• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Bases Biológicas (I Bimestre)
 

Bases Biológicas (I Bimestre)

on

  • 5,936 views

Universidad Técnica Particular de Loja

Universidad Técnica Particular de Loja
Psicología
Bases Biológicas
I Bimestre
Abril - Agosto 2007
Ponente: Ing. Iván Burneo

Statistics

Views

Total Views
5,936
Views on SlideShare
5,923
Embed Views
13

Actions

Likes
1
Downloads
101
Comments
0

3 Embeds 13

http://www.slideshare.net 9
http://pensamientosdeunfilosofo.blogspot.com 3
http://pensamientosdeunfilosofo.blogspot.com.es 1

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Bases Biológicas (I Bimestre) Bases Biológicas (I Bimestre) Presentation Transcript

    • ESCUELA : PONENTE : BIMESTRE : BASES BIOLÓGICAS CICLO : PSICOLOGÍA I BIMESTRE Ing. Iván Burneo ABRIL – AGOSTO 2007
    • OBJETIVO GENERAL Conseguir un compromiso entre la necesidad de que el estudiante adquiera parte de la terminología básica de la biología y el ideal de que renueve de forma constante su interés por el enfoque que la BIOLOGÍA presenta del ser humano en general y el medio ambiente en particular.
    • CONTENIDOS
      • Unidad 1. Biomoléculas y organización celular
      • Unidad 2. La energía y los seres vivos
      • Unidad 3. Introducción a la genética
      • Unidad 4. Desarrollo animal y humano
      • Unidad 5. La reproducción y la conducta sexual
    • BIOMOLÉCULAS Y ORGANIZACIÓN DE LA VIDA
    • OBJETIVOS
      • Identificar los elementos que conforman la materia viva y las principales macromoléculas biológicas.
      • Identificar las reacciones químicas y sus principales propiedades físicas que participan en los seres vivos
      • Identificar las principales estructuras celulares
    • LA MATERIA VIVA CONTIENE C, H, O, N, S y P
      • Los elementos principales que conforman la materia viva son:
    • MACROMOLÉCULAS BIOLÓGICAS
      • La materia viva posee una organización compleja que tiene como base compuestos monoméricos : ácidos grasos, aminoácidos, monosacáridos y nucleótidos.
      • Muchas biomoléculas son compuestos poliméricos : proteínas, polisacáridos y ácidos nucléicos.
    • INFORMACIÓN BIOLÓGICA E INTERACCIONES
      • ENLACES COVALENTES:
      • Se forman por compartición de electrones y son bastante estables. Elementos que forman enlaces covalentes son: C, N, S, O, etc.
      • ENLACES NO COVALENTES:
      • Son enlaces débiles entre las biomoléculas y pueden ser de cuatro tipos:
          • Fuerzas de Van der Waals
          • Enlaces Iónicos
          • Puentes de Hidrógeno
          • Interacciones Hidrofóbicas
    •  
    • BIOMOLÉCULAS EN EL AGUA
    • OBJETIVOS
      • Conocer y comprender la estructura molecular del agua y la formación de puentes de H.
      • Determinar la influencia de los puentes de H en las propiedades físicas del agua.
      • Reconocer la importancia de los sistemas amortiguadores en los seres vivos.
    •  
    •  
    • MOLÉCULAS ORGÁNICAS
    •  
    • Grupo Nombre Importancia biológica – OH Hidroxilo Polar, y por esta razón soluble en agua; forma puentes de hidrógeno – C=O     I    OH Carboxilo Ácido débil (dador de hidrógeno); cuando pierde un ion hidrógeno adquiere carga negativa: – C=O     I    O - + H + – N – H     I    H Amino Base débil (aceptor de hidrógeno); cuando acepta un ion hidrógeno adquiere carga positiva:     H     I – N + – H     I    H     H     I – C=O Aldehído Polar, y por esta razón soluble en agua; caracteriza a algunos azúcares – C=O     I Cetona (o carbonilo) Polar, y por esta razón soluble en agua; caracteriza a otros azúcares     H     I – C – H     I    H Metilo Hidrofóbico (insoluble en agua)    O    II – P – OH    I   OH Fosfato Ácido (dador de hidrógeno); en solución presenta habitualmente carga negativa:    O    II – P – O - + 2H +    I   O -
