Com "parlen els gens".Fundació Dr.Robert.2009 Sl

  • 643 views
Uploaded on

genética

genética

More in: Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
643
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
6
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. GUIÓ Que és el material genètic? Com es transmet la informació del nucli a la resta de la cèl·lula? Jornades Formatives en MALALTIES MINORITÀRIES Com es tradueix i com s’executa la informació? Curs 2009-210 El codi genètic es pot alterar? Què son les mutacions? Com “parlen” els gens? Quina relació hi ha entre mutació , producte gènic alterat i malaltia? Dra.Teresa Pàmpols i Ros L’expressió clínica és molt variable. Per què? Institut de Bioquímica Clínica. Servei de Bioquímica i Genètica molecular. Com es transmeten les malalties genètiques a la descendència? Hospital Clínic de Barcelona i Perquè les malalties hereditàries tenen prevalences tan (tpampols@clinic.ub.es) baixes? Dins el nucli d’una De fet, els gens “parlen” bioquímica cèlula hi ha enmagatzemada la informació per a la Com ho fan ? constitució del ser viu del qual procedeix : el Que és el material genètic? material genètic Guanina Adenina Timina Citosina El material genètic es l’àcid desoxiribonucleic (ADN)=desoxiribosa + fosfat+ bases nucleotídiques 1
  • 2. 3’ L’ADN es una enciclopedia que enmagatzema tota la A A A 3’ C C T G informació mitjançant un senzill alfabet de 4 lletres T T C T T A G G C ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATG G enlace de A GAAATGGATCATGTTGACCTGATCGATCCTCTCTCGACTTTGACCTGC 5’ base hidrógeno 5’ ATGATGCCTAGCATGTTGACCTGATCGAAATGGATCCTCTCTCGACTA GGATCCTCTCTCGACTATAACCAATGATGCCTAGCACATGTTGACCTG CGACTATAACCAATGATGCCTAGCATGTTGACCTGATCGAAATGGATC Una molècula d’ADN, està constituïda per dues cadenes amb CTAGCCAATGATGCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTG seqüències de nucleòtids complementaries, generant una doble hèlix TGGATCCTCTCTCGACTATAACCAATGATGCCTAGATGTTGACCTGAT de aproximadament 10 parelles de nucleòtids per volta de la hèlix. GGATCCTCTCTCGACTATAACCAATGATGCCTAGCACATGTTGACCTG CCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATGCCTAGCA ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATG CTAGCCAATGATGCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTG GACTATAACCAATGATGCCTAGCACATGTTCTAGCCAATGATGCACA TGTTCTAGCCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTGTGATG Biología Molecular de la Célula B. Alberts, D. Bray, J. Lewis, M. Raff, K. Roberts, JD. Watson. Ed. Omega (1994) MAGNITUD DEL ADN oòcit espermatozous El DNA del nucli d’una cèl·lula reproductora és un doble filament en espiral de 1 m de longitud que conte 3 x 109 parells de bases cèl.lula de la pell Les 3 x 109 parells de bases (lletres) del genoma haploide El nucli d’una cèl·lula somàtica te dos filaments , el (d’una cèl·lula germinal) escrites una darrera l’altra procedent del pare i el procedent de la mare, es a dir 2 ocuparien 200 volums de 1000 pàgines cadascun metres de DNA L’ADN está “empaquetat”dins el nucli Quan una cèl·lula es divideix , el material genètic s’ha de replicar i repartir en les dues cèl·lules filles ( mitosis). Per a evitar errors l’ADN es reparteix en paquets petits densament empaquetats (cromosomes) Fibras de cromatina Empaquetamiento Grado 6 60% proteína Cromatina 35% DNA 5% RNA 1879-1872 Arnold y Fleming : Primeres observacions de cromosomes en mitosis Principios de Bioquímica. Lehninger 1986 2
