Origins Final Presentation
Upcoming SlideShare
Loading in...5
×
 

Origins Final Presentation

on

  • 525 views

 

Statistics

Views

Total Views
525
Views on SlideShare
525
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • Venice State Archive houses one of the largest collections of unbroken documentary historyDating back to the beginning of the Venetian Republic90km of shelves
  • Show the first three words, one at a timeLink this with the three people thing, with more edits
  • Show the first three words, one at a timeLink this with the three people thing, with more edits
  • Show the first three words, one at a timeLink this with the three people thing, with more edits
  • Dna extraction is generic example, random str, explain significanceFor example, go back to map and show comparison from everythingOne sample tracking throughLab gets bottle, extract Y chromosomeFrom Y chromosome, DNA helixFrom DNA Helix, zoom in on a non-coding DNAFrom ncDNA, zoom to nucleotides(explain STR’s, and all the stuff I read)Bunch of other samples come in, randomly? (fabio just said it)Show comparison from samples from the test regions and the control regions, make up how some are similar but some are different

Origins Final Presentation Origins Final Presentation Presentation Transcript

  • Unearthing the Roots of Venice:From Relics to DNA
    Debora Afezolli
    Benjamin M. Allen
    Jaclyn Hepworth
    Andrew J. Kazanovicz
  • Ancient Documents
    Archaeology
    Genetic Genealogy


  • Archaeologist 2
    To be filled for every object/layer
    ~100 per intervento

    Archaeological
    potential map

    Cross-reference


    Searchable
    Scheda statua 
    Scheda sito 
    Scheda tomba
    Scheda inorganico 

    Index forms
    Scheda organico 
    Scheda unita stratigrafica (US) 
    Manually created
    Schede

    Soprintendenza Archeologica
    Foto

    Manually submitted
    Archaeologist 1
    Disegni

  • ArchEasy: A Solution
    Web-based management system for the archival, geo-referencing, and interpretation of archaeology in Venice
    Form management
    Database search
    Automatic indexing
    Interpretative maps
    Initial prototype system design
  • Archaeologist 2
    Automatic
    Automatic
    Archaeologist 1
    Soprintendenza Archeologica

    Archaeological
    potential map

    Cross-reference
    Electronically submitted

    Searchable
    Data Interpretation

    Index forms
    ArchEasy database
    Schede

    Electronically uploaded
    Foto

    Disegni

  • Archaeologist 2
    Automatic
    Automatic
    Archaeologist 1
    Soprintendenza Archeologica

    Archaeological
    potential map

    Cross-reference
    Electronically submitted

    Searchable
    Data Interpretation

    Index forms
    ArchEasy database
    Schede


    Electronically uploaded
    Foto

    Disegni

  • Forms
    Paper US form
    ArchEasy electronic US form
  • Archaeologist 2
    Automatic
    Automatic
    Archaeologist 1
    Soprintendenza Archeologica

    Archaeological
    potential map

    Cross-reference
    Electronically submitted

    Searchable
    Data Interpretation


    Index forms
    ArchEasy database
    Schede

    Electronically uploaded
    Foto

    Disegni

  • Old paper index US form
    ArchEasy electronic index US form
    Indexing
  • Archaeologist 2
    Automatic
    Automatic
    Archaeologist 1
    Soprintendenza Archeologica

    Archaeological
    potential map

    Cross-reference
    Electronically submitted


    Searchable
    Data Interpretation

    Index forms
    ArchEasy database
    Schede

    Electronically uploaded
    Foto

    Disegni

  • Traditional Search
    Manually searched
    Old searching methods to find desired data
    • Time consuming
    • Ineffective
    • Difficult to cross-reference
  • Romano

    ArchEasy electronic search and results
    ArchEasy Search
  • Mapping Data
    View the Map
  • Archaeologist 2
    Automatic
    Automatic
    Archaeologist 1

    Soprintendenza Archeologica

    Archaeological
    potential map

    Cross-reference
    Electronically submitted

    Searchable
    Data Interpretation

    Index forms
    ArchEasy database
    Schede

    Electronically uploaded
    Foto

    Disegni

  • Archaeological Potential
    Lower potential of archaeological find
    Higher potential of archaeological find
    Broad representation of archaeological potential
  • Public works official
    Archaeological Potential
    View all objects on map
    Consults map
    Relics near Via Barovier are found every 15m
    High likelihood of more of these objects, so budget accordingly
    Application to public works
  • Archaeologist 2
    Automatic
    Automatic
    Archaeologist 1

