• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Biología I (II Bimestre)
 

Biología I (II Bimestre)

on

  • 9,637 views

Universidad Técnica Particular de Loja

Universidad Técnica Particular de Loja
Gestión Ambiental
Biología I
II Bimestre
Abril-Agosto 2007
Ponente: Blgo. Máximo Moreira

Statistics

Views

Total Views
9,637
Views on SlideShare
9,617
Embed Views
20

Actions

Likes
2
Downloads
137
Comments
1

1 Embed 20

http://www.slideshare.net 20

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel

11 of 1 previous next

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
  • un pregunta podrias explicarme que relacion ahy entre la ley de segregacion y la meiosis. gracias
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Biología I (II Bimestre) Biología I (II Bimestre) Presentation Transcript

    • ESCUELA : PONENTE : BIMESTRE : BIOLOG ÍA I CICLO : GESTI ÓN AMBIENTAL II BIMESTRE Blgo. M áximo Moreira ABRIL – AGOSTO 2007
      • Temas a tratar:
      • Ciclo celular
        • Interfase
        • Mitosis
        • Citocinesis
      • Meiosis y reproducción sexual
      • Diferencias mitosis-meiosis
      • Leyes de Mendel
      • ADN
    • CICLO CELULAR En los cromosomas el material genético se encuentra organizado en secuencias de nucleótidos llamadas genes. Los genes portan información esencial para el funcionamiento de la célula y se distribuyen en forma equitativa entre las células hijas, esto se da por la división celular.
    • Una célula individual crece asimilando sustancias de su ambiente y transformándolas en nuevas moléculas estructurales y funcionales. Cuando una célula alcanza cierto tamaño crítico y cierto estado metabólico, se divide.
      • CICLO CELULAR (eucariotas, por mayor cantidad de cromosomas)
      • Se divide en tres fases principales:
      • INTERFASE, MITOSIS Y CITOCINESIS
        • INTERFASE (de preparación), duplicación de cromosomas y producción de orgánulos para las células hijas 3 Fases
    •  
        • CICLO CELULAR…
        • MITOSIS : División del núcleo (repartición de los cromosomas duplicados e idénticos en las células hijas) y se reconstituye el núcleo celular.
        • Profase, los pares de centriolos se separan y comienza la formación del huso. Desaparece la envoltura nuclear, queda en contacto citoplasma con cromosomas
        • Metafase temprana, pares de cromátidas se van ubicándose en plano ecuatorial
        • Metafase tardía, ubicación exacta en el centro
        • Anafase, los centrómeros desaparecen desde el centro a los polos separando a las cromátidas pares transformándolas en cromosomas separados
        • Telofase, aparece la envoltura nuclear
        • CITOCINESIS (división del citoplasma y orgánulos)
    •  
    • Cromosomas Homólogos
    •  
      • MEIOSIS Y REPRODUCCIÓN
      • SEXUAL
      • DEFINICIONES PREVIAS
      • Gametos : células sexuales
      • Cigoto : célula diploide producida por fusión de gametos
      • Haploide : una dotación de cromosomas
      • Diploide : dos dotaciones de cromosomas
      • Homólogos : pareja de un cromosoma
      • Entrecruzamiento (crossing over): intercambio de un segmento del cromosoma, permite recombinación del material genético
    • La reproducción sexual requiere, en general, de dos progenitores y siempre involucra dos hechos: la fecundación y la meiosis. La fecundación es el medio por el cual las dotaciones genéticas de ambos progenitores se reúnen y forman una nueva identidad genética, la de la progenie. La meiosis es un tipo especial de división nuclear en el que se redistribuyen los cromosomas y se producen células que tienen un número haploide de cromosomas (n). La fecundación restablece el número diploide (2n).
