Verónica González NúñezUniversidad de Salamanca12. REGULACION DE LA EXPRESIONGENICA EN PROCARIONTES
1. Introducción. Importancia de la regulación de la expresión génica2. Promotores3. El operon Lac- Concepto de operon- El ...
INTRODUCCION. Importancia de la regulación de la expresión génicaNo todas las proteínas han de expresarse simultáneamente-...
Importancia de la regulación de la expresión génica (II)ProcariontesAcoplamiento de la transcripción y la traducciónLos ge...
Importancia de la regulación de la expresión génica (III)EucariontesCompartimentación celular 1. La transcripción tiene lu...
Mecanismo de control de la transcripciónInteracciones específicas entre productos en trans = proteínassobre secuencias en ...
Tipos de regulación génica (I)Forma I1. El represor esta unido constitutivamente al promotor  gen reprimido2. La union de...
Tipos de regulación génica (II)Regulación positiva La unión de un activador facilita la transcripciónForma I1. El activado...
Promotor eficiente ó fuerteSecuencia muy parecida a la secuencia consensoAlta tasa de transcripción en condiciones basales...
Tipos de promotores (II)Promotor ineficiente ó débilLa secuencia difiere mucho de la secuencia canónicaBaja tasa de transc...
Concepto de operonUnidad de expresión génica, que permite la transcripción coordinada de variosgenes implicados en una mis...
El operon (II)Gen reguladorCodifica un efector que interacciona con el centro operadorControla la transcripción de los gen...
Estructura del Operon Lac- unión de la proteina CAP- p = promotor- o = operador- 3 genes estructurales: z, y & az = β-gala...
El operon lac (II)DNAOP z y aOperadorPromotor Genes estructuralesSitio deunion a CAPCAPgen iRP iEl operon lac y su regulac...
Tetrámerocon un eje de simetría binarioCada subunidad- 360 αα (37 KDa). cada subunidad- codificado por el gen i- cada subu...
En ausencia de inductorEl gen i se transcribe  el represor se sintetizaRepresor Lac sin inductor- el represor en forma te...
En presencia de inductor = lactosa en el medioLas pocas moléculas de β-galactosidasa catalizanla transformación de lactosa...
Mecanismo de regulación del operon Lac (III)En presencia de inductorEn ausencia de inductorOperon lacP igen iRBloqueo de l...
Región palindrómica de 28 bp- eje de simetría binario- localizada en el lugar de unión de la RNA polimerasa- correlación e...
Efecto inhibidor de la Glc = Represión catabólicaLa Glc es el metabolito por excelenciaEn presencia de Glc en el medio: no...
Relación inversa entre Glc y [cAMP] [Glc]   [cAMP]Mecanismo- fosforilación de una enzima- la enzima-P activa la adenila...
CAP: Catabolite Activator Protein = CRP: cAMP Receptor ProteinHomodímero. Estructura de cada monómero- dominio N-terminal:...
Interacción CAP-cAMP # DNA 2 posibilidades no mutuamente excluyentesProteina CAP y [cAMP] (II)Fuente de la imagen:RCSB PDB...
Control de la expresión génica por la proteína CAP (II)Ejemplo. Operon lacEn presencia de Glc y ausencia de inductor- [cAM...
Operon araBADCodifica las enzimas necesarias para el metabolismo de la arabinosa  xilulosa-5P4 sitios de control upstream...
Genes estructurales del operon araBADtransformación de la arabinosa  xilulosa-5P- ara B = ribulokinasa- ara A = arabinosa...
En presencia de AraC y ausencia de L-arabinosa y de CAP-cAMP- AraC se une a araO1, araO2 & araIbucle en el DNA, que une ar...
Cuando AraC, L-arabinosa y cAMP (baja [Glc]) están presentes- CAP-cAMP se une a un sitio CAP- L-ara se une a araC: AraC-ar...
1. Una proteína puede regular su propia síntesis al reprimir la expresióndel gen que la codifica2. La unión de un efector ...
ATENUACIÓN: EL OPERON trpMecanismo utilizado para controlar la expresión de operones que codificanenzimas implicadas en la...
Estructura del represor TrpProteína homodimérica- 1 monómero = 107 αα- codificado por el gen trpR(en un operon distinto)Es...
Mecanismo de acción del represor Trp (I)Represor per se: no se puede unir al DNA  transcripción del operon trpRepresor tr...