    Soprintendenza Archeologica

    Archaeological
    potential map

    Cross-reference
    Electronically submitted

    Searchable
    Data Interpretation

    Index forms
    ArchEasy database
    Schede

    Electronically uploaded
    Foto

    Disegni

  • Object Correlation
    ArchEasy
    Correlates data
    Similar elevation, also 13th Century
    Brick floor
    Found: 1.5m beneath
    Origins: 13th Century
    Brick floor
    Found: 1.5m beneath
    Origins: ??
    Correlational ability of ArchEasy
  • The Future: Autonomous Agent Approach
    I have a similar floor pattern, therefore I could also be a 15th century church
    My brick size is 14x12x7 cm
    I’m a 15th century church with herringbone floors
    My brick size is 22x15x9 cm, and I am 100 years old
    I could also be 100 years old
    I have the same type of floor, oriented in the same direction
    My brick size is 22x15x9 cm
    Self-correlating autonomous agent approach
  • Results
    • Promotional Website: Purpose, vision, and features of ArchEasy
    Introducing ArchEasy…
    • Archaeological data storage, analysis, and manipulation
    • Easy completion of administrative form requirements
    • Archaeological potential maps
    • Complete customization and control of workspace
    • Effective search function to enable cross-referencing
  • Venice State Archive
    Unbroken documentary history
    90km of shelves
    Painstaking to access and utilize the documents
  • Current Process at the Venice State Archive
    Publications
    Archive
    Scholar 1
    Pages
    Transcriptions
    Santa Maria della Salute
    Manuscripts
    Retrieves
    Searches
    Deliver to
    90km of Shelves
    Request Information
    Choose
  • Current Process at the Venice State Archive
    Publications
    Archive
    Scholar 2
    Duplicate Transcriptions
    Pages
    SAME Manuscripts
    Santa Maria della Salute
    Retrieves
    Searches
    Deliver to
    90km of Shelves
    Request SAME Information
    Choose
  • Current Process at the Venice State Archive
    Publications
    Archive
    Scholar 3
    TriplicateTranscriptions
    Pages
    SAME Manuscripts
    Santa Maria della Salute
    Retrieves
    Searches
    Deliver to
    90km of Shelves
    Request SAME Information
    Choose
  • Transcriptions are not shared!
    Scholar 1
    Scholar 3
    Scholar 2
    Transcriptions
    Transcriptions
    Transcriptions




    SHARING
  • uScript: A Solution
    Scholar 1
    Scholar 3
    Scholar 2
    Transcriptions
    Transcriptions
    Transcriptions
    SHARING
  • Contribution Accountant
    uScript’s Components
    3 Components
    Archive Assistant
    Transcription Assistant
    Archive Assistant
    Transcription Assistant
  • uScript
    Scholar 1
    Scholar 3
    Scholar 2
    uScript: An Overview
    Archive Assistant
    Santa Maria della Salute
    Search
  • uScript
    Scholar 1
    Scholar 3
    Scholar 2
    Manuscripts
    Archive Assistant
  • I
    In
    In
    n
    no
    nom
    nomi
    nomin
    nomine
    nomine
    d
    do
    dom
    domi
    domin
    domini
    domini
    Marie
    Transcription Assistant
  • uScript
    Scholar 1
    Scholar 3
    Scholar 2
    Transcriptions
    Transcriptions
    Manuscripts
    Manuscripts
    Archive Assistant
    Contribution Accountant
    Search
    d
    do
    dom
    domi
    domin
    domini
  • I
    In
    In
    n
    no
    nom
    nomi
    nomin
    nomine
    nomine
    d
    do
    dom
    domi
    domin
    domini
    domini
    n
    no
    nos
    nost
    nostr
    nostri
    nostri
    Marie
    Transcription Assistant
  • M
    Ma
    Mar
    Mary
    Mary
    Transcription Assistant
  • uScript
    Scholar 1
    Scholar 3
    Scholar 2
    Transcriptions
    Transcriptions
    Manuscripts
    Manuscripts
    Archive Assistant
    Contribution Accountant
    Search
    d
    do
    dom
    domi
    domin
    domini
  • Marie
    Transcription Assistant
  • uScript
    Scholar 1
    Scholar 3
    Scholar 2
    Transcriptions
    Manuscripts
    Archive Assistant
    Contribution Accountant
  • The Components
    Contribution Accountant
    Archive Assistant
    Transcription Assistant
    Archive Assistant
    Contribution Accountant
    Search Manuscripts and Transcriptions

    Rate Contributors and Transcriptions
    Transcription Database
    Promotes Accuracy

