Your SlideShare is downloading. ×
¿Son seguros los alimentos transgénicos?
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

¿Son seguros los alimentos transgénicos?

101

Published on

Conferencia del Prof. Dr. José Luis García López, profesor de investigación del Centro de Investigaciones Biológicas del CSIC, sobre los organismos modificados genéticamente. …

Conferencia del Prof. Dr. José Luis García López, profesor de investigación del Centro de Investigaciones Biológicas del CSIC, sobre los organismos modificados genéticamente.
Conferencia impartida el 13 de mayo de 2014 en la Universidad Popular Carmen de Michelena de Tres Cantos.
Más información en:
http://www.universidadpopularc3c.es/index.php/actividades/conferencias/details/1773

Published in: Health & Medicine
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
101
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
2
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. José Luis García CIB-CSIC Universidad Popular "Carmen de Michelena" Tres Cantos Mayo 13, 2014
  • 2. LECTURAS RECOMENDADAS www.sebiot.org DESCARGA GRATUITA COLECCIÓN PREGUNTAS Y RESPUESTAS
  • 3. CIENCIA NOVELA OTROS LIBROS
  • 4. LEGISLACIÓN EUROPEA Ley de Bioseguridad (Ley 9/2003) (Real Decreto 78/2004) Reglamento Europeo Etiquetado de OGMs (R (CE) 1830/03) COMISIÓN NACIONAL BIOSEGURIDAD AGENCIAS DE SEGURIDAD ALIMENTARIA
  • 5. OTRAS INSTITUCIONES RELACIONADAS CON LA SALUD ALIMENTARIA
  • 6. FOOD SAFETY (seguridad alimentaria) Se refiere a la manipulación, preparación y almacenamiento de alimentos de manera que prevenir las enfermedades causadas por los alimentos. CONCEPTOS DE SEGURIDAD ALIMENTARIA FOOD SECURITY (aseguramiento alimentario) Se refiere a la disponibilidad de alimentos, el acceso de las personas a ellos y el aprovechamiento biológico de los mismos
  • 7. GENERALMENTE CONSIDERADO SEGURO GENERALLY RECOGNIZED AS SAFE
  • 8. EVALUACIÓN DE RIESGOS Riesgos para el hombre Salud Riesgos para el medioambiente Plantas Animales Ecosistemas
  • 9. CONTAMINACIÓN GENÉTICA flujo de genes no controlado desde un OGM hacia una población salvaje o no OGM del mismo organismo
  • 10. MEJORA GENÉTICA Metodologías para cambiar las propiedades de las especies animales y vegetales por medio de la modificación del genotipo de los individuos TRADICIONAL RECOMBINANTE ± Mutagénesis (radiación, etc.) SELECCIÓN Cruzamiento Transformación GEN
  • 11. b) Organismo modificado genéticamente: cualquier organismo, con excepción de los seres humanos, cuyo material genético ha sido modificado de una manera que no se produce de forma natural en el apareamiento o en la recombinación natural, siempre que se utilicen las técnicas que reglamentariamente se establezcan.
  • 12. Un organismo transgénico es un OGM generado mediante la incorporación de genes de otras especies. Es decir, es un organismo modificado genéticamente mediante un procedimiento de ingeniería genética que implica la transferencia de genes entre distintas especies.
  • 13. AGALLA Agrobaterium tumefaciens Plásmido Ti