Mecanismo de acción del represor Trp (II)Consideraciones- El Trp actua como Co-represor- El represor trp también controla ...
trpLSecuencia guía ó líder de 162bp que contiene el atenuador ó centro determinación controladaMet-Lys-Ala-Ile-Phe-Val-Leu...
4 segmentos que pueden formar horquillas mutuamente excluyentesAntiterminadorhorquillas 23 La transcripción continúa de ...
Estructura del atenuador (II)Segmentorico en GCHorquilla1 # 2 Horquilla3 # 4TerminadorUUUUUSTOPleaderTrp (UGG)Trp (UGG) Tr...
Basado en la presencia de dos codones consecutivos de Trpen procariontes, la transcripción y la traducción están acopladas...
Mecanismo de acción del atenuador (II)Si el Trp es abundante = abundancia de Trp-tRNATrp(Si la RNA polimerasa ha logrado e...
Coordinación de la biosíntesis de rRNA con las necesidades de síntesis deproteínasThe stringent response ó respuesta restr...
ppGpp: guanosina 5’-difosfato-3’-difosfatoActúa como mensajero intracelular, afectando los niveles de expresión devarios o...
Falta de nutrientes: aumenta la concentración de ppGppGen relAFactor restrictivo (sintetasa). Cataliza la síntesis de ppGp...
Upcoming SlideShare
Loading in...5
×

12. regulacion de la expresion genica en procariontes

6,081

Published on

Published in: Education
1 Comment
3 Likes
Statistics
Notes
  • de donde saco la información ?
       Reply 
    Are you sure you want to  Yes  No
    Your message goes here
No Downloads
Views
Total Views
6,081
On Slideshare
0
From Embeds
0
Number of Embeds
4
Actions
Shares
0
Downloads
0
Comments
1
Likes
3
Embeds 0
No embeds

No notes for slide
  • Estructura del operon trp - trpO : region palindrómica = eje de simetría binario. Se solapa con el promotor region lider ( trpL ) que contiene el atenuador 5 genes estructurales Fuera del operon trp: trpR – codifica el represor Trp
  • 12. regulacion de la expresion genica en procariontes

    1. 1. Verónica González NúñezUniversidad de Salamanca12. REGULACION DE LA EXPRESIONGENICA EN PROCARIONTES
    2. 2. 1. Introducción. Importancia de la regulación de la expresión génica2. Promotores3. El operon Lac- Concepto de operon- El operon lac4. Represión por catabolito- Relación entre la presencia de glucosa y los niveles de cAMP- La proteína CAP como ejemplo de proteína de unión al DNA5. Control positivo y negativo por una misma proteína: el operon araBAD6. Atenuación: el operon trp7. Regulación de la síntesis de rRNAESQUEMA. Regulación de la expresión génica en procariontes
    3. 3. INTRODUCCION. Importancia de la regulación de la expresión génicaNo todas las proteínas han de expresarse simultáneamente- gasto de materia y ε- interferencia en las funciones entre proteínasLos organismos han de adaptarse muy rápidamente a cambios ambientalesDeterminados programas genéticos necesitan de la expresión ordenada de unconjunto de genes Síntesis de cada proteína en el momento en que sea necesariaLa expresión génica se regula fundamentalmente a nivel transcripcional
    4. 4. Importancia de la regulación de la expresión génica (II)ProcariontesAcoplamiento de la transcripción y la traducciónLos genes suelen ser policistrónicosCambios ambientales muy drásticos y repentinos la adaptación ha de ser muy rápida (minutos)El control de la transcripción suele ejercerse durante la iniciación
    5. 5. Importancia de la regulación de la expresión génica (III)EucariontesCompartimentación celular 1. La transcripción tiene lugar en el núcleo2. El mRNA es transportado al citoplasma3. El mRNA es traducido por los ribosomasLa modificación de la expresión génica no ha de ser ni tan rápida(en horas ó días), ni tan drásticaExcepción: durante el desarrollo y la diferenciación se necesita de laexpresión diferencial y ordenada de múltiples genesEl control de la expresión génica puede ejercerse sobre- la iniciación de la transcripción- el splicing- el transporte de los mRNAs- la estabilidad de los mRNAs- la traducción