    •  
    •  
    •  
    •  
    •  
    •  
    •  
    •  
    • ENZIMAS
    • CATALIZADORES BIOLÓGICOS
      • Las enzimas constituyen la clase mayor y más altamente especializada de proteínas .
      • Son catalizadores biológicos y presentan las siguientes propiedades cinéticas:
        • Disminuyen la barrera de energía de activación de una reacción.
        • Su estructura no cambia permanentemente durante una reacción.
        • No alteran la posición de equilibrio de una reacción.
        • Por lo general, actúan formando un complejo transitorio con el reactivo.
      • La sustancia sobre la que actúa el enzima se llama SUSTRATO .
      • El sustrato se une a una región concreta del enzima, llamada CENTRO ACTIVO que comprende:
        • Un sitio de unión formado por los aminoácidos que están en contacto directo con el sustrato
        • Un sitio catalítico formado por los aminoácidos directamente implicados en el mecanismo de la reacción.
      En una reacción catalizada por una enzima:
    • UNIÓN SUSTRATO-ENZIMA
      • Hay dos modelos sobre la forma de unión sustrato-enzima:
      • El modelo llave-cerradura
      • El modelo del ajuste inducido
    •  
    • MONOSACÁRIDOS
      • Son moléculas orgánicas caracterizadas por la presencia de cadenas carbonadas portadoras de grupos hidrófilo y funciones aldehídicas y cetónicas.
      • Pueden tener dos configuraciones: D o L según se encuentre el OH del penúltimo carbono hacia la derecha o hacia la izquierda respectivamente.
    •  
      • Si el grupo carbonilo está en el carbono 1, el monosacáridos es una ALDOSA .
      • Si el grupo carbonilo está en el carbono 2, el monosacáridos es una CETOSA .
    • MONOSACÁRIDOS CÍCLICOS
    • ENLACES GLICOSÍDICOS
      • La unión de los monosacáridos tiene lugar mediante enlaces glicosídicos .
      • Compuestos con grupos OH, NH 2 y SH pueden reaccionar con el OH hemiacetálico del carbono anomérico de un monosacárido, con pérdida de una molécula de agua para formar los compuestos llamados generalmente glicósidos.
      • Según la naturaleza del grupo reaccionante se distinguen:
        • O-glicósidos (a partir de un OH)
        • N-glicósidos (a partir de un NH 2 )
        • S-glicósidos (a partir de un SH)
    • REACCIONES DE LOS MONOSACÁRIDOS
      • Los monosacáridos pueden sufrir diversas reacciones para dar diversos derivados monosacáridos:
        • Por oxidación
        • Por reducción
        • Por sustitución
    • POR REDUCCIÓN:
      • Las aldosas y cetosas, por reducción del grupo carbonilo del carbono anomérico da lugar a polialcoholes como el glicerol .
      GLICEROL GLICERALDEHIDO
    • POR OXIDACIÓN:
      • Formación de un grupo carboxilo en el carbono terminal.
      • Se forma azúcares ácidos como el ácido glucorónico .
      GLUCOSA ACIDO GLUCORÓNICO
    • DESOXIDERIVADOS:
      • La sustitución de un OH alcohólico por un H da lugar a los desoxiderivados.
      • Se forman los desoxiazúcares como la desoxirribosa que es un componente de los nucleótidos.
      RIBOSA DESOXIRRIBOSA
    • AMINODERIVADOS:
      • La sustitución de un OH (generalmente en el carbono 2) de los monosacáridos por un grupo amino (NH2) da lugar a los aminoderivados.
      • Se forman aminoazúcares como la glucosamina .
      GLUCOSA GLUCOSAMINA
    • FOSFATODERIVADOS:
      • El grupo fosfato pueden formar ésteres con los grupos OH (alcohólico o hemiacetálico) de los monosacáridos. Con ello se introduce un grupo fuertemente electronegativo en una molécula que normalmente no posee carga eléctrica.
