Uploaded on

Diversidad genética, estructura poblacional y selección de materiales superiores de Guadua angustifolia Kunth

Diversidad genética, estructura poblacional y selección de materiales superiores de Guadua angustifolia Kunth

More in: Education
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
1,320
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
30
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. BAMBU DE COLOMBIA SA DIVERSIDAD GENÉTICA, ESTRUCTURA POBLACIONAL Y SELECCIÓN DE CLONESSUPERIORES DE Guadua angustifolia Kunth EN LA ECO-REGIÓN CAFETERA DE COLOMBIA JAIME EDUARDO MUÑOZ FLOREZ XIMENA LONDOÑO ELEONORA NUÑEZ LEONOR CRISTINA MORALES PAULA ANDREA RUGELES ANDRES MAURICIO POSSO FRANCO ALIRIO VALLEJO
  • 2. INTRODUCCIÓN • Bambú: «Oro Verde» del siglo XXI. • contribuye a mitigar efectos del cambio climático. • Sustituye a la madera. • Metas para el desarrollo del milenio ONU. • - Sostenibilidad ambiental. • - Mejorar condiciones de vida de millones de desplazados. • - utilizado en : construcción, alimentación, industrialización, producción de papel, conservación ambiental.Phyllostachys heterocycla var. pubescens
  • 3. IMPORTANCIA ECONOMICACHINAÁrea Cultivada: 5 millones ha (2004)Incremento anual área: 50.000 haNumero agricultores: 10 millonesEmpresas Bambú: 30.000Número de empleos industria bambú: 5,7 mill.Valor producción industria bambú: 8,97 billones $USD (Zhu, 2007)Valor exportación productos bambú: USD$1.500 mill. (Zhu, 2007). Figure 4: Chinas bamboo product export (in million US$) 1600 1500 1400 1200 1200 1000 800 600 800 950 400 650 700 200 439 500 0 170 1990 1996 1998 2000 2002 2004 2005 2006 2007
  • 4. COLOMBIAÁrea estimada: 51.000 ha.55% en región cafetera.Área cultivada: 4.800 ha.Incremento anual área: 193 ha últimos 25 años Rodríguez, 2005Número de culmos producidos/año: 340.000.Numero Personas beneficiadas: 100.000 .Empresas Bambú: 101. Demanda de guadua por sector Construcción Muebles & Artesanias Preindustrialización 2% 8% 90%
  • 5. INVESTIGACIONES PREVIAS SOBRE EFECTO AMBIENTAL Y DIVERSIDAD• F = G + A + GxA• Solo se reconoce efecto ambiental A.• Características de productividad y calidad varían por condiciones de sitio ( Camargo 2006, Ortega y Zuluaga 2006, García 2004 ).• Investigaciones sobre diversidad:• - Marulanda et al 2002 AFLP.• - Potosi 2005 RAPD.• - Perez et al 2009, SSR.• - Torres SSR.
  • 6. • Especies de bambúes en el mundo: aprox. 1400 spp. & 108 géneros.• 34% América: 470 spp & 41 géneros.
  • 7. ESPECIES DE GUADUA EN1. COLOMBIA G. angustifolia Kunth2. G. amplexifolia Presl3. G. glomerata Munro4. G. incana Londoño5. G. macrospiculata Londoño & Clark6. G. paniculata Munro7. G. superba Huber G. paniculata8. G. uncinata Londoño & Clark9. G. weberbaueri PilgerG. glomerata G. uncinata G. amplexifolia G. incana
  • 8. VARIEDADES BOTÁNICAS DE G. angustifolia var. angustifolia var. bicolor var. nigra
  • 9. DISTRIBUCIÓN DE Guadua angustifolia Antioquia Santander Casanare Chocó Boyacá Caldas Risaralda Cundinamarca Quin dío Valle Tolima Meta Cauca Huila Nariño Caquetá PutumayoDistribución en América: Colombia,Ecuador, Perú y Venezuela. Distribución en Colombia
  • 10. OBJETIVOSGeneralContribuir a conocer y utilizar la diversidad genética de Guaduaangustifolia Kunth. Específicos• Explorar, seleccionar y recolectar materiales superiores de Guadua angustifolia en la región cafetera con base en características físico-mecánicas, de calidad y de productividad para los diferentes sectores de la cadena: construcción, pre- industrialización, y muebles y artesanías.• Conocer la diversidad genética de la G. angustifolia, la estructura poblacional y proponer hipótesis sobre la variación intraguadual..
  • 11. SELECCIÓN DE SITIOS Aprovechadores (42) Encuestas Dueños de fincas (125) (23)Identificación Empresarios de sitios (60) Octubre 2008 Armenia, Pereira Manizales y Abril del 2009 Norte del Valle
  • 12. Aprovechadores Biotipos Ubicación de fincasActividad & sobresalientes por: Biodiversidad Dureza,Contratista Diámetro, Longitud y Espesor Cortero Rectitud, Forma de entrenudos Carguero Presencia ganchos Sanidad guadual
  • 13. Dueños de fincasUbicación del Tipos de guadual aprovechamiento Productos que se Georeferenciación extraen Uso en la finca Procedencia • Biotipos • Natural • Plantado Función del guadual
  • 14. Empresarios Tamaño empresaEmpresas Productos Procedencia – Características Porción usada Tipo de mercado
  • 15. FINCA MPIO. DPTO. 1 EL BAMBUSAL "A" Montenegro QUINDIO 2 LA ELENA "B" Montenegro QUINDIO 7 NAPOLES C, D, E, F, G Montenegro QUINDIO 8 LA SECRETA "H" Circasia QUINDIO 9 EL PORVENIR "I" Circasia QUINDIO 12 EL OCASO "J", "K" & "N" Quimbaya QUINDIO 13 BALSORA "L" Armenia QUINDIO30 sitios de 14 LA MEJORANA "M" Quimbaya QUINDIO 15 BELEN "Ñ" Circasia QUINDIO muestreo 16 YARIMA "0" Pereira RISARALDA en la eco- 18 EUPEN "P" & "Q" Pereira RISARALDA 19 FILIPINAS "R" Pereira RISARALDA región 20 LA ESMERALDA "S" Pereira RISARALDA 21 CEBG "T" Cordoba QUINDIO cafetera 22 LA PIRAGUA "U" Marcella RISARALDA 23 LA ESPAÑOLA "V" Marcella RISARALDA 24 El NARANJAL "W" Chinchina CALDAS 25 LA ESPERANZA "X" Manizales CALDAS 26 LOMAS "Y" Manizales CALDAS 27 EL NOGAL "Z" Palestina CALDAS 28 VILLA MARTHA "Alfa" Pereira RISARALDA 29 LAS BRISAS "Beta" Cartago VALLE 30 COROZAL "Gama" Cartago VALLE
  • 16. TOMA DE MUESTRAS Muestras de suelo. Muestras de herbario.Registro de caracteres vegetativos para análisis morfológico. Muestras de hojas para estudios de ADN. Probetas para propiedades físico – mecánicas. Extracción de Chusquines.
  • 17. Premisas para la Selección de guadua según el uso final 1. Características morfométricas PARA CONSTRUCCIÓN Se parte de las siguientes premisas: 1. Tamaño: prefieren guaduas entre 9 y 12 cm diámetro. 2. Longitud comercial del culmo: preferiblemente mayor a 12 m. 3. Culmos rectos. 4. Culmos casi cilíndricos. 5. Culmos maduros o “hechos”.
  • 18. PARA PRE-INDUSTRIALIZACIONSe parte de las siguientes premisas:1. Espesor de pared, mayor de 1,5 cm (NTC 5829).2. Mayor volumen de madera.3. Diámetros de los culmos iguales o mayores a 10 cm.4. Culmo recto.5. Entrenudos simétricos.
  • 19. PARA MUEBLES & ARTESANIASSe parte de las siguientes premisas:1. Diversos diámetros, los fabricantes de muebles prefieren entre 8 y 10 cm.2. Culmos no estrictamente rectos por que a las curvas le dan valor agregado.3. Lumen pequeño.4. Rarezas.
  • 20. PRODUCCION DE ESTERILLAS PREMISAS1. Longitud de la circunferencia externa: mayor de 30 cm.2. Área de la esterilla: ancho mayor a 30 cm y un espesor igual o mayor de 1,5 cm.
  • 21. Selección de guadua según uso final 2. Características físico-mecánicasUNIVERSIDAD NACIONAL DECOLOMBIA SEDE BOGOTÁINSTITUTO DE INVESTIGACIONESTECNOLÓGICAS• Compresión Paralela a la fibra Ensayo Corte• Corte paralelo a la fibra• Módulo de elasticidad a la compresión• Contenido de Humedad Ensayo Compresión
  • 22. Metodología RAMs Y SSR para Caracterizar la Estructura Genética de Guadua angustifolia MATERIAL VEGETAL ADN TOTAL PROCESO DE EXTRACCIÓN DE ADN AMPLIFICACIÓN E IMPLEMENTOS DE EXTRACCIÓN PRODUCTO PCR DE LA DENDROGRAMA AMPLIFICACIÓN CON MICROSATELITES
  • 23. MARCADORES MICROSATÉLITES (PÉREZ, 2009)Locus No. Secuencia de cebadores 5´- 3’ Motivo Alelos Ho He PIC R: CCTTCACATGGTCTCACAAGFJ444930 (GATA)8 7 0,40 0,40 0,38 F: CAGTCTAGCAATCAATTTGAAG R: CTAGATCTTCCTAATCAAAGTGGFJ444929 (GATA)10 8 0,67 0,67 0,61 F: TACTAACCGATTGTCCCGTCTAG R: CGCCACGTTAATCCCAGTTAGGFJ444932 (CTAT)10 4 0,27 0,44 0,38 F: CCTATACATATATGCATTGTGTGG R: GTTCCTACATGTAGACATATCCFJ476075 (CTAT)13 5 0,33 0,40 0,36 F: CTCTTGGGAGTGAGCATGGTGAC R: CCCGACAGATAGATGGTCAAAFJ444934 (GATA)16 8 0,47 0,74 0,66 F: CTCATTTCTCAATTGCGCAAGAG R: GTCAATCACGCCAGCTCTAACAFJ444931 (GATA)16 9 1,00 0,84 0,80 F: CTCTGACATGTATGGATCTTGCA R: CCCAACAAAGATGGTCAGATFJ444936 (GATA)9 9 1,00 0,86 0,83 F: CAGGAGATGAGCCTGTTAGT R: CTAGGCCCACTCCTATCCCAFJ444935 (CTAT)8 3 0,50 0,63 0,48 F: AGCTTCCTCAGAATGCCTAATTA R: CCTTCAATTAGTACATAGATAGFJ476076 (GATA)8 4 0,88 0,73 0,62 F: GTACAGAACCATCTCATCCT
  • 24. VARIACIÓN INTRAGUADUAL• Información de RAMs y Microsatélites.• 24 muestras en la hacienda Nápoles.• Estimación de He y Ho.• Colecta de flósculos en diferentes sitios.• Estimación del número de semillas por flósculo.• Evaluación de % germinación.• Estimación de número de semillas por planta.• Teoría sobre la constitución genética de los guaduales.
  • 25. A1 A2 A3 C1 C2 C3 D1 Dendrograma construido D3 D2 E1 E2 E3 M1 M2 con marcadores RAMs M3 W1 W2 W3 ALFA1 ALFA2 ALFA3 H1 H2 H3 B1 B2 F1 F2 G1 G2 G3 N1 N3 O1 O2 O3 Ñ1 Ñ2 Ñ3 J1 J2 J3 L1 L2 L3 K2 K3 P1 P3 P2 Q1 Q2 R1 Q3 T1 T3 U1 U3 B3 I1 I2 I3 K1 N2 V3 U2 V1 V2 R2 R3 T2 X1 Y2 Y3 Y1 X2 X3 BETA1 BETA3 BETA2 GAMA1 GAMA2 GAMA3 S1 S2 S3 Z1 Z2 Z30.00 0.25 0.50 0.75 1.00
  • 26. A1 A2 A3 D3 D5 D1 E2 E4 G3 B1 B2 B3 Dendrograma para 30 M1 C1 C2 C5 E5 M2 M3 H2 sitios utilizando H3 P3 F1 F2 G2 G1 O1 O2 microsatélites. O3 T2 T3 T1 a1 a2 a3 U1 U2 U3 V1 V3 V2 H1 Z1 P1 P2 Q3 Q1 Q2 R1 R2 Z2 R3 Z3 W1 W2 W3 I1 I2 L1 L3 L2 I3 J1 J3 J2 K1 K2 K3 ß1 ß2 ß3 s1 s2 s3 N1 N2 N3 Ñ1 Ñ2 Ñ3 S11 S10 S12 X1 X2 X3 Y1 Y2 Y3 PE1 PE2 PE30.00 0.25 0.50 0.75 1.00 Coefficient
  • 27. • Alta diversidad genética.• RAMs He = 0,32 , SSR He = 0,50• Fst= 0.10 RAMs SSR, moderada diferenciación genética.• Variación intraguadual.• Los guaduales de Caldas son los que más difieren.• Hay diferencia entre guaduas Colombianas y Peruanas
  • 28. Dendrograma obtenido de 24 muestras de la Hacienda Nápoles usando RAMs Y Microsatelites 1 1 2 2 3 4 4 9 5 17 9 16 15 3 16 7 6 8 12 18 13 5 14 6 7 10 8 13 10 14 11 11 17 12 19 15 18 19 20 20 21 21 22 24 24 22 23 2300 0.08 0.75 0.17 0.25 0.33 1.00 0.42 0.50 0.58 0.67 0.75 0.83 0.92 1.00 Coefficient
  • 29. Dinámica de la reproducciónsexual de Guadua angustifolia.
  • 30. CONCLUSIONES1. Se encontró una alta variabilidad en características asociadas a construcción, preindustrialización, y muebles y artesanías lo que permitió identificar CINCO materiales superiores para en construcción, DOS en pre industrialización y DOS en muebles y artesanías.2. Existe una alta diversidad genética en la eco región cafetera de Colombia y existe estructura poblacional asociada a ubicación geográfica.
  • 31. CONCLUSIONES3. La variación intraguadual en la mayoría de los sitios evaluados sugiere que la reproducción sexual ha generado variaciones genotípicas a través del tiempo.4. La alta heterocigosidad observada, que supera a la esperada y explicada en parte por la posición del estigma plumoso con relación a las anteras, sugiere también que existen mecanismos de autoincompatibilidad.
  • 32. Agradecimientos• Lynn Clark • Ana Cruz Morillo• Mario García • Francisco Sánchez• Tulio Cesar Lagos • Sofía de la Pava• Nancy Barrera • Martha Londoño• Juan Jaramillo • Ana Milena Caicedo• Edgar Iván Estrada • Nancy Cardozo• Luz Ángela Álvarez • Paola Zuluaga• Diego Marmolejo • Yamileth Chagüezá V• Yacenia Morillo • Grupo de Investigación en Diversidad Biológica
  • 33. Instituciones• Universidad Nacional de Colombia – Sede Palmira y Sede Bogotá.• Ministerio de Agricultura y Desarrollo Rural.• Sociedad Colombiana del Bambú.• Hacienda la Esmeralda. Montenegro-Quindío.• Corporación Regional del Quindío – CRQ.• Bambú de Colombia.
  • 34. «El abrazo de la guadua»
  • 35. RECOMENDACIONESHacer una selección de materiales superiores a nivel nacionalcon otros grupos de investigación del país.Completar el estudio de biología floral e iniciar un programa demejoramiento genético.Establecer las relaciones filogenéticas entre las especies delgenero Guadua.Iniciar un plan de vigilancia tecnológica y de denominación deorigen que permita patentar procesos y productos innovadoresrealizados con y para la especie Guadua angustifolia Kunth