    • Cada una de las células haploides producidas por meiosis contiene un complejo único de cromosomas, debido al entrecruzamiento o crossing over y a la segregación al azar de los cromosomas. De esta manera, la meiosis es una fuente de variabilidad en la descendencia. FASES: Meiosis I y Meiosis II, cada una compuesta por profase, metafase, anafase, telofase.
    •  
    • DIFERENCIAS 1.- En meiosis, cada núcleo diploide se divide dos veces, produciendo un total de cuatro núcleos. Sin embargo, los cromosomas se duplican sólo una vez, antes de la primera división nuclear. Por lo tanto, cada uno de los cuatro núcleos producidos contiene la mitad del número de cromosomas presentes en el núcleo original. A diferencia de lo que ocurre en la meiosis, en la mitosis, luego de la duplicación de los cromosomas, cada núcleo de divide sólo una vez. En consecuencia, el número de cromosomas se mantiene invariable.
    • 2.- Debido al fenómeno del entrecruzamiento y al de segregación al azar de los cromosomas, durante la meiosis se recombina el material genético de los progenitores, lo que no ocurre en la mitosis. 3.- La mitosis puede ocurrir en células haploides o diploides, mientras que la meiosis ocurre solamente en células con un número diploide (o poliploide) de cromosomas. La meiosis ocurre en diferentes momentos del ciclo vital, según en que especie se produzca. La meiosis en los animales produce gametos, en las plantas produce esporas. Una espora es una célula reproductora haploide que, a diferencia de un gameto, puede producir un organismo haploide sin haberse fusionado previamente con otra célula.
    •  
    • COMIENZO DE LA GENÉTICA La gran contribución de Mendel fue demostrar que LAS CARACTERISTICAS HEREDADAS SON LLEVADAS EN UNIDADES DISCRETAS QUE SE REPARTEN POR SEPARADO -se redistribuyen– en cada generación. Estas unidades discretas, que Mendel llamó elemente , son los que hoy conocemos como genes.
    • LEYES DE MENDEL primera ley de Mendel o PRINCIPIO DE SEGREGACIÓN La hipótesis de que cada individuo lleva un par de factores para cada característica y que los miembros del par segregan –es decir, se separan– durante la formación de los gametos. segunda ley de Mendel o PRINCIPIO DE DISTRIBUCION INDEPENDIENTE Establece que, cuando se forman los gametos, los alelos del gen para una característica dada segregan independientemente de los alelos del gen para otra característica.
    • DEFINICIONES PREVIAS Gen: La unidad de la herencia en un cromosoma; secuencia de nucleótidos en la molécula de DNA que desempeña una función específica, tal como codificar una molécula de RNA o un polipéptido Alelo: Dos o más formas diferentes de un gen. Los alelos ocupan la misma posición (locus) en los cromosomas homólogos y se separan uno de otro en la meiosis Cigoto: célula diploide producida por fusión de gametos Homocigoto: Organismo diploide que lleva alelos idénticos en uno o más loci génicos Heterocigoto: Organismo diploide que lleva dos alelos diferentes en uno o más loci génicos
    • Fenotipo: Características observables de un organismo que resultan de las interacciones entre el genotipo y el ambiente (pH, etc) Genotipo: La constitución genética de una sola célula o de un organismo con referencia a una sola característica o a un conjunto de características; la suma total de todos los genes presentes en un individuo. Alelo dominante: Alelo que se expresa dando el mismo fenotipo tanto cuando se encuentra en condición heterocigótica como homocigótica. AA o aa Alelo recesivo: Alelo cuyo efecto fenotípico está enmascarado en el heterocigoto por el de otro alelo dominante Aa
    • primera ley de Mendel o PRINCIPIO DE SEGREGACIÓN
    • Esquema de segregación De los alelos durante la Formación de los gametos
    • Esquema del Principio de Segregación de Mendel