    • POLISACÁRIDOS
      • Son los glúcidos más abundantes en los organismos vivos.
      • Se clasifican bajo dos criterios
        • Por su estructura
        • Por su función
      AGLICONA: Grupo que reacciona con el monosacárido GLICÓSIDO: Monosacárido unido a una aglicona HOLÓSIDO: Cuando la aglicona es otro monosacárido HETERÓSIDO: Cuando la aglicona es cualquier otro compuesto
    • POR SU ESTRUCTURA:
      • Homopolisacáridos:
      • Polímeros constituidos por un solo tipo de monosacáridos.
      • Heteropolisacáridos:
      • Polímeros constituidos por dos o más monosacáridos (o derivados) distintos.
    • POR SU FUNCIÓN:
      • De reserva:
      • Constituyen formas de almacén o paquetes de los monosacáridos que serán degradados para la obtención de energía. (almidón y glucógeno).
      • Estructurales:
      • Forman parte de las estructuras tales como paredes celulares, exoesqueletos, cubiertas, etc. (celulosa, hemicelulosa, pectina, agar-agar, goma arábiga, quitina, mucopolisacáridos).
    • DISACÁRIDOS
      • Cuando el enlace glicosídico se forma entre dos monosacáridos, el compuesto resultante recibe el nombre de disacárido.
      • Esta unión puede tener lugar de dos formas distintas, dando dos tipos de disacáridos:
        • Reductores
        • No reductores
      • DISACÁRIDOS REDUCTORES:
      • El carbono anomérico de un monosacárido reacciona con un OH alcohólico de otro . Así, el segundo azúcar presenta libre su carbono anomérico, y por lo tanto seguirá teniendo propiedades reductoras, y podrá presentar el fenómeno de la mutarrotación.
      • A este grupo pertenecen: la maltosa, celobiosa, sacrosa y lactosa
      • DISACÁRIDOS NO REDUCTORES:
      • En ellos, el carbono anomérico de un monosacárido reacciona con el carbono anomérico del otro monosacárido . Como no queda ningún carbono anomérico libre, estos disacáridos no podrán presentar mutarrotación.
      • A este grupo pertenecen: sacarosa y trehalosa
    • OLIGOSACÁRIDOS
      • Son cadenas cortas de monosacáridos (3 a 20) unidas mediante enlace O-glucosídico.
      • Los disacáridos pueden seguir uniéndose a otros monosacáridos por medio de enlaces glicosídicos.
        • Si el disacárido es reductor, se unirá a otros monosacáridos por medio del OH de su carbono anomérico o de cualquier OH alcohólico.
        • Si no es reductor, se unirá únicamente por medio de grupos OH alcohólicos.
    •  
      • Los lípidos presentan una estructura general formada por un alcohol (glicerol) y uno, dos o tres ácidos grasos.
      • Están compuestos de ácidos grasos cuyas propiedades son:
        • Casi todos contienen un número par de átomos de carbono
        • La cadena hidrocarbonada puede estar saturada, insaturada o poliinsaturada.
      • En función de su estructura química los lípidos se clasifican en tres grupos:
        • Lípidos simples: Esteres de ácidos grasos y alcoholes
          • Grasas y aceites
          • Ceras
        • Lípidos compuestos: Lípidos simples conjugados con otras biomoleculas (ácido fosfórico, carbohidratos y proteínas).
          • Fosfolípidos
          • Glucolípidos
          • Lipoproteínas
        • Compuestos asociados:
          • Pigmentos
          • Vitaminas liposolubles
          • Esteroles
          • Hidrocarburos
      • Según su capacidad para formar jabones los lípidos se clasifican:
        • Saponificables: Tenemos las grasas, aceites, ceras, fosfolípidos y fosfátidos
        • Insaponificables: Esteroles, hidrocarburos y prostaglandinas c
    • TRIGLICÉRIDOS
      • Los acilgliceroles o glicéridos son ésteres de ácidos grasos con glicerol (propanotriol).
    • LIPIDOS POLARES