  • 14. ACTGTGACGTGACGTCAGGACTGACCAGTCAGTACGTGACTGACTGACGTACGCATGACGA CTGACCACACAGTGACGAGACTTTGAGACGTAGACCACGATGAGACGATAGAAACAGTGA TAGATAGAGATAGAGATACAGACACACAGAGACACACGTAGACGATGATAGCAGTGACG ATGACCAGTGATAGAACTGTGACGTGACGTCAGGACTGACCAGTCAGTACGTGACTGACT GACGTACGCATGACGACTGACCACACAGTGACGAGACTTTGAGACGTAGACCACGATGAG ACGATAGAAACAGTGATAGATAGAGATAGAGATACAGACACACAGAGATGACCCGCTCGT CGACGAGCTGTGTGTACCACACCACAGAGAGTGAGCACGAGAGAGCACATGATGACTGTG ACGTGACGTCAGGACTGACCAGTCAGTACGTGACTGACTGACGTACGCATGACGACTGACC ACACAGTGACGACTGTGACGTGACGTCAGGACTGACCAGTCAGTACGTGACTGACTGACGT ACGCATGACGACTGACCACACAGTGACGAGACTTTGAGACGTAGACCACGATGAGACGAT AGAAACAGTGATAGATAGAGATAGAGATACAGACACACAGAGAACTGTGACGTGACGTC AGGACTGACCAGTCAGTACGTGACTGACTGACGTACGCATGACGACTGACCACACAGTGAC GAGACTTTGAGACGTAGACCACGATGAGACGATAGAAACACGTGACGTCAGGACTGACCA GTCAGTACGTGACTGACTGACGTACGCATGACGACTGACCACACAGTGACGACTGTGACGT GACGTCAGGACTGACCAGTCAGTACGTGACTGACTGACGTACGCATGACGACTGACCACAC AGTGACGAGACTTTGAGACGTAGACCACGATGAGACGATAGAAACAGTGATAGATAGAG ATAGAGATACAGACACACAGAGAACTGTGACGTGACGTCAGGACTGACCAGTCAGTACGT GACTGACTGACGTACGCATGACGACTGACCACACAGTGACGAGACTTTGAGACGTAGACC ACGATGAGACGATAGAAACAGTGATAGATAGAGATAGAGATACAGACACACAGAGAAGA CTTTGAGACGTAGACCACGATGAGACGATAGAAACAGTGATAGATAGAGATAGAGATAC AGACACACAGAGATGATGATGATGCACGACAGAGACAGAGCACCATGTATATGATGATGA CAGACCAGACCAGATACTGTGACGTGACGTCAGGACTGACCAGTCAGTACGTGACTGACTG ACGTACGCATGACGACTGACCACACAGTGACGAGACTTTGAGACGTAGACCACGATGAGA CGATAGAAACAGTGATAGATAGAGATAGAGATACAGACACACAGAGAACTGTGACGTGA CGTCAGGACTGACCAGTCAGTACGTGACTGACTGACGTACGCATGACGACTGACCACACAT TTGAGACGTAGACCACGATGAGACGATAGAAACATACAGACACACAGAACCACGATCTGA AGACACACAGAGATGATGATGATGCACGACAGA GACAGAGCACCATGTATATGATGATGACAGACCA GACCAGATACTGTGACGTGACGTCAGGACTGACC AGTCAGTACGTGACTGACTGACGTACGCATGACG ACTGACCACACAGTGACGAGACTTTGAGACGTAG ACCACGATGAGACGATAGAAACAGTGATAGATA GAGATAGAGATACAGACACACAGAGAACTGTGA CGTGACGTCAGGACTGACCAGTCAGTACGTGACT GACTGACGTACGCATGACGACTGACCACACATTT GAGACGTAGACCACGATGAGACGATAGAAACAT ACAGACACACAGAACCACGATCTGA
  • 15. POSIBLES MEJORAS GENÉTICAS PARA LA ALIMENTACIÓN Plantas 1.Mejora de la producción 2.Mejora de las propiedades nutricionales 3.Nuevas propiedades (Vacunas) Microorganismos 1.Mejora de la producción de aditivos Animales 1.Mejora de la producción
  • 16. Cultivo transgénico resistente a herbicida Cultivo no transgénico GLIFOSATO Gen bacteriano de la enzima EPSPS similar al de la planta pero resistente a glifosato
  • 17. SIEMBRA BAJO CUBIERTA EN PRESENCIA DE GLIFOSATO
  • 18. Bacillus thuringiensis CRISTALES DE PROTEÍNA CRY USO COMO INSECTICIDA ECOLÓGICO Dipel y Thuricide
  • 19. Bt No Bt Gen bacteriano de la proteína Cry
  • 20. Cultivo transgénico Bt Cultivo no transgénico sensibles resistente refugio
  • 21. Tomate transgénico resistente a la infección Tomate no transgénico Pseudomonas syringae pv. tomato Gen de la Pto Kinasa de tomate
  • 22. colza transgénica
  • 23. Algodón Bt Algodón
  • 24. Dianthus caryophyllus Transgen = gen azul de la petunia Moonshadow
  • 25. RESISTENCIA A LA SEQUÍA REDUCCIÓN DE ALERGENICIDAD
  • 26. DATOS DE ESPAÑA  La única variedad transgénica que se cultiva en España con fines comerciales es el maíz MON 810, resistente a la plaga de taladro, de especial incidencia en el valle del Ebro.  De todo el maíz MON810 que se cultiva en Europa (149.926 hectáreas) España cultiva más del 90% (136.962 hectáreas).  Aragón cultiva más de 54.000 hectáreas y Cataluña cerca de 34.000 hectáreas.  En España se importan varios productos modificados genéticamente como soja y colza.  La inmensa mayoría de los OGMs se destina a la alimentación animal.
  • 27. “GOLDEN” RICE VITAMINA AIngo Potrykus Peter Beyer
  • 28. DESCAFEINADO MADURACIÓN HOMOGÉNEA
  • 29. MEJORA TRADICIONAL DE PLANTAS MUTAGÉNESIS, CRUZAMIENTO Y SELECCIÓN ¿CUÁNTOS GENES SE MODIFICAN EN ESTE PROCESO?
  • 30. ALGUNAS PREGUNTAS SOBRE LOS CULTIVOS TRADICIONALES ¿Sabemos siempre cómo se han obtenido? ¿Sabemos qué es lo que se modifica cada vez? ¿Pueden producir alergias o daños a la salud? ¿Pueden ocasionar cambios en los ecosistemas? ¿Quién controla la seguridad de estos alimentos? ¿Por qué no nos asustan?
  • 31. ALGUNAS PREGUNTAS SOBRE LOS CULTIVOS TRANSGÉNICOS ¿Sabemos siempre cómo se han obtenido? ¿Sabemos qué es lo que se modifica cada vez? ¿Pueden producir alergias o daños a la salud? ¿Pueden ocasionar cambios en los ecosistemas? ¿Quién controla la seguridad de estos alimentos? ¿Por qué nos asustan?
  • 32. Domingo JL. Toxicity studies of genetically modified plants: a review of the published literature. Crit Rev Food Sci Nutr. 2007;47:721-733. http://www.biosafety.ru/ftp/domingo.pdf Domingo JL, Giné Bordonaba J A literature review on the safety assessment of genetically modified plants. Environ Int. 2011 37:734-742 http://gaiapresse.ca/images/nouvelles/28563.pdf EFSA GMO Panel Working Group on Animal Feeding Trials. Safety and nutritional assessment of GM plants and derived food and feed: the role of animal feeding trials. Food Chem Toxicol. 2008; 46 Suppl 1:S2-70. http://www.efsa.europa.eu/en/efsajournal/doc/1057.pdf http://www.efsa.europa.eu/en/supporting/doc/480e.pdf ADAS UK Ltd. & Rothamsted Research. Review of the strategies for the comprehensive food and feed safety and nutritional assessment of GM plants per se. EFSA supporting publication 2013:EN-480.
  • 33. Environmental impacts I. GM pesticide-producing crops Toxic to harmless non-target species Toxic to beneficial insects A threat to soil ecosystems Risk for aquatic life Swapping one pest for another II. GM herbicide tolerant (HT) crops Toxic effects of herbicides on ecosystems Increased weed tolerance to herbicide Effects on health We simply do not know if GM crops are safe for human or animal consumption http://www.greenpeace.org/australia/PageFiles/434214/GM_Fact%20 Sheet_Health_%20and_Env_Impacts.pdf
  • 34. En 2012, la revista Food and Chemical Toxicology publicó un polémico artículo del biólogo francés Gilles-Eric Séralini en el que se aseguraba que el consumo de alimentos transgénicos había aumentado la mortalidad en ratones, hasta en un 50% en machos y un 70% en hembras. EL CASO Séralini Un año después de la publicación, el editor de la revista, Wallace Hayes, reconocía su error. “Food and Chemical Toxicology se retracta de este artículo porque nuestras investigaciones han revelado que sus métodos eran científicamente defectuosos. No se pueden extraer conclusiones definitivas y los datos no son concluyentes”
  • 35. ¿QUÉ PASA CON EL HAMBRE?

×