  • 3. 46 cromosomes 2 metres DNA µ 5µm 600mg/mL (70% pes) µ 25µm Cromosoma Metafàsic Empaquetament Cèl·lula somàtica 1.000-10.000 vegades Nucli en metafase Principios de Bioquímica. Lehninger 1986 1956 Tjio & Levan : Tenim 46 cromosomas La informació de la enciclopèdia (l’ADN) està El GEN es la unitat física i funcional de la herència organitzada en frases (gens) i les frases en paraules i la majoria conté informació per a elaborar una (codons ) formats per 3 lletres (les 4 bases proteïna nucleotídiques) Molts gens tenen un tamany de unes 100.000 ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATG GAAATGGATCATGTTGACCTGATCGATCCTCTCTCGACTTTGACCTGC parells de bases. ATGATGCCTAGCATGTTGACCTGATCGAAATGGATCCTCTCTCGACTA GGA TCC TCT CTC GAC TAT AAC CAA TGA TGC CTA GCA CAT GTT GAC CGA CTA TAA CCA ATG ATG CCT AGC ATG TTG ACC TGA TCG AAA TGG Hi ha gens molt grans : el gen de la Distrofina te CTA GCC AAT GAT GCC TAG CCA ATG ATG CCT AGC ATGA TGC CTA ATC 2.4 Mb CTC TCT CGA CTA TAA CCA ATG ATG CCT AGA TGT TGA CCT GAT GGATCCTCTCTCGACTATAACCAATGATGCCTAGCACATGTTGACCTG CCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATGCCTAGCA ( 1 Megabase = 1.000.000 de parells de bases) ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATG CTAGCCAATGATGCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTG GAC TAT AAC CAA TGA TGC CTA GCA CAT GTT CTA GCC AAT GAT GCA CA El genoma humà te 3.200 Mb TGT TCT AGC CCT AGC CAA TGA TGC CTA GCA TGA TGC CTA GCT TGT Només 1,4 % del genoma es codificant Tenim també un petit genoma mitocondrial: ADN mt 14 d’abril de 2003 Es circular i te 13.6 Kb “Wellcome to the Genomic Age” S’hereta exclusivament per línia materna www.genome.gov 3
  • 4. Nature, 21 Oct. 2004 ¡¡ Sorpresa, Sorpresa !! Només tenim 19.599 gens codificadors de proteïnes ( de fet son uns 25.000) www.ncbi.nih.gov/Genbank www.genome.ucsc.edu www.ensembl.org www.ddbj.nih.ac.jp www.ebi.ac.uk/embl/index.html Wadsworth Center Els gens es distribueixen en cada un dels cromosomes Diem locus a la posició fixa d’un gen en un sempre de la mateixa manera (MAPA) cromosoma ex. el locus del gen OCA 1 es 11q 1.4-q 2.1 Gen A Gen B metafase La distancia entre gens es medeix en Gen C centimorgans Gen D Gen E 1 centimorgan = 1.000.000 de parells de bases Gen F Gen G La llista ordenada de loci es denomina mapa ¡Recordeu! Cèl·lules somàtiques: 46 cromosomes, formats per genètic Desierto génico gens i proteïnes que es localitzen en el núcli, 23 procedents del pare amb els 25.000 gens paterns i 23 procedents de la mare amb els 25.000 gens materns. Al tenyir el nucli en metafase Diem al.lel a la variant de la secuencia d’ADN en veiem els cromosomes individualitzats i “bandejats” un determinat locus La informació continguda en l’ADNdel nucli es transmet al citoplasma de la cel.lula mitjançant l’ARN Com es transmet la informació del nucli a la resta de la cèl·lula? i Procés Transcripció de l’ADN a ARNp(precursor) Com es tradueix i com s’executa la informació? “Splicing” a ARNm (missatger) Traducció a un producte gènic 4
  • 5. L’ARN es un esquelet de ribosa Quan un gen s’ha d’expressar o “encendre” s’obre la doble hèlix de l’ADN a l’ inici del gen i la RNA polimerasa va fosfat i 4 bases nucleotídicas ensamblant les bases nucleotídiques complementaries G C A i U ( en lloc de T) formant un RNA precursor Es diu procés de transcripció Intensificador TRANSCRIPCIÓ Silen ciad or L’expressió dels gens a nivell transcripcional es complexa i Represor regulada per factors controladors In or t en Activador icad sif Inclòs un cop transcrit el RNAp hi ha regulació ( per el ica do nsif r splicing, per a l’exportació del ARNm al citoplasma i per a la Inte Activador seva estabilitat) Activador L'expressió gènica es la base de la diferenciació cel·lular, 250 40 morphogenèsis i adaptabilitat de l’organisme 30 110 60 BETA H Depèn de mecanismes anomenats epigenètics 30 ALFA 150 E 80 Proteína F Polimerasa Metilació del ADN de unión a TATA de ARN Regió A B Xifrada Silenciació de gens Modificacions d’histones Bloque TATA Centre promotor Proteïnes modificadores de la cromatina R.Tjian “Mecanismo molecular del control génico”. Investigación y Ciencia. Abril 1995 Un gen te introns i exons l’ADN del gen es transcriu sencer pero nomes es tradueixen els introns Els mecanismes epigenètics son responsables de la inactivació al atzar d’un dels cromosomes X en les Intró 1 Intró 2 Intró 3 cèl.lules dels fetus de sexe femení en les primeres etapes P exó 1 exó 2 exó 3 del desenvolupament RNAp “splicing” Son malaltíes epigenètiques : Les sídromes de Rett, Angelman , Prader –Willi i Beckwith-Wiedemann RNAm traducció Producte gènic 5