      • Dentro de este grupo están los fosfolípidos y esfingolípidos que constituyen las membranas biológicas.
      • Presentan una cabeza polar y una cola apolar
    • ESTEROIDES
      • Todos presentan anillos fusionados.
      • El más conocido es el colesterol que se encuentra en la membrana celular y es precursor de ciertas hormonas.
    • TERPENOS
      • Suelen incluirse en este grupo moléculas formadas por condensación de unas pocas unidades de isopreno .
      • Muchas de estas moléculas son vitaminas liposolubles.
      • Son frecuentes en los aceites esenciales de plantas.
      • En este grupo se incluyen:
        • Retinoides (vitamina A)
        • Carotenoides (provitamina A)
        • Tocoferoles (vitamina E)
        • Naftoquinonas (vitamina K)
    • EICOSANOIDES
      • Este término agrupa a una serie de compuestos derivados de ácidos grasos poliinsaturados de 20 átomos de carbono (de donde deriva su nombre).
      • Todos ellos tienen una amplia gama de actividades biológicas, bien como señales químicas (hormonas) o como efectores fisiológicos (en procesos inflamatorios).
      • En esta categoría se incluyen:
        • Prostanglandinas
        • Tromboxanos
        • Leucotrienos
    • TRANSPORTE A TRAVÉS DE MEMBRANAS
    •  
    • OBJETIVOS
      • Describir la estructura elemental de los ácidos nucleicos: RNA y DNA
      • Los AN son polímeros lineales en los que la unidad repetitiva, llamada nucleótido está constituída por:
        • Una pentosa (la ribosa o la desoxirribosa)
        • Un ácido fosfórico
        • Una base nitrogenada (purina o pirimidina).
      • La unión de la pentosa con una base constituye un nucleósido .
      • La unión mediante un enlace éster entre el nucleósido y el ácido fosfórico da lugar al nucleótido .
      • Hay cinco bases nitrogenadas diferentes en los nucleótidos, que son los sillares de construcción de los ácidos nucleicos.
        • Dos de ellas, la adenina y la guanina, se conocen como purinas .
        • Las otras tres, citosina, timina y uracilo se conocen como pirimidinas .
      • Los AN se forman por la esterificación de los grupos fosfato con los hidroxilos 5' y 3' de dos nucleótidos consecutivos.
      • Por convención, la secuencia de los polinucleótidos se representa en el sentido 5' - 3' .
      • Los dos polinucleótidos presentes en los seres vivos son los ácidos: ribonucleico (RNA) y desoxirribonucleico (DNA).
    • DOGMA CENTRAL DE LA BIOLOGÍA
      • Los acidos nucleicos contienen la información para estructurar una enorme variedad de proteínas que se encuentran en los organismos.
      • La información contenida en los ácidos nucleicos es transcripta y luego traducida a las proteínas.
      • Son las proteínas las moléculas que finalmente ejecutarán las "instrucciones" codificadas en los ácidos nucleicos.
    • Niveles de Organización Dos o más átomos juntos del mismo elemento o de elementos diferentes. Biomoléculas: carbohidratos, lípidos, proteínas, DNA y RNA. La unidad más pequeña que tiene vida y puede formar parte de organismos multicelulares. Matriz organizada de células y sustancias que interactúan en algunas tareas. Tejido óseo, conectivo, etc. Unidad estructural hecha de dos o más tejidos interactuando en algunas funciones. Órganos interactuando físicoquímicamente, o ambos en la misma función. Sistema vascular, sistema nervioso, etc. Elementos fundamentales que forman la materia. Los átomos son las más pequeñas unidades que retienen las propiedades de un elemento. Electrones, protones y neutrones. átomo molécula célula tejido órgano Sistemas de órganos