    6. 6. Mecanismo de control de la transcripciónInteracciones específicas entre productos en trans = proteínassobre secuencias en cis =DNA- productos en trans: difunden y ejercen su acción sobre elementos alejadosde su lugar de síntesis- secuencias en cis: “sólo” pueden afectar a regiones vecinas del DNAEl control de la expresión génica se suele ejercer sobre el inicio de latranscripciónEl control transcripcionalTipos de genes- Constitutivos = housekeeping- Inducibles: aumenta su expresión en respuesta a un cambio ambiental- Reprimibles: inhibición de su expresión en presencia a una señal represora
    7. 7. Tipos de regulación génica (I)Forma I1. El represor esta unido constitutivamente al promotor  gen reprimido2. La union de una molécula señal provoca la disociación del represor del promotor3. La transcripción tiene lugarRegulación negativa La union de un represor inhibe la transcripciónForma II1. El represor no puede unirse per se al promotor  gen activado2. La unión de una molécula señal permite que el represor se una al promotormolecula señal = co-represor + represor = apo-represor3. La transcripción se bloquea
    8. 8. Tipos de regulación génica (II)Regulación positiva La unión de un activador facilita la transcripciónForma I1. El activador esta unido constitutivamente al promotor  gen activado2. La unión de una molécula señal causa la disociación del activador del promotor3. La transcripción se bloqueaForma II1. El activador no puede unirse per se al promotor  gen reprimido2. La unión de una molécula señal permite que el activador se una al promotormolecula señal = coactivador + activador = apoactivador3. La transcripción tiene lugar
    9. 9. Promotor eficiente ó fuerteSecuencia muy parecida a la secuencia consensoAlta tasa de transcripción en condiciones basalesLa expresión génica se controla con un represor: Regulación negativaRepresión: disminución de la tasa de síntesis de una enzima en presenciade un determinado metabolitoEn OPERONES REPRIMIBLESTIPOS DE PROMOTORES (I)
    10. 10. Tipos de promotores (II)Promotor ineficiente ó débilLa secuencia difiere mucho de la secuencia canónicaBaja tasa de transcripción en condiciones basalesLa expresión génica se controla con un inductor o activadorRegulación positivaInducción: aumento de la síntesis de un enzima en presencia de unsustrato determinadoEn OPERONES INDUCIBLES
    11. 11. Concepto de operonUnidad de expresión génica, que permite la transcripción coordinada de variosgenes implicados en una misma ruta metabólicaEstructura de un operon: Distribución lineal de los componentes- centro operador: cerca del promotor y del inicio de la transcripciónlugar de reconocimiento para los efectores- promotor: puede solaparse con el operador- genes estructurales = codifican las enzimas de una ruta metabólicamRNA policistrónicoEL OPERON (I)DNAO P 1 2 3Operador Promotor Genes estructurales
    12. 12. El operon (II)Gen reguladorCodifica un efector que interacciona con el centro operadorControla la transcripción de los genes estructuralesEl efector interacciona generalmente con el DNA y con la RNA polimerasaDNAO P 1 2 3Operador Promotor Genes estructuralesDNAP RGen reguladorOperon sobre el que actua el gen regulador
    13. 13. Estructura del Operon Lac- unión de la proteina CAP- p = promotor- o = operador- 3 genes estructurales: z, y & az = β-galactosidasay = galactósido permeasaa = tiogalactósido transacetilasaEL OPERON lac (I)Fuera del Operon Lac: gen iRegulador: determina los niveles detranscripción del operon lacRepresor difusible que actúa en transCodifica las enzimas involucradas en el metabolismo de la lactosaEl operon sólo se activa cuando hay lactosa en el medio
    14. 14. El operon lac (II)DNAOP z y aOperadorPromotor Genes estructuralesSitio deunion a CAPCAPgen iRP iEl operon lac y su regulación por el represor codificado por el gen i
    15. 15. Tetrámerocon un eje de simetría binarioCada subunidad- 360 αα (37 KDa). cada subunidad- codificado por el gen i- cada subunidad puede unir unamolécula de inductor (IPTG)- Dominio N-terminal: unión al DNA- Dominio C-terminal: unión delinductor y oligomerizaciónEl represor Lac es un reguladornegativo Bloquea la transcripciónEstructura del represor LacFuente de la imagen:RCSB PDB. N. acceso: 1JWLEstructura del represor Lac dimérico