  • 6. CÓDI GENÈTIC Ampliem el concepte traducció: AMINOÁCIDS CODONS A Ala Alanina GCA GCC GCG GCU Un cop fora del nucli la seqüència de l’ARN m C Cys Cisteína UGC UGU es llegida per uns agregats moleculars : D Asp Acid aspártic GAC GAU ribosomes K Lys Lisina AAA AAG Cada triplet o codó te el significat d’un aminoàcid Els aminoàcids es fixen a molècules Y Tyr Tirosina UAC UAU d’ARN petites de RNAt (transferència) i es van ensamblant i formant un polipèptid Hi han 20 aminoàcids i 64 combinacions de triplets possibles , la majoria d'aminoàcids està especificat per mes d’un codò Traducció ¡¡¡¡Un polipèptid de 400 aminoacids es sintetitza en 20 segons!!!!! Els 4 passos de la formació de proteïnes Repàs núcli ADN intró exó TRANSCRIPCIÓ 1. Transcripció y traducció 2. Plegament ARN p “SPLICING” RNAm Producte gènic = TRADUCCIÓ 3. Modificacions post traducció 4. Interacció proteïna-proteïna Polipèptid/Proteïna The Promise of Proteomics. New York Academy of Sciences. January 31, 2001. www.nyas.org 6
  • 7. ¡Hi ha moltes mes proteïnes que gens ! (25.000 gens / 200.000 proteïnes) Un gen pot donar lloc a diversos El codi genètic es pot alterar? “transcrits” o PRODUCTES GÈNICS (polipéptids/proteínes) Què son les mutacions? “Splicing” alternatiu Quan una cèl·lula entra en divisió s’ha de replicar tot l’ADN 50 enzims reparadors Errors de Polimerització :1 en 10 -4 40 enzims correctors Errors de replicació : 1 en 10 -10 La forquilla de replicació avança a la velocitat de 50 nucleotids / segon Al duplicar el genoma s’ensamblen 1,2 x 10 10 El doble filament de l’ DNA se ha de desenrotllar y l’helix paterna gira nucleotids a 50 revolucions/segon (3000 rpm) “ La celula Viva” .C.de Duve.Biblioteca Scientific American . Labor 1998 Amb una freqüència al voltant de 10-6 es produeixen Les mutacions en una cèl·lula somàtica poden errors en la replicació de l’ADN ser rellevants per al càncer o envelliment i només concerneixen a l’individu , però no a la Mutació = canvi estable i hereditari en la seqüència seva descendència* primària de nucleòtids de l’ADN que afecta la salut Les mutacions han d’estar en les cèl·lules germinals per a tenir impacte en la Excepcionalment poden ser inestables i el descendència d’un individu descobriment de la expansió de triplets ens ha permès explicar malalties com el Huntington, la Les mutacions poden ser també produïdes per distròfia miotònica y la síndrome X-fràgil , factors mediambientals ( productes tòxics, radiacions ionitzants) * son excepció els càncers familiars 7
  • 8. El terme mutacions s’empra només per als canvis en l’ADN que afecten la salut Altres canvis es diuen polimorfismes Els essers humans tenim un genoma 99,9% contribueixen a la diversitat humana, permeten idèntic canvis adaptatius i son la base de la evolució El 0,1% del genoma que ens fa diferents pot Si mateix , polimorfismes en el gen o en altres contenir les causes de que les persones locus poden modificar el genotip enmalalteixin per agents infecciosos, exposicions ambientals i comportaments o Hi ha polimorfismes (SNPs) que combinats estils de vida amb factors mediambientals confereixen susceptibilitat a malalties comunes Magnitud de les mutacions Tipus de mutacions puntuals . Hem dit que els gens son Mutacions molt grans (millions de parells