Your SlideShare is downloading. ×
0
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Curso de Genómica - UAT (VHIR) 2012 - Tecnologías de Ultrasecuenciación y de Enriquecimiento de Secuencia

1,515

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
1,515
On Slideshare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
42
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Cursos de Formación de la UAT (2012) Plataforma de Genómica / Plataforma de Diagnóstico Molecular “Tecnologías de alto rendimiento en genómica”2ª Parte: Tecnologías de ultrasecuenciación y de enriquecimiento de secuencia.
  • 2. Programa del curso De Sanger hacia NGS 454 de Roche  Cómo funciona  Flujo de trabajo de la tecnología Comparación con otros Sistemas NGS Aplicaciones de las tecnologías de ultrasecuenciación.  Estudio de quasiespecies virales mediante análisis de amplicones.  Secuenciación de genomas “de novo”.  Metagenómica  RNAseq  Aplicaciones de los arrays de captura de secuencia:  Análisis de exomas  Estudio de mutaciones en leucemia mediante arrays de captura de secuencia. Análisis de datos de ultrasecuenciación (UEB)
  • 3. Cualquier DNA puede ser secuenciado S. cervisiae BarleyM Tuberculosis C. elegans Arabidopsis Tomato Maccaca HIV Potato Neanderthal James Watson Honeybee H5N1 Grape wine Mammut
  • 4. Genomas SecuenciadosNature Reviews Genetics 9, 303-313, 2008Over the past years thegenomes of some of the mostimpotant model organisms havebeen sequenced:Figure 2. Vertebrate genomic sequence data. Phylogenetic treerepresenting species for which genomic sequence data are currentlyavailable Green indicates that BAC (bacterial artificial chromosome)-basedsequence is available in targeted regions of the genome 11, 15. Yellowrepresents 2X whole-genome shotgun assemblies17, and blue representsfull-shotgun or near-complete genomic sequence assemblies.
  • 5. Cronología de la Secuenciación phi X 174 Primer genoma de DNA completo secuenciado 11 genes en 5386 Secuenciaci bases (cadena ón Genoma sencilla) Watson “Chain-terminator mediante method” 454/ROCHE Sanger et al. Nature 452, Método usado 872-876 (17 1000 durante los proximos 30 April 2008). Genomes Francis Crick años Project ABI El NIH Finalización Lanzamie and James “ DNA comercializa empieza Proyecto Watson nto de Lanzamient sequencing by el 1ª secuenciació Genoma Lanzamiento GS FLX- describen el GS20 (454 o de chemical secuenciador n Humano GS FLX de SOLID Titanium Life SOLEXA (ROCHE) GS FLX+ modelo de la degradation ” automático, a gran (13 años) Science) (ABI) (Illumina) (ROCHE)ROCHE)doble hélice del Maxam y ABI 370. escala de DNA. 195 70 Gilbert 197 198 diversos 199 microorgs. 200 20 20 200 200 200 Helicos 3 ´s 7 7 0 3 05 06 7 8 9 BioSciences 20 10 2012
  • 6. 1ª Generación Secuenciación Método manual de Secuenciación Sanger Método automático de Secuenciación Nucleótidos Modificados Sanger Nucleótidos Modificados Marcados dTTP Polimerasa dTTP Polimerasa dGTP dGTP dATP + Secuencia molde:3´…GCCAGTCGGATGCATATGTCTGAGTC…5´ Primer: 5´…CGGT dATP + Secuencia molde: 3´..GCCAGTCGGATGCATATGTCTGAGTC..5´ 5´…CGGT dCTP dCTP Primer: (Marcaje radioactivo en el Primer o en uno de los 4 dNTPs en cada tubo) ddGTP ddATP ddTTP ddCTP ddGTP ddATP ddTTP ddCTP Grupo Base fosfato CGGTCAGCCTAC CGGTCAGCCTA H CGGTCAGCCT CGGTCAGCC3´ CGGTCAGCCTACGTATACAGACTCAG CGGTCAGC CGGTCAGCCTACGTATACAGACTCA CGGTCAG CGGTCAGCCTACGTATACAGACTC CGGTCAGCCTACGTATACAGACT CGGTCAGCCTACGTATACAGAC Electroforesis CGGTCAGCCTACGTATACAGA CGGTCAGCCTACGTATACAG (1 Secuencia/Capilar) CGGTCAGCCTACGTATACA CGGTCAGCCTACGTATAC CGGTCAGCCTACGTATA CGGTCAGCCTACGTAT CGGTCAGCCTACGTA CGGTCAGCCTACGT CGGTCAGCCTACG GCCTAC CGGTCAGCCTAC CGGTCAGCCTA CGGTCAGCCT CGGTCAGCC CGGTCAGC CGGTCAG CGGTCA CGGTC CGGT CGG5´ CG C
  • 7. 1ª Generación SecuenciaciónEstrategia de Secuenciación a gran escala Secuenciación de fragmentoslargos de DNA. El DNA se fragmenta en trozos alazar y se clonan en una bibliotecabacteriana. El ADN de los clones bacterianosindividuales se secuencianmediante Secuenciación Sangerautomática. La secuencia se ensamblanobservando las regionessolapantes. Los Gaps se pueden rellenarmediante paseos de cebadores.
  • 8. 1ª Generación Secuenciación Primer borrador Genoma 3.000 millones de Humano dólares para secuenciar 3.000 nts (1$/nt)Sanger sequencing:- Long reads (500-1000 bp)- Low throughput (192 reactions/run)
  • 9. 2ª Generación SecuenciaciónLos Instrumentos de secuenciación de 2ª generación son capaces de generar cientos de miles de reacciones desecuencias en paralelo en un día como los generados por varios cientos de secuenciadores con capilares tipo Sanger, a un coste por base leída más barato. 2004 2006-2009 Coste 0.01$/bp 0.0001$/bp Capacidad/Instrumento/día 1.000.000 ˃ 5.000.000.000
  • 10. 2ª Generación Secuenciación ROCHE GS FLX 454 GS FLX+ 454 GS Junior 454 Illumina Solexa HiSeq 2000 HiSeq 1000 HiScanSQ Genome MiSeq Analyzer IIx LifeTechnology SOLiD™ 3System SOLiD™ 4 System 5500 5500xl Ion Torrent System System System
  • 11. Sanger vs 2ª Generación Secuenciación 1. Fragmentación de DNA 1. Fragmentación de DNA2.Clonaje en Vectores; Transformación Bacterias; 2. Ligación de adaptadores in vitro y crecimiento y aislamiento vector DNA amplificación clonal 3. Ciclo Secuenciación 3. Secuenciación masiva en paralelo Secuencia: Primer: Polimerasa dNTPs ddNTPs marcados 4. Procesamiento imagen 4. Procesamiento imagen CTATGCTCG Electroforesis (1 Secuencia/Capilar)
  • 12. Programa del curso De Sanger hacia NGS 454 de Roche  Cómo funciona  Flujo de trabajo de la tecnología Comparación con otros Sistemas NGS Aplicaciones de las tecnologías de ultrasecuenciación.  Estudio de quasiespecies virales mediante análisis de amplicones.  Secuenciación de genomas “de novo”.  Metagenómica  RNAseq  Aplicaciones de los arrays de captura de secuencia:  Análisis de exomas  Estudio de mutaciones en leucemia mediante arrays de captura de secuencia. Análisis de datos de ultrasecuenciación (UEB)
  • 13. GS 454 de ROCHEGS FLX + GS Junior
  • 14. GS 454 de ROCHE: Como funciona Formato de Placa 1ª Generación 2ª Generación 3100 ABI GS ROCHE96p-Plates 384p-Plates PicoTiterPlate PicoTiterPlate FLX+ (70x70mm) Junior
  • 15. GS 454 de ROCHE: Como funciona¿Cúantas muestras se pueden secuenciar por run? GS FLX+ Junior 454 Gaskets 70.000-100.000N= (GxC)/Mbp por región PTP N= num de muestras que puedo secuenciar en un run G= tamaño de lo que quiero secuenciar C= Coverage (C= N * L / G) Multiplexar (MIDS; Tamaño Multiplexar (MIDS; Tamaño amplicón; Primer) amplicón; Primer)
  • 16. GS FLX/Junior 454 WorkflowgDNA, DNA plasmídico, RNA 1.Calidad & Cantidad Material de partida 2. Construcción Librería 3. Amplificación mediante emPCR 4. Secuenciación Datos Obtenidos
  • 17. 1. Calidad & Cantidad Material de partida1.1 Calidad mediante Chips Bioanalyzer; gel agarosa gDNA, DNA plasmídico, RNA1.2 Cuantificación mediante Picogreen (gDNA, amplicones) o Ribogreen (RNA) y = 34,577x - 61,596 R2 = 0,9994 20000 15000 Fluorescence 10000 . 5000 0 0 200 400 600 Lam bda DNA (ng/m L) Fluorímetro FLx800
  • 18. GS FLX/Junior 454 WorkflowgDNA, DNA plasmídico, RNA 1.Calidad & Cantidad Material de partida 2. Construcción Librería 3. Amplificación mediante emPCR 4. SecuenciaciónDatos Obtenidos
  • 19. 2. Construcción Librería Librería Shotgun Librería Pair-End Fragmentación Librería cDNA Selección Tamaño Ligación Adaptadores Librería Amplicones gDNA, DNA plasmídico PCR con Fusion Primers RNA Adaptador A (44 bases): Adaptador B (44 bases) Fusion Primers Primer Primer Adaptador A Target 4 4Amplificación Primer Amplificación Primer nucleótidos Secuenciación nucleótidos Secuenciación “Key” Biotina “Key” Adaptador B Target
  • 20. 2. Construcción Librería: Fragmentación gDNALibreríasShotgun Rotura utilizando nitrógeno a alta presiónNEBULIZACIÓN Nebulize DNA genómico Fragmentos de DNA de doble cadena 2.1 bar (30psi)Librerías Pair-End Fuerzas de rotura hidrodinámicasHYDROSHEAR gDNA Orificio fragmentado gDNA
  • 21. 2. Construcción Librería: Fragmentación RNALibreríascDNARNA Rando First Strand m Synthesis Primers Solución de Fragmentación de Second Strand Synthesis RNA Fragmentos de cDNA de doble cadena
  • 22. 2. Construcción Librería: Selección fragmentosgDNA Nebulizado: AMPure beads DNA 7500 Lab Chip SPRI (Solid Phase Reversible Immobilization) DNA 7500 LabChip 300pb-1000pb 50pb-1000pbgDNA fragmentado con Hydroshear: RNA Pico 6000 LabChip Electroelución 500pb-600 nt Tamaño medio de 500-600 nt (dep. del contenido en GC) Menos del 10% ≤ 300 nt, no adaptor dimers Conc >0.2 ng/μl (Ribogreen ®)
  • 23. 2. Construcción LibreríaInmobilización Fragmentos y aislamiento de la Librería: AB Melt Solution BA BB AA  4 tipos de productos resultan de la ligación  Los productos con Biotina (AB, BA, BB) se unen a bolas magnéticas que llevan estreptavidina. Los products AA son lavados y eliminados.  Mediante Melt Solution (NaOH0.1N) las cadenas no biotiniladas de cada fragmento de dsDNA son aisladas. Ambas cadenas de los fragmentos BB quedarán unidas a las bolas. Sólo se aislan cadenas de DNA sencilla AB constituyendo la librería.
  • 24. 2. Construcción Librería: Q&Q LibreríaMolecules/μl =  Num de Avogadro es 6.022x1023 (moléculas/mole)  328.3x109 (gramos/mole) es peso molecular medio de nts.  Perfil típico de una librería ssDNA (Agilent 2100 RNA Pico 6000 LabChip): Tamaño medio de 500-800 bp  Cuantificación mediante Ribogreen  Dilución de trabajo para emPCR
  • 25. GS FLX/Junior 454 WorkflowgDNA, DNA plasmídico, RNA 1.Calidad & Cantidad Material de partida 2. Construcción Librería 3. Amplificación mediante emPCR 4. SecuenciaciónDatos Obtenidos
  • 26. 3. Amplificación mediante emPCRReacción de emPCR: High-speed shaker -1 starting effective fragment per microreactor - ~106 microreactors per ml - All processed in parallel (Amplificación clonal)
  • 27. 3. Amplificación mediante emPCRRecuperación de beads después de la emPCR: Rotura y Recuperación Contaje 65%, 85% óptimo DNA-beads/ml % Recuperación= x100 Input beads Enrequecimiento de beads con DNA: Melt 5-20% óptimo Unión de Primer Adición de bolas Melt DNA-beads/ml dsDNA marcado con Biotina a magnéticas con x100 % Enrequecimiento= bolas de captura con estreptavidina Input beads ssDNA
  • 28. emPCR Titulación sólo para GS FLXAntes de la emPCR: ¿Cuántas copias de librería por Beads de captura son óptimas? 1. Procesar 4 tubos emulsiones Tubo Moléculas de Librería por Vol Librería Bead de Captura (cpb) Diluida 1 2 1.2 µl 2 4 2.4 µl 3 8 4.8 µl 4 16 9.6 µl 2. Recuperación y enrequecimiento de cada tubo 3. Contaje de las beads enriquecidas 4. Escoger el ratio copia/bead con aproximadamente un 8% de enrequecimiento
  • 29. GS FLX/Junior 454 WorkflowgDNA, DNA plasmídico, RNA 1.Calidad & Cantidad Material de partida 2. Construcción Librería 3. Amplificación mediante emPCR 4. SecuenciaciónDatos Obtenidos
  • 30. 4. Secuenciación GasketsMetal coated PTP reduces crosstalk29 μm well diameter (20/bead)3,400,000 wells per PTP
  • 31. 4. SecuenciaciónSecuenciación mediante síntesisQuímica basada en la pirosecuenciación  Polimerasa añade nucleótidos (dATP)  Se libera pirofosfato (PPi)  Sulfurilasa crea ATP a partir del PPi Sulfurylase Luciferasa hidroliza ATP Luciferase Luciferina y usa luciferina para producir luz. Light + oxyluciferin
  • 32. 4. SecuenciaciónFlujo de Reactivos Nucleotides are flowed sequentially acrossthe PTPone at a time (200 cycles à 4 bases) Pyrophosphate signal generation uponcomplimentary nucleotide incorporation —darkotherwise The CCD camera is generating a image afterevery flow The signal strength is proportional to thenumber of nucleotides incorporated
  • 33. 4. SecuenciaciónFlowgama y Base calling:
  • 34. 4. Secuenciación:Ejemplo
  • 35. Especificaciones Sistemas GS FLX & GS Junior GS Junior SystemGS FLX+ System
  • 36. El futuro de la secuenciación 454
  • 37. Programa del curso De Sanger hacia NGS 454 de Roche  Cómo funciona  Flujo de trabajo de la tecnología Comparación con otros Sistemas NGS Aplicaciones de las tecnologías de ultrasecuenciación.  Estudio de quasiespecies virales mediante análisis de amplicones.  Secuenciación de genomas “de novo”.  Metagenómica  RNAseq  Aplicaciones de los arrays de captura de secuencia:  Análisis de exomas  Estudio de mutaciones en leucemia mediante arrays de captura de secuencia. Análisis de datos de ultrasecuenciación (UEB)
  • 38. Comparación con otros Sistemas NGS 2ª NGS 3ª NGS ABI Illumina ROCHE Illumina ABI Roche 3ª NGSCuadro resumen de las posibles combinaciones de estrategias en las diferentesplataformas de NGS
  • 39. Comparación Plataformas NGS GS FLX 454 HiSeq 2000-Illumina ABI SOLID 5500xl  Chemistry based on  Chemistry based on Chemistry based on pirosequencing reversible terminators sequencing by ligation  Sample amplified by  Sample amplified by Sample amplified by emulsion PCR solidphase amplification emulsion PCR  Read length 2x100 bp  Read length 50-100 bp Read length 250-500 bp  3 billions reads per run  100-500 million reads per run >1 million reads per run  600 Gb of sequence  50-100 Gb of sequence 400-600 Mb of sequence  2-11 days run  4-8 days run ~10 hours run
  • 40. Comparación Plataformas secuenciaciónEQUIPO ROCHE GS FLX ILLUMINA HISEQ ABI 5500XL 454 2000 SOLIDCoste del equipo 450.000 $ 690.000 $ 251.000 $Coste de los reactivos 6.200 $ 23.470 $ 10.503 $por run*Coste por Mb 12 $ 0,07 $ 0,04 $Fuente: http://www.molecularecologist.com/next-gen-fieldguide/
  • 41. Comparación Plataformas secuenciación
  • 42. Comparación Plataformas secuenciación Aplicaciones
  • 43. Comparación Plataformas secuenciaciónNext Generation Genomics: World Map of High-throughputSequencers
  • 44. Ejemplos de Genomas humanos secuenciados Nature Reviews Genetics 11, 31-46 (January 2010)
  • 45. Comparación Plataformas secuenciación 1ª Generación 2ª Generación
  • 46. 3ª Generación Secuenciación SCIENCE Vol 323 2 JANUARY 2009Real-Time DNA Sequencing fromSingle Polymerase MoleculesJohn Eid,* Adrian Fehr,* Jeremy Gray,* Khai Luong,* John Lyle,* Geoff Otto,*Paul Peluso,* David Rank,* Primo Baybayan, Brad Bettman, Arkadiusz Bibillo,Keith Bjornson, Bidhan Chaudhuri, Frederick Christians, Ronald Cicero,Sonya Clark, Ravindra Dalal, Alex deWinter, John Dixon, Mathieu Foquet,Alfred Gaertner, Paul Hardenbol, Cheryl Heiner, Kevin Hester, David Holden,Gregory Kearns, Xiangxu Kong, Ronald Kuse, Yves