    16. 16. En ausencia de inductorEl gen i se transcribe  el represor se sintetizaRepresor Lac sin inductor- el represor en forma tetramérica se une al DNA  se desliza a través del DNAhasta que llega al operador lac- unión de alta afinidad represor # operador lac  Bloqueo de la transcripciónMecanismo: la interacción represor # operador- estimula la unión de la RNA polimerasa al DNA- pero impide la iniciación de la transcripción: la RNA polimerasa no puedeformar un complejo abierto (aumento de la barrera ε) la RNA polimerasa no puede adquirir alta procesividad durante laelongaciónMecanismo de regulación del operon Lac (I)
    17. 17. En presencia de inductor = lactosa en el medioLas pocas moléculas de β-galactosidasa catalizanla transformación de lactosa 1,6-alolactosaInductor fisiológico = 1,6-alolactosa(por transglicosilación de la lactosa)Inductor no metabolizable = IPTG(isopropil-tiogalactósido)El inductor se une al represorLa unión IPTG # Represor Lac disminuyela afinidad del represor por el operador El represor se separa del DNA  transcripcion del operon lac• Implicaciones biotecnológicas del operon Lac& técnicas de clonación1,6-alolactosaIPTGMecanismo de regulación del operon Lac (II)
    18. 18. Mecanismo de regulación del operon Lac (III)En presencia de inductorEn ausencia de inductorOperon lacP igen iRBloqueo de la transcripciónP z y aOgen iRTranscripciónP z y aOTraducción
    19. 19. Región palindrómica de 28 bp- eje de simetría binario- localizada en el lugar de unión de la RNA polimerasa- correlación entre el eje de simetría del represor y del operador adaptación DNA # proteínaEstructura del operador Lac (35bp)Operador constitutivo (Oc)Al menos 8 mutaciones que provocan una disminución en la simetría afinidad del represor por el operador & el represor no se puede unir al DNA El operon se transcribe de manera constitutiva(* Aplicaciones biotecnológicas)TGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAACAACTCACCTTAACACTCGCCTATTGTTAAAGTGTGTOperador lac
    20. 20. Efecto inhibidor de la Glc = Represión catabólicaLa Glc es el metabolito por excelenciaEn presencia de Glc en el medio: no se utiliza otra fuente de ε se inhibe la expresión de las enzimas del metabolismo de cualquier otra fuente εOperones regulados por represión por catabolito- suelen tener promotores ineficientes ó débiles- doble control: 1. cAMP: señal de ausencia de Glc en el medio2. Inductor propio: señal de presencia de la fuente ε metabolizadapor las enzimas codificadas en el operonCircuito regulador globalCoordina la expresión génica con el estado fisiológico de la célula- operones regulados por cAMP- genes de choque térmico- genes sos: activados por lesión en el DNAREPRESION POR CATABOLITO
    21. 21. Relación inversa entre Glc y [cAMP] [Glc]   [cAMP]Mecanismo- fosforilación de una enzima- la enzima-P activa la adenilato ciclasa [Glc]   [cAMP]Mecanismo- transporte de Glc a través de la membrana- la Glc estimula desfosforilación de laenzima:  enzima-P- inactivación de la adenilato ciclasaControl de la expresión génica por la proteína CAP (I)CAP activaCAP inactivacAMP cAMP [Glc]↓ [cAMP] [Glc]↓ [cAMP]Unión a CAP-cAMP # CAPbinding site en los operonesActivación de la transcripción
    22. 22. CAP: Catabolite Activator Protein = CRP: cAMP Receptor ProteinHomodímero. Estructura de cada monómero- dominio N-terminal: unión de cAMP (1 sitio por monómero)- dominio C-terminal: unión al DNA (HTH)- un eje de simetría binario, que coincide con su centro de unión al DNACAP per se no se une a los promotores, sino CAP-cAMPRegión del DNA reconocida por CAP- region palindrómica CAP binding siteLa unión CAP-cAMP # DNA produce la activación génica CAP es un regulador positivoProteina CAP y [cAMP] (I)
    23. 23. Interacción CAP-cAMP # DNA 2 posibilidades no mutuamente excluyentesProteina CAP y [cAMP] (II)Fuente de la imagen:RCSB PDB. N. acceso: 1CGPEstructura de un dímero de CAP-cAMP unido al DNA1. CAP # cAMP interaccionadirectamente con la RNApolimerasaEl sitio CAP se solapa con elpromotor2. CAP # cAMP se une alpromotorEl DNA se dobla 90° sobre sucentro de simetríaSe forma un complejo cerradoRNA polimerasa # promotorSe facilita la iniciación de latranscripción
    24. 24. Control de la expresión génica por la proteína CAP (II)Ejemplo. Operon lacEn presencia de Glc y ausencia de inductor- [cAMP] bajos  CAP inactiva- El represor lac se une al operador, impidiendo la transcripción Bloqueo de la transcripción del operon lacEn ausencia de Glc y presencia de inductor (alolactosa)- [cAMP] altos  CAP-cAMP activa  se une al CAP binding site del operon lac- El represor lac # alolactosa se separa del operador Activación de la transcripción del operon lac
    25. 25. Operon araBADCodifica las enzimas necesarias para el metabolismo de la arabinosa  xilulosa-5P4 sitios de control upstream del inicio de la transcripción (en sentido upstream)- araO2: operador 2, situado a -270bp del inicio del operon araBAD y tambiénupstream del gene araC (se transcribe en dirección opuesta al operon araBAD)- araO1: operador 1 del gen araC- CAP- araI: [I – inductor] 2 secuencias idénticas de 17bp - araI1 & araI2 – repeticionesdirectas separadas por 4bparaI2 se solapa con la región -35bp del promotor araBADCONTROL POSITIVO Y NEGATIVO POR UNA MISMA PROTEÍNA: EL OPERON araBAD
    26. 26. Genes estructurales del operon araBADtransformación de la arabinosa  xilulosa-5P- ara B = ribulokinasa- ara A = arabinosa isomerasa- ara D = ribulosa-5P epimerasaGen araCCodifica la proteína de unión de L-arabinosa (292 αα)- dominio N-terminal: unión de L-arabinosa; es el dominio de dimerización- dominio C-terminal: unión al DNAEn ausencia de arabinosa se comporta como represorEn presencia de arabinosa, araC # arabinosa actúa como activadorEL OPERON araBAD (II)
    27. 27. En presencia de AraC y ausencia de L-arabinosa y de CAP-cAMP- AraC se une a araO1, araO2 & araIbucle en el DNA, que une araI & araO2dimerización de la proteína araC- Se impide la unión de la RNA polimerasa  Transcripción de araC y araBADCONTROL NEGATIVO y Autorregulación de la transcripción de araCMecanismo de acción propuesto (I)Operon araBAD: regulado por CAP-cAMP y por AraCLa RNA polimerasa transcribe el gen araC
    28. 28. Cuando AraC, L-arabinosa y cAMP (baja [Glc]) están presentes- CAP-cAMP se une a un sitio CAP- L-ara se une a araC: AraC-arabinosa se separa de araO2 yaumentando su afinidad por araI2: no se forma el bucle en el DNA  Transcripción de araBADaraC permenece reprimido (unión de AraC-arabinosa a araO1)CONTROL POSITIVOMecanismo de acción propuesto (II)
    29. 29. 1. Una proteína puede regular su propia síntesis al reprimir la expresióndel gen que la codifica2. La unión de un efector a una proteína puede alterar su conformacióny/o su funcionalidad: cambio de un inhibidor a un activador génico3. Los centros reguladores de un gen no tienen por qué localizarse juntoal inicio de la transcripción de los genes que regulanLa formación de bucles en el DNA es un mecanismo muy extendidopara poner en contacto dos regiones de DNA4. Los cambios inducidos por efectores pueden revertirse de manerarápida y sencilla El sistema se puede adaptar de forma muy eficiente a cambiosambientalesOperon araBAD y principios generales de la regulación génica
    30. 30. ATENUACIÓN: EL OPERON trpMecanismo utilizado para controlar la expresión de operones que codificanenzimas implicadas en la biosíntesis de aminoácidosOperones de Trp, Phe, His, Leu, Thr, ilv (Ile, Leu & Val)La secuencia líder es rica en codones que codifican para los ααsintetizados por las enzimas del operon•gnc4 en levaduras: mecanismo análogo en eucariontesOperon trpCodifica 5 polipéptidos que forman 3 enzimas implicadas en la biosíntesisde Trp a partir de corismatoSe expresan de manera coordinada bajo la regulación del represor trpEl operon trp sólo se induce en ausencia de Trp en el medio
    31. 31. Estructura del represor TrpProteína homodimérica- 1 monómero = 107 αα- codificado por el gen trpR(en un operon distinto)Estructura de cadamonómero de represor trp- dominio N-terminal = regiónde “dimerización- “spacer”- dominio C-terminal = HTHde interacción con el DNAFuente de la imagen:RCSB PDB. N. acceso: 1TROEstructura de un dímero del represor TRP#Trp unido al DNA
    32. 32. Mecanismo de acción del represor Trp (I)Represor per se: no se puede unir al DNA  transcripción del operon trpRepresor trp-Trp- cambio conformacional: los dos dominios HTH se separancada una de las HTH encaja en un surco mayor del DNA (surcos consecutivos)- puente de hidrógeno entre el Trp y un grupo fosfato del DNA- H2O: puentes entre el DNA y el represor Interacción Represor trp-Trp # trpO:  expresión del operon trp(se impide la unión de la RNA polimerasa al promotor)trpO- region palindrómica del DNA con un eje de simetría binario- se solapa con el promotor
    33. 33. Mecanismo de acción del represor Trp (II)Consideraciones- El Trp actua como Co-represor- El represor trp también controla la expresión de otros dos operones:trpR y aroH (biosintesis del corismato)- El represor trp también regula su propio operon trpR= Autorregulación ó regulación autógenaEn ausencia de Trp- El represor trp no puede unirse al DNA Activación de la transcripción del operon trpEn presencia de Trp en el medio- El represor trp # Trp se une a trpO del DNA Bloqueo de la transcripción del operon trp
    34. 34. trpLSecuencia guía ó líder de 162bp que contiene el atenuador ó centro determinación controladaMet-Lys-Ala-Ile-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser (STOP)AtenuaciónNiveles de Trp bajos: se transcribe todo el mRNA policistrónico, incluido trpL (7Kb)Niveles mayores de Trp: la mayoría de los mRNAs son de 140 nucleótidosEl aumento de los niveles de Trp provoca una terminación prematura de latranscripción
    35. 35. 4 segmentos que pueden formar horquillas mutuamente excluyentesAntiterminadorhorquillas 23 La transcripción continúa de forma normalTerminadorhorquillas12 & 34Señal de terminación de la transcripción: secuencia rica en G+C que formauna horquilla, seguida de U’s La transcripción se terminaEstructura del atenuador (I)
    36. 36. Estructura del atenuador (II)Segmentorico en GCHorquilla1 # 2 Horquilla3 # 4TerminadorUUUUUSTOPleaderTrp (UGG)Trp (UGG) Trp (UGG)Trp (UGG)STOPleaderHorquilla2 # 3Antiterminador
    37. 37. Basado en la presencia de dos codones consecutivos de Trpen procariontes, la transcripción y la traducción están acopladasCuando el Trp es escaso = escasez de Trp-tRNATrp (aminoácido activado)- el ribosoma comienza a traducir el mRNA, pero se para sobre los codonesque codifican para el Trp (ausencia de tRNAs cargados)- se impide la formación de la horquilla 12 en el mRNA- al continuar la transcripción, se forma la horquilla 23 Horquilla 23 = AntiterminadorSe transcribe un mRNA de 7 KbSéntesis de todas las enzimas implicadas en la biosíntesis de TrpMecanismo de acción del atenuador (I)
    38. 38. Mecanismo de acción del atenuador (II)Si el Trp es abundante = abundancia de Trp-tRNATrp(Si la RNA polimerasa ha logrado esquivar la inhibición por el represor)- se transcribe y el operon trp, y los ribosomas comienzan a traducir el mRNA- el ribosoma impide que se forme la horquilla 23 en el mRNA- se forman las horquillas 12 & 34 Horquilla 34 = terminador de la transcripciónSe transcribe un mRNA de 140 ntNo se sintetizan las enzimas implicadas en la biosíntesis de Trp
    39. 39. Coordinación de la biosíntesis de rRNA con las necesidades de síntesis deproteínasThe stringent response ó respuesta restrictivaLa falta de cualquier aminoacil-tRNA, que pueda limitar la biosíntesis deproteínas, produce un reajuste metabólico en la célulaLa célula se prepara para situaciones de falta de nutrientes- reducción (1:10 ó 1:20) en la biosíntesis de rRNAs y tRNAs- represión de rutas anabólicas, excepto la activación de la biosíntesis de ααREGULACIÓN DE LA SÍNTESIS DE rRNA (I)
    40. 40. ppGpp: guanosina 5’-difosfato-3’-difosfatoActúa como mensajero intracelular, afectando los niveles de expresión devarios operones- Inhibe la transcripción de rRNAs- Estimula la transcripción de operones trp y lacRegulación de la síntesis de rRNA (II)Estructura del ppGpp
    41. 41. Falta de nutrientes: aumenta la concentración de ppGppGen relAFactor restrictivo (sintetasa). Cataliza la síntesis de ppGppATP + GDP  AMP + ppGppSu actividad es máxima cuando el ribosoma está unido a un mRNAy a un tRNA no cargado con ααLa unión de un aminoacil-tRNA disminuye la síntesis de ppGppGen spoTMetaboliza ppGpp ppGpp  GTP + PPiLa respuesta restrictiva y ppGpp

    ×