de bases) frases amb significat formats per paraules de tres lletres S’altera la morfología i/o número dels cromosomes Son visibles al microscopio observant el nucli en metafase ATGCCTACTT ATG CCA TTG ATTCCCAA ( Citogenètica) Mutaciones de < 2.000-3.000Kb aa1 aa2 aa3 POLIPEPTID Visibles emprant sondas moleculars (FISH etc.) Mutaciones puntuals (delecions, insercions o canvis d’una única base) “Visibles” amb els ull de la bioquímica emprant els recursos recursos de la Genètica bioquímica i la Genètica XBNMLANFK SAL DEL MAR ALKSFJLKJ molecular Tipus de mutacions puntuals Que passa quan trobem un canvi en l’ADN d’un pacient . Es una mutació o és un polimorfisme? Vull més SAL DEL MAR seqüència normal • Sabem que les mutaciones que truncan la proteïna , petitess insercione/delecions, mutacions que creen un codón “stop” o Vull més SOL DEL MAR substitució; error de sentit mutacions de “splicing” “missense” Vull més SI L DEL MAR substitució; pèrdua de sentit “nonsense”o absurda* Son causa de la malaltia Vull més SALD ELM AR deleció; pèrdua de sentit “frame shift” o amb desplaçamento de motlle* Vull més SAX LDE LM inserció; pérdua de sentit • Les mutaciones que només cambien un AA son causa de la malaltia o un polimorfisme? Canvi en la proteïna 8
  • 9. 1er es mira si la mutación està descrita a la bibliografía, si no ho està: • Comparem la nostra proteïna amb la d’altres espècies (si es conserva el residu o no) • Mirem la importància del canvi de AA per a la funció de la proteïna Quina relació hi ha entre mutació , producte gènic • Ens assegurem que no hem trobat un altre canvi alterat i malaltia? en el gen • Estudis de expressió • Verifiquem si el canvi es troba en 50 individus de població general ( 100 al.els) Un exemple, la Fenilcetonuria Transcripció a ARN Traducción La de tirosina producció a producte gènic (polipéptid/proteína) pigments i síntesi de neurotransmisors ADN Producte gènic de fenilalanina en plasma Víes/Productes Metabólics Desequilibri amb D’acids fenilpiruvic i altres aminoàcids fenil làctic Efecte tòxic sobre el sistema nerviós . Síntesi de mielina deficient Olor corporal La mutació es tradueix en un canvi en el patró del seu producte gènic específic Fenotipo La pèrdua de funció altera la homeostàsi fisiològica induint les manifestacions (Fenoma) Fenoma) clíniques i la malaltia Expressió fenotípica per sistemes anatòmic/funcionals L’afectació del sistema nerviós és molt frequent perquè Muscular/Esquelè gairebe un 80 % dels nostres gens estàn relacionats directa o indirectament amb el seu funcionament Sistema Nerviós 40,0 Ocular 30,0 Craneofacial Genitourinari Metabòlic Pell Ungles, Immune Extremitats Circulatori MBID 8 20,0 Sang Endocrí Cabell Dents Respiratori 10,0 0,0 Basat en: MBID 8: Cap.1 pàg. 3-125 (L.Beaudet, Ch.Scriver, N.Sly, D.Valle) 9
  • 10. Un 80% debuta a l’edat pediàtrica 5% In utero Edad adulta tardía >50 años Es coneixen les Pubertad - 50 anys bases metabòliques >50% i moleculars de Neonatal - 1 año unes 700 malalties hereditàries 30% 1 año - pubertad Jiménez-Sánchez et al. capítol 4 del MMBID 8 El coneixement de les bases metabòliques , de la fisiopatología i dels L’expressió clínica és molt variable mecanismes moleculars, incloent el gen , i els processos de transcripció i Per què? traducció son fonamentals per a dissenyar teràpies El fenòmen de la heterogeneitat genètica Las variacions en un gen no afecten sempre de la HETEROGENEITAT NO AL.LÈLICA O DE LOCUS mateixa manera a la proteïna Mutacions a diferents locus genètics poden donar lloc a la mateixa malaltía Les MH presenten una gran heterogeneïtat genètica e.x. gangliosidosis GM2 • Els pacients amb una mateixa malaltia no son un grupo homogèni HETEROGENEITAT AL.LÈLICA • Fins i tot amb la mateixa mutació poden ser En un mateix locus es poden donar moltes mutacions diferents diferents e.x. Duchenne i Becker Hurler i Scheie 10
  • 11. β-hexosaminidasa Exemple de heterogeneitat de locus: Les gangliosidosis GM2 A LA HETEROGENEITAT AL·LÈLICA es molt més freqüent , gairebé general. Hexosaminidasa A β En moltes malalties les mutacions arriben a ser α “privades” o “propietàries” de cada família. β Sovint els pacients que diem homozigots són en realitat “compostos genètics”. Amb la qual cosa l'individu α Gangliosid estarà produint dos tipus de proteïnes diferents. activador-GM2 GM2 A tot això cal afegir les següents consideracions que contribueixen a la variabilitat de presentació clínica en els pacients amb una mateixa malaltia: Model de la degradació del gangliosid GM2 per la ß-Hex A estimulada per l’activador. MMBID 8 pàg 3374 (modificada de W. Fürt i K. Sandhoff. BBA 1126:1, 1992 El fenotip clàssic sever es dona p. ex. quan : Mutació Mutació suau severa No es produeix un producte gènic funcional Efecte de mutacions “missense” Neutre Sever Quan la mutació altera severament la funció de la proteïna Efecte de factors cel.lulars: Control de qualitat/temperature PERÒ Funció residual de la proteïna Alta Baixa Efecte d’altres factors Sovint hi ha un continuum de expressió mes suau provenint de mutacions que permeten una funció residual de la proteïna Probabilitat de malaltía clínica Asimptomàtic Malaltia clínica DINTELL PER A LA MALALTÍA CLÍNICA J. Inherit. Metab. Dis (2001) 24:189-212 Transcripció a ARN Traducción a polipéptid/proteína La funció residual de la proteïna pot ser ADN Factors epigenétics influenciada per : Factors ambientals que estressen las vies metabòliques Aconteixements post-traducció i factors cel·lulars Producte gènic Procesament Gens situats en altres locus Post-traducción e Efectes Ambientals intervenció + gens altres locus de factors cel.lulars Víes/Productes Metabólics El genotip no sempre prediu el fenotip i una malaltia monogènica es pot comportar com un trastorn complexe 11
  • 12. Concepte de penetrança G6PD deficiency Hemochromatosis Freqüència amb la que la característica que controla un gen (fenotip) es fa visible en els Paper creixent de factors ambientals i estocàstics Acute intermittent porphyria Type I diabetes mellitus individus que el tenen alterat α1-Antitrypsin ZZ Apo E-2/E-2 hyperlipoproteinemia ex. malaltía de Tay-Sachs Tuberous sclerosis Marfan Els gens amb penetrança baixa requereixen la Retinoblastoma Hartnup Phenylketonuria Familial hypercholesterolemia interacció amb factors ambientals Ej. genotip lent NAT2 aumenta el risc de cáncer de Sickle-cel anemia Cystic fibrosis bufeta en individus exposats a arilaminas , però es Huntington disease Duchenne distrophy inefectiu si no hi ha exposició 0 Tay Sachs 0 Paper creixent dels genotips d’altres loci Quan un gen juga un paper predominant en la determinació d’una malaltia , aquesta s’hereta de forma monogènica o mendeliana (segueix les lleis de Mendel) 20% AD Com es transmeten les malalties genètiques a la descendència? 8% Herència 60% AR 12% XL Herencia materna mtDNA Herencia Autosòmica Recesiva A a A a A a A a A A A a a A a a 1/4 25% No portadors 1/2 50%Portadors 25%Malalts 1/4 (Homocigots) (Heterocigots) 12
  • 13. HERENCIA AUTOSÒMICA DOMINANT Si en la família del esquema anterior la malaltia fos autosòmica dominant , estarien clínicament afectats un 75% dels fills Però és mes comú que només un dels dos progenitors sigui heterozigot i aleshores estaran afectats un 50% dels fills Es diu que un caràcter s’hereta en forma dominant quan els heterozigots presenten clínica Depèn en gran part, de la tolerància del sistema biològic a la pertorbació de la proteïna Herència gonosómica Lligada al X AX X a AX Y a A X a X Axxx X a Y X AY aX X A a X Y a A X XA X Y Nena no portadora Nen no portador Nena portadora Nen malalt (heterozigota) (hemizigot) Estaràn afectats 50% dels nens i serán portadoras 50% de les nenes En una malaltía lligada al X , la mutació també pot aparèixer per primer cop en el cromosoma X d’un home Totes les nenes de la parella portaran un X de la mare i el X del pare amb la mutació , per tant seran totes heterozigotes i no serà fins la segona generació que apareixeran nens afectats Exemples d’arbres familiars amb els tres tipus d’herència mendeliana descrits 13
  • 14. HI HA 3 CATEGORÍES DE MALALTIES GENÈTIQUES Com es transmeten a la descendència HERENCIA HERÈNCIA NO • TRASTORNS CROMOSÓMICS : Constitucionals i adquirides MENDELIANA MENDELIANA Trastorns monogènics • TRASTORNS MENDELIANS O MONOGÈNICS Autosòmica Recesiva Anomalies Cromosomiques Gonosòmica Lligada al X • TRASTORNS POLIGÈNICS O MULTIFACTORIALS Trastorns Multifactoriales Causats per la interacció de múltiples gens i factores ambientals, entre els Autosòmica Dominante quals hi han algunes de las malalties corrents de la edat adulta com la Alteracions del Genoma diabetis i les malalties coronaries Gonosómica Dominant mitocondrial lligada al X El zigot te un sol genoma nuclear heretat del pare i de la mare , però te diversos genomas mitocondrials (poliplasmia) que hereta només de la mare i no tots tenen la mutació (heteroplasmia) Moltes malalties mitocondrials son de transmissió mendeliana perquè els gens que controlen la S majoría de les proteïnes mitocondrials son nuclears Hi ha un grup més petit de proteïnes , controlades O Poliplasmia y pel genoma mitocondrial i aleshores les mutacions heteroplasmia es transmeten amb el que s’anomena “herència Z (Zigot) materna”, perquè el zigot conté només les mitocondries del òvul matern ja que les del Els teixits reben espermatozou es perden Segregació mitocondries normal i mutades replicativa de manera aleatòria A B C Un noi afectat per una malaltia lligada al genoma mitocondrial , no pot transmetre mai la malaltia a la descendència , en canvi si la que està afectada es una noia , tots els fills ho estaran Perquè les malalties hereditàries tenen prevalences tan baixes? 14
  • 15. Les malalties genètiques pertanyen majoritàriament a la categoria de malalties rares o de baixa prevalença, La freqüència de una malaltia genètica en la població depèn de: un 80% fins i tot estan per sota de 1 en 100.000 La tassa de mutacions El patró d'herència Desavantatges que confereix la mutació Successos distorsionadors ( naturals o socials) www.orpha.net Però en el cas d’una malaltia recessiva , el gen mutat està present en els heterozigots sans i amb la mateixa tasa de mutació de 10-6 i Quan una mutació altera la funció del gen i porta a la mateixa frequencia de l’homozigot de 1 en 1 milió , la una desavantatge , la mutació tendeix a desaparèixer freqüència del heterozigot al equilibri es 1 en 1000 de la població , però contínuament apareixen noves Quan la frequencia d’una malaltía es multiplica per 10 o per 100 mutacions en cada generació i s'arriba a un equilibri en algunes poblacions , pot ser per: entre mutació que dona lloc a un gen deletèri i selecció natural que l’elimina de la població. Efecte fundador Com a promitg , la tassa de mutació per generació i Aventatges pel fet d’esser heterozigot : gen es molt baixa ap. 10-6 i per un trastorn dominat Anèmia falciforme protecció en front la malaria letal, la freqüència del gen al equilibri es de 1 en 1 Fibrosis quística protecció en front el tifus i malalties milió diarreicas Fenilcetonuria incidencia de pèrdues fetals Val la pena remarcar que cadascun de nosaltres portem de 6 a 8 anomalies genètiques recessives i si alguna coincideix amb les de la parella podem tenir fills afectats Tenim uns 25.000 gens i per això es molt difícil coincidir 15