    • El segundo principio de Mendel, el principio de la distribución independiente, se aplica al comportamiento de dos o más genes diferentes. Este principio establece que los alelos de un gen segregan independientemente de los alelos de otro gen. Cuando se cruzan organismos heterocigotas para cada uno de los genes que se distribuyen independientemente, la relación fenotípica esperada en la progenie es 9:3:3:1.
    • Los principios de Mendel no se cumplen en su totalidad, hay sus excepciones, así tenemos: La determinación cromosómica del sexo, cromosomas sexuales homogaméticos, típicamente las hembras XX, o heterogamético por lo general los machos XY Ligamiento entre genes y recombinación, basados en la distancia genética, esto explica como pueden ir juntas dos características Aunque la interacción de la gran mayoría de los alelos ocurre según la modalidad dominante-recesivo, en algunos casos existe dominancia incompleta (fenotipo intermedio) y codominancia (heterocigoto que expresa ambos alelos).
    • Además, aunque sólo dos alelos están presentes en cualquier individuo diploide, en una población de organismos un solo gen puede tener alelos múltiples, como resultado de una serie de diferentes mutaciones de ese gen. La interacción entre genes puede originar fenotipos nuevos y, en algunos casos, los genes pueden presentar epistasis , uno de ellos modificar el efecto del otro . Como resultado, se alteran las proporciones fenotípicas esperadas según las leyes de Mendel. Asimismo, un solo gen puede afectar dos o más características que aparentemente no están relacionadas ; esta propiedad de un gen se conoce como pleitropía . En muchas características, la expresión fenotípica está influida por varios genes; este fenómeno se conoce como herencia poligénica .
    • ADN
      • Cada nucleótido que forma parte de la cadena de ADN
      • está formado de:
      • un azúcar desoxirribosa
      • un grupo fosfato
      • base púrica (AG) o pirimídica (TCU)
      • La Timina se une con la Adenina 2 puentes
      • La Citosina se une con la Guanina 3 puentes
      • Estas uniones se basan en el peso molecular
      • En el caso del ARN cambia la Timina por Uracilo
      • La A del RNA se une con la T del DNA
      • El U del RNA se une con la A del DNA
    • DÓNDE ESTÁ EL ADN
    •  
    •  
    • ADN Cromatina
    • NUCLEO CITOPLASMA Hebras de ADN 2n = 20
    •  
    • GEN AMBAS HEBRAS LLEVAN EL MISMO TIPO DE INFORMACI ON PERO PUEDE SER DE DIFERENTE “MODELO”
    • ATCGCGTATAATCGCGGCGCTACG CGCGGCATTACGCGCGTATAATGC GEN COLOR DE LA SEMILLA GEN COLOR DE LA SEMILLA
    • ATCGCGTATAATCGCGGCGCTACG CGCGGCATTACGCGCGTATAATGC ALELO QUE CODIFICA SEMILLAS COLOR VERDE (a) ALELO QUE CODIFICA SEMILLAS COLOR AMARILLO (A)
      • Replicación del DNA
      • Consiste en la duplicación o síntesis del DNA. Sus bases:
        • La cadena de ADN se sintetiza copiando una hebra
        • de ADN preexistente-molde.
        • Las enzimas que copian los ácidos nucleicos son las
        • Polimerasa
        • La ADN polimerasa necesita un iniciador sobre el cual puedan adicionar nucleótidos.
    • Replicación Semiconservadora: La síntesis del ADN se realiza antes de la división celular durante la interfase y se dice que es semiconserva dora por el hecho de que cada una de las dobles hélices de nueva formación está constituida por una hebra preexistente y una de nueva síntesis.
    • DEL DNA A LA PROTEINA: PAPEL DEL RNA El RNA se encuentra en el citoplasma y es el encargado de la síntesis de proteínas. TRANSCRIPCIÓN: es cuando la cadena de ADN se usa para obtener una de ARN y se da de la misma forma que en la replicación del ADN, va de 3´a 5´ entonces el ARN va de 5´a 3´
    • ROLES DEL ADN A : TRANSMISIÓN DE CARACTERÍSTICAS B: EXPRESIÓN DE CARACTERÍSTICAS
    • B
    • Ribosoma
    •  
    •  
    •  
    •