    • Individuos hechos de diferentes tipos de células. Organismos multicelulares conformados por tejidos, órganos y sistemas. Grupo de individuos de la misma especie que ocupa una determinada área Todas las poblaciones de todas las especies que ocupa una determinada área Una comunidad que interactúa con el medioambiente físico. Organismos multicelulares población comunidad ecosistema biosfera comunidad
    • LAS CÉLULAS
    •  
    •  
    •  
    • FOTOSÍNTESIS
    •  
    •  
    •  
    • REVISIÓN DEL CONCEPTO DE GEN: EL ADN Y SUS ROLES
    • QUÉ ES EL ADN
    •  
    •  
    •  
    •  
    • DÓNDE ESTÁ EL ADN
    •  
    •  
    •  
    • NUCLEO CITOPLASMA Hebras de ADN 2n = 20
    • LA ESPECIE HUMANA TIENE 46 HEBRAS DE ADN 2n = 46
    •  
    • GEN AMBAS HEBRAS LLEVAN EL MISMO TIPO DE INFORMACIÓN PERO PUEDE SER DE DIFERENTE “MODELO”
    • ATCGCGTATAATCGCGGCGCTACG CGCGGCATTACGCGCGTATAATGC GEN COLOR DE LA SEMILLA GEN COLOR DE LA SEMILLA
    • CUÁLES SON LOS ROLES DEL ADN
    • T T C A G
    • ROLES DEL ADN A : TRANSMISIÓN DE CARACTERÍSTICAS B: EXPRESIÓN DE CARACTERÍSTICAS
    •  
    •  
    •  
    • Cromátidas Hermanas a a A A Cromosomas Homólogos Alelo a duplicado Alelo A duplicado
    •  
    •  
    •  
    •  
    •  
    •  
    • A: MEIOSIS Cromosomas Homólogos Células Haploides (n)
    • A: MEIOSIS
    •  
    •  
    •  
    •  
    •  
    •  
    • Capítulo 15 Reproducción y desarrollo
    • I. Reproducción asexual vs. reproducción sexual
      • Reproducción asexual – Produce individuos genéticamente idénticos a sus padres..
        • Ejemplos – germinación o brotes en anémonas, crecimiento en estrellas de mar
      Brote en una hidra
    • Reproducción sexual – Produce descendencia genéticamente diferente de sus padres, requiere producción de gametos (huevos y esperma) que se fusionan y forman el huevo o cigoto. - Ejemplo - humanos
    • II. Fecundación externa vs. fecundación interna
      • Fecundación externa – animales acuáticos.
        • Óvulos y esperma se descargan en el agua donde se efectúa la fecundación.
        • Requiere muchos gametos para asegurar la fecundación.
        • Desarrollo embrionario ocurre en el agua fuera del cuerpo.
    •  
    • Fertilización interna
      • Animales terrestres y algunos acuáticos
      • El esperma se deposita directamente dentro de el cuerpo femenino para proteger los gametos.
      • Requiere desarrollo
    • 3. El desarrollo embrionario pos fertilización puede ser: a. ovíparo – huevo se desarrolla apartado de la madre (ejm: pájaros, reptiles)
    • b. ovovivíparos – huevo se desarrolla dentro de la hembra pero no recibe nutrición de ella (algunos tiburones)
    • c. Vivíparos – embrión se desarrolla dentro del cuerpo de la madre y recibe nutrición de ella, a menudo en la placenta (mamíferos)
    • a. precociales – altamente desarrollados y capaces de alimentarse y moverse por ellos mismos “pequeños adultos” (reptiles) 4. Los jóvenes que han nacido pueden ser: b. altriciales - inmaduros y requieren considerables cuidados maternos.
    • Sistema Reproductor Femenino Humano ano ano vagina recto cerviz endometrio útero Labio mayor Labio menor clítoris uretra Hueso púbico tubo urinario ovario Vejiga urinaria
    • Ovario Oviducto – trompas de Falopio , sitio de fecundación, transporte del cigoto del ovario al útero útero
    • vagina ovario Cerviz Tubo de Falopio Óvulo Útero
    • FEDUNDACIÓN
    • SISTEMA REPRODUCTOR MASCULINO HUMANO escroto Apertura de la uretra pene uretra testículos epidídimo Conducto deferente Glándula bulborenal recto vesícula seminal próstata uretra vejiga Hueso púbico
    •  
    • Gracias Ing. Iván Burneo Saavedra [email_address] Planta de Productos Naturales Telf: 07 2 570 275 Ext: 2512-2527
    •