Conference OGM Mounier

2,494 views
2,194 views

Published on

Published in: Education
0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
2,494
On SlideShare
0
From Embeds
0
Number of Embeds
632
Actions
Shares
0
Downloads
41
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Conference OGM Mounier

  1. 1. Les OGM 5 décembre 2008 Nicole Mounier Université Claude Bernard Lyon 1 CGMC, bâtiment Gregor Mendel 43, boulevard du 11 Novembre 1918 69622 Villeurbanne Cedex
  2. 2. OGM Organismes Génétiquement Modifiés Transfert de gènes Bactéries Eucaryotes Microorganismes Animaux Végétaux Transfert nucléaire
  3. 3. Rappels
  4. 4. Comment fonctionne un gène ?
  5. 5. Comment manipuler l’ADN et les gènes ? Effet attendu au niveau du produit du gène dans la cellule l’organisme la population d’organisme Les outils enzymatiques Couper, copier, coller l’ADN
  6. 6. Couper un ADN par une enzyme de restriction 5’ ATCGCGTAACGTATTCGAATTCTTCAGGCTAAGCTA 3’ 3’ TAGCGCATTGCATAAGCTTAAGAAGTCCGATTCGAT 5’ 5’ ATCGCGTAACGTATTCGAATTCTTCAGGCTAAGCTA 3’ 3’ TAGCGCATTGCATAAGCTTAAGAAGTCCGATTCGAT 5’ 5’ ATCGCGTAACGTATTCG AATTCTTCAGGCTAA 3’ TAGCGCATTGCATAAGCTTAA GAAGTCCGATT
  7. 7. Copier, recopier un ADN grâce à une ADN polymérase
  8. 8. Coller deux fragments d’ADN 5’... TCGCATCACG AATTCCGATCA ...3’ 3’... AGCGTAGTGCTTAA GGCTAGT ...5’  + ADN ligase 5’... TCGCATCACGAATTCCGATCA ... 3’ 3’... AGCGTAGTGCTTAAGGCTAGT ... 5’
  9. 9. Hybridation moléculaire
  10. 10. Sonde
  11. 11. Le clonage
  12. 12. Comment cloner un fragment d’ADN ?
  13. 13. Bactérie transformée = OGM Protéines produites par des bactéries génétiquement modifiées : Insuline Hormone de croissance Erythropoïétine Facteur VIII Interféron gamma Facteurs de croissance Activateur tissulaire du plasminogène Interleukine-2 …
  14. 14. Enzymes impliquées dans la fromagerie la boulangerie la pâtisserie la dégradation des graisses le blanchiment du papier, des textiles la dépollution la manipulation de l’ADN Taq polymérase séquenase
  15. 15. Transfert de gènes chez les eucaryotes Transfert de gènes dans des cellules en culture = transfection
  16. 16. Expression du gène transfecté Clones cellulaires
  17. 17. Analyse de l’ARNm, ou de la protéine, ou de l’effet sur la cellule
  18. 18. Transgènes -  gène d’intérêt, avec ou non ses propres séquences régulatrices - gène rapporteur CAT lacZ GFP luciférase
  19. 19. Vecteur d’expression : un exemple
  20. 20. Méthodes chimiques biologiques mécaniques
  21. 21. Phosphate de calcium
  22. 22. liposomes
  23. 23. Vecteurs viraux SV40 adenovirus virus Herpès retrovirus baculovirus …
  24. 24. électroporation
  25. 25. Canon à particules
  26. 26. Micro injection dans le noyau
  27. 27. Expression transitoire ou expression stable du gène transfecté Expression du gène transfecté Clones cellulaires
  28. 28. Fibroblastes 24h après transfection
  29. 29. Application correction génique
  30. 30. (SCID)-X1 Severe Combined ImmunoDeficiency liée à X Avril 2000 Hôpital Necker
  31. 31. sur 630 essais de thérapie génique (somatique) :
  32. 32. Thérapie génique (somatique) ex vivo in vivo in situ Beaucoup d’espoir Peu de réussite à ce jour …
  33. 33. Transgenèse = Transfert d’un gène dans un organisme pluricellulaire
  34. 34. Transgenèse = Transfert d’un gène dans un organisme pluricellulaire Organismes génétiquement modifiés OGM Bactéries Levures Animaux mammifères oiseaux poissons … Plantes
  35. 35. Exemple : chez la souris Transfert de gènes : souris transgéniques
  36. 36. 1982
  37. 37. Animaux transgéniques -  Amélioration -  « bioréacteurs » -  Xénogreffes -  Lutte contre certaines pandémies - Modèle animal pour étude des maladies humaines
  38. 38. production de molécules à intérêt pharmaceutique industriel
  39. 39. Janvier 2007 Poules transgéniques Transgène sur-exprimé dans le blanc d’oeuf -  interféron - un anticancéreux potentiel
  40. 40. Transgenèse par transformation de cellules souches embryonnaires
  41. 41. The Nobel Prize in Physiology or Medicine 2007 "for their discoveries of principles for introducing specific gene modifications in mice by the use of embryonic stem cells" Mario R. Capecchi Sir Martin J. Evans Oliver Smithies 1/3 of the prize 1/3 of the prize 1/3 of the prize USA United Kingdom USA
  42. 42. Fécondation Développement embryonnaire
  43. 43. Invalidation ciblée de gène Construction d’une version invalidée du gène d’intérêt dans un vecteur de ciblage Intégration du gène invalidé à la place du gène « normal » dans les cellules ES: - Transformation des cellules ES avec le vecteur de ciblage contenant le gène invalidé - Sélection des cellules ES knock out (KO) pour le gène d’intérêt Injection des cellules ES KO dans un blastocyste et implantation dans une souris receveuse Souris KO pour le gène d’intérêt
  44. 44. Obtention de cellules ES recombinées (par ciblage génétique, recombinaison homologue)
  45. 45. Injection des cellules ES KO dans un blastocyste et implantation dans une souris receveuse
  46. 46. KO conditionnels Knock out et Knock in
  47. 47. Transgenèse chez la drosophile Transposon : élément P
  48. 48. Transgenèse chez les plantes Protoplastes Canon à particules Plasmide Ti d’Agrobacterium tumefaciens
  49. 49. Plasmide Ti (Tumor inducing) - 206 kb - 196 gènes - ADN-T : transfert
  50. 50. Interaction plante-Agrobacterium Si blessure, induction de l’expression des gènes vir. Les protèines vir excisent l’ADN-T (= brin T) qui est transféré dans la plante
  51. 51. Résistance aux herbicides aux insectes nuisibles Amélioration nutritionnelle Production de molécules à usage thérapeutique
  52. 52. USA : 2/3 de la production mondiale
  53. 53. Riz doré produit du beta-carotène (précurseur de la vitamine A)
  54. 54. Risques http://www.ogm.gouv.fr
  55. 55. http://www.ogm.gouv.fr
  56. 56. Clonage par transfert nucléaire
  57. 57. 1997
  58. 58. Clonage reproductif Clonage thérapeutique Interdit en France (chez l’homme)

×