    Learn Handwriting

    Automatic Transcriptions
    Automatic Boxing
  • Transcriptions
    Transcriptions
    Transcriptions
    Transcriptions
    Nothing goes to waste!
    uScript
  • Recent Effort
    Promotional Website: show and explain everything that is uScript
  • Contribution to Origins Theory
    Origins of Venetians
    Unearth Theory Evidence
    Validates Theory
    Research Theory Evidence
  • Venetian Origins Theories
    Lusatia
    ?
    Brittany
    ?
    Paphlagonia
    ?
  • Paphlagonian Theory
  • Paphlagonian Theory
  • Paphlagonian Theory
    Livy – Aburbe condita
    1st Century B.C.E.
    “Antenor sailed into the furthest part of the Adriatic, accompanied by a number of Enetians…and the name was extended to the surrounding district; the whole nation were called Veneti”
  • Paphlagonian Theory
    Homer – The Illiad
    8th Century B.C.E.
    “The Paphlagonianswere commanded by a stout-hearted Pylaemenes from Enetae…”
  • Brittany Theory
  • Brittany Theory
  • Brittany Theory
    Strabo – Ancient Greek Historian
    1st Century A.C.E.
    Claim that ancestors of Veneto are not the Enetae of Paphlagoniabut the Veneti of Gaul
  • Lusatia Theory
  • Lusatia Theory
  • Lusatia Theory
    Salvi – Veneti: First Builders of European Community
    1984 A.C.E.
    Developed VeneticTheory claiming most current day European populations are descendants of the Veneti of Lusatia
  • ?
    ?
    ?
  • ?
    ?
    ?
  • Confirming Theories
    ?
    ?
    ?
  • Genographic Project Collaboration
  • Genographic Project Collaboration
  • Genographic Project Collaboration
  • Genographic Project Collaboration
    300
  • Genographic Requirements
    Males
    At least 18 years old
    From Northeast Italy (specifically Veneto)
  • Veneto
    Barcelona
  • 163
  • DNA Extraction
  • Y-Chromosomal DNA
    Y-chromosome
  • Y-Chromosomal DNA
    Coding DNA (genes)
    Y-chromosome
  • Y-Chromosomal DNA
    Coding DNA (genes)
    Non-coding DNA
    Y-chromosome
  • Y-Chromosomal DNA
    Coding DNA (genes)
    Non-coding DNA
    Loci
    - 12 locations of interest
    Y-chromosome
  • Y-Chromosomal DNA
    ATCTCATACATACATACATAGCTA
    Y-chromosome
  • Y-Chromosomal DNA
    4 complementary nucleotides
    A,T,C, and G
    ATCTCATACATACATACATAGCTA
    Y-chromosome
  • Y-Chromosomal DNA
    Scientists examine
    short tandem repeats (STRs)
    ATCTCATACATACATACATAGCTA
    Y-chromosome
  • Y-Chromosomal DNA
    Scientists examine
    short tandem repeats (STRs)
    ATCTCATACATACATACATAGCTA
    Y-chromosome
  • Y-Chromosomal DNA
    Scientists examine
    short tandem repeats (STRs)
    ATCTCATACATACATACATAGCTA
    Y-chromosome
  • Y-Chromosomal DNA
    Scientists examine
    short tandem repeats (STRs)
    ATCTCATACATACATACATAGCTA
    4 CATA repetitions
    =
    4 STRs
    Y-chromosome
  • Hypothetical DNA Comparison
    Venice ATCTCATACATACATACATAGCTA
  • Hypothetical DNA Comparison
    Venice ATCTCATACATACATACATAGCTA
    PaphlagoniaATCACATACATACATACATAGCA
    Lusatia GCTGACCATACTGAACGATATC
    Brittany GCTAACGAATGTCAAGCTAATA
  • Hypothetical DNA Comparison
    Venice ATCTCATACATACATACATAGCTA
    Paphlagonia ATCACATACATACATACATAGCA
    Lusatia GCTGACCATACTGAACGATATC
    Brittany GCTAACGAATGTCAAGCTAATA
  • Hypothetical DNA Comparison
    Venice ATCTCATACATACATACATAGCTA
    Paphlagonia ATCACATACATACATACATAGCA
    Lusatia GCTGACCATACTGAACGATATC
    Brittany GCTAACGAATGTCAAGCTAATA
  • Hypothetical DNA Comparison
    Venice ATCTCATACATACATACATAGCTA
    (4 STRs)
    Paphlagonia ATCACATACATACATACATAGCA
    Lusatia GCTGACCATACTGAACGATATC
    Brittany GCTAACGAATGTCAAGCTAATA
  • Hypothetical DNA Comparison
    Venice ATCTCATACATACATACATAGCTA
    (4 STRs)
    PaphlagoniaATCACATACATACATACATAGCA
    Lusatia GCTGACCATACTGAACGATATC
    Brittany GCTAACGAATGTCAAGCTAATA
  • Hypothetical DNA Comparison
    Venice ATCTCATACATACATACATAGCTA
    (4 STRs)
    PaphlagoniaATCACATACATACATACATAGCA
    (4 STRs)
    Lusatia GCTGACCATACTGAACGATATC
    (1 STRs)
    Brittany GCTAACGAATGTCAAGCTAATA
    (0 STRs)
  • Hypothetical DNA Comparison
    Venice ATCTCATACATACATACATAGCTA
    (4 STRs)
    PaphlagoniaATCACATACATACATACATAGCA
    (4 STRs)
    Lusatia GCTGACCATACTGAACGATATC
    (1 STRs)
    Brittany GCTAACGAATGTCAAGCTAATA
    (0 STRs)



  • Y-DNA Haplogroups
    https://genographic.nationalgeographic.com/genographic/lan/en/atlas.html
  • Ancient Documents
    Archaeology
    Genetic Genealogy
  • Acknowledgements
    Professor Fabio Carrera
    Professor Daniel Gibson
    Dr. Marco Bortoletto and Dr. Alberto Zandinella,
    Dr. Giovanni Caniato
    Dr. David Comas
    Alberto Gallo
    MatteoSecchi, PierluigiTamburrini, and Venessia.com
    The Settimari
    Caffé Brasilia
    John Brunelli
    And a special thanks to all of the Genographic participants!
  • Questions