a microstructure model. Am J Physiol Heart Circ Physiol E, Abraham MR. Proarrhythmic potential of mesenchymal stem cell 294: H2040 –H2052, 2008. transplantation revealed in an in vitro coculture model. Circulation 113: 29. Kawano S, Otsu K, Kuruma A, Shoji S, Yanagida E, Muto Y, 1832–1841, 2006. Yoshikawa F, Hirayama Y, Mikoshiba K, Furuichi T. ATP autocrine/10. Chen B, Dodge ME, Tang W, Lu J, Ma Z, Fan CW, Wei S, Hao W, paracrine signaling induces calcium oscillations and NFAT activation in Kilgore J, Williams NS, Roth MG, Amatruda JF, Chen C, Lum L. human mesenchymal stem cells. Cell Calcium 39: 313–324, 2006. Small molecule-mediated disruption of Wnt-dependent signaling in tissue 30. Kinnaird T, Stabile E, Burnett MS, Shou M, Lee CW, Barr S, Fuchs regeneration and cancer. Nat Chem Biol 5: 100 –107, 2009. S, Epstein SE. Local delivery of marrow-derived stromal cells augments11. Cho J, Zhai P, Maejima Y, Sadoshima J. Myocardial injection with collateral perfusion through paracrine mechanisms. Circulation 109: GSK-3(beta)-overexpressing bone marrow-derived mesenchymal stem 1543–1549, 2004. AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org
  • 11. MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES H60931. Krejci P, Aklian A, Kaucka M, Sevcikova E, Prochazkova J, Masek 46. Quevedo HC, Hatzistergos KE, Oskouei BN, Feigenbaum GS, Rodri- JK, Mikolka P, Pospisilova T, Spoustova T, Weis M, Paznekas WA, guez JE, Valdes D, Pattany PM, Zambrano JP, Hu Q, McNiece I, Wolf JH, Gutkind JS, Wilcox WR, Kozubik A, Jabs EW, Bryja V, Heldman AW, Hare JM. Allogeneic mesenchymal stem cells restore Salazar L, Vesela I, Balek L. Receptor tyrosine kinases activate canon- cardiac function in chronic ischemic cardiomyopathy via trilineage differ- ical WNT/beta-catenin signaling via MAP kinase/LRP6 pathway and entiating capacity. Proc Natl Acad Sci USA 106: 14022–14027, 2009. direct beta-catenin phosphorylation. PLos One 7: e35826, 2012. 47. Raaijmakers HG, Van Den Bosch G, Boezeman J, De Witte T,32. Leiker M, Suzuki G, Iyer VS, Canty JM Jr, Lee T. Assessment of a Raymakers RA. Single-cell image analysis to assess ABC-transporter- nuclear affinity labeling method for tracking implanted mesenchymal stem mediated efflux in highly purified hematopoietic progenitors. Cytometry cells. Cell Transplant 17: 911–922, 2008. 49: 135–142, 2002.33. Leroux L, Descamps B, Tojais NF, Seguy B, Oses P, Moreau C, Daret 48. Salazar KD, Lankford SM, Brody AR. Mesenchymal stem cells produce D, Ivanovic Z, Boiron JM, Lamaziere JM, Dufourcq P, Couffinhal T, Wnt isoforms and TGF-␤1 that mediate proliferation and procollagen Duplaa C. Hypoxia preconditioned mesenchymal stem cells improve vascular and skeletal muscle fiber regeneration after ischemia through a expression by lung fibroblasts. Am J Physiol Lung Cell Mol Physiol 297: Wnt4-dependent pathway. Mol Ther 18: 1545–1552, 2010. L1002–L1011, 2009.34. Ling L, Nurcombe V, Cool SM. Wnt signaling controls the fate of 49. Shang YC, Wang SH, Xiong F, Zhao CP, Peng FN, Feng SW, Li MS, mesenchymal stem cells. Gene 433: 1–7, 2009. Li Y, Zhang C. Wnt3a signaling promotes proliferation, myogenic dif- Downloaded from http://ajpheart.physiology.org/ at Universidad De Santiago on April 1, 201335. Liu X, Ma B, Malik AB, Tang H, Yang T, Sun B, Wang G, Minshall ferentiation, and migration of rat bone marrow mesenchymal stem cells. RD, Li Y, Zhao Y, Ye RD, Xu J. Bidirectional regulation of neutrophil Acta Pharmacol Sin 28: 1761–1774, 2007. migration by mitogen-activated protein kinases. Nat Immunol 13: 457– 50. Valiunas V, Doronin S, Valiuniene L, Potapova I, Zuckerman J, 464, 2012. Walcott B, Robinson RB, Rosen MR, Brink PR, Cohen IS. Human36. Markel TA, Wang Y, Herrmann JL, Crisostomo PR, Wang M, mesenchymal stem cells make cardiac connexins and form functional gap Novotny NM, Herring CM, Tan J, Lahm T, Meldrum DR. VEGF is junctions. J Physiol 555: 617, 2004. critical for stem cell-mediated cardioprotection and a crucial paracrine 51. van der Heyden MA, Rook MB, Hermans MM, Rijksen G, Boonstra factor for defining the age threshold in adult and neonatal stem cell J, Defize LH, Destree OH. Identification of connexin43 as a functional function. Am J Physiol Heart Circ Physiol 295: H2308 –H2314, 2008. target for Wnt signalling. J Cell Sci 111: 1741–1749, 1998.37. Mills WR, Mal N, Kiedrowski MJ, Unger R, Forudi F, Popovic ZB, 52. von Marschall Z, Fisher LW. Secreted Frizzled-related protein-2 Penn MS, Laurita KR. Stem cell therapy enhances electrical viability in (sFRP2) augments canonical Wnt3a-induced signaling. Biochem Biophys myocardial infarction. J Mol Cell Cardiol 42: 304 –314, 2007. Res Commun 400: 299 –304, 2010.38. Miragoli M, Gaudesius G, Rohr S. Electrotonic modulation of cardiac 53. Wang D, Shen W, Zhang F, Chen M, Chen H, Cao K. Connexin43 impulse conduction by myofibroblasts. Circ Res 98: 801–810, 2006. promotes survival of mesenchymal stem cells in ischaemic heart. Cell Biol39. Mirotsou M, Zhang Z, Deb A, Zhang L, Gnecchi M, Noiseux N, Mu H, Pachori A, Dzau V. Secreted frizzled related protein 2 (Sfrp2) is the Int 34: 415–423, 2010. key Akt-mesenchymal stem cell-released paracrine factor mediating myo- 54. Wang D, Zhang F, Shen W, Chen M, Yang B, Zhang Y, Cao K. cardial survival and repair. Proc Natl Acad Sci USA 104: 1643–1648, Mesenchymal stem cell injection ameliorates the inducibility of ventric- 2007. ular arrhythmias after myocardial infarction in rats. Int J Cardiol 152:40. Noiseux N, Gnecchi M, Lopez-Ilasaca M, Zhang L, Solomon SD, Deb 314 –320, 2011. A, Dzau VJ, Pratt RE. Mesenchymal stem cells overexpressing Akt 55. Williams AR, Hare JM. Mesenchymal stem cells: biology, pathophysi- dramatically repair infarcted myocardium and improve cardiac function ology, translational findings, and therapeutic implications for cardiac despite infrequent cellular fusion or differentiation. Mol Ther 14: 840 – disease. Circ Res 109: 923–940, 2011. 850, 2006. 56. Williams AR, Trachtenberg B, Velazquez DL, McNiece I, Altman P,41. Okoye UC, Malbon CC, Wang HY. Wnt and Frizzled RNA expression Rouy D, Mendizabal AM, Pattany PM, Lopera GA, Fishman J, in human mesenchymal and embryonic (H7) stem cells. J Mol Signal 3: Zambrano JP, Heldman AW, Hare JM. Intramyocardial stem cell 16, 2008. injection in patients with ischemic cardiomyopathy: functional recovery42. Pijnappels DA, van Tuyn J, de Vries AA, Grauss RW, van der Laarse and reverse remodeling. Circ Res 108: 792–796, 2011. A, Ypey DL, Atsma DE, Schalij MJ. Resynchronization of separated rat 57. Yokokawa M, Ohnishi S, Ishibashi-Ueda H, Obata H, Otani K, cardiomyocyte fields with genetically modified human ventricular scar Miyahara Y, Tanaka K, Shimizu W, Nakazawa K, Kangawa K, fibroblasts. Circulation 116: 2018 –2028, 2007. Kamakura S, Kitamura S, Nagaya N. Transplantation of mesenchymal43. Pimentel RC, Yamada KA, Kleber AG, Saffitz JE. Autocrine regulation stem cells improves atrioventricular conduction in a rat model of complete of myocyte Cx43 expression by VEGF. Circ Res 90: 671–677, 2002. atrioventricular block. Cell Transplant 17: 1145–1155, 2008.44. Psaltis PJ, Paton S, See F, Arthur A, Martin S, Itescu S, Worthley SG, Gronthos S, Zannettino AC. Enrichment for STRO-1 expression en- 58. Zeevi-Levin N, Barac YD, Reisner Y, Reiter I, Yaniv G, Meiry G, hances the cardiovascular paracrine activity of human bone marrow- Abassi Z, Kostin S, Schaper J, Rosen MR, Resnick N, Binah O. Gap derived mesenchymal cell populations. J Cell Physiol 223: 530 –540, junctional remodeling by hypoxia in cultured neonatal rat ventricular 2010. myocytes. Cardiovasc Res 66: 64 –73, 2005.45. Psaltis PJ, Zannettino AC, Worthley SG, Gronthos S. Concise review: 59. Zhang Z, Deb A, Zhang Z, Pachori A, He W, Guo J, Pratt R, Dzau VJ. mesenchymal stromal cells: potential for cardiovascular repair. Stem Cells Secreted frizzled related protein 2 protects cells from apoptosis by block- 26: 2201–2210, 2008. ing the effect of canonical Wnt3a. J Mol Cell Cardiol 46: 370 –377, 2009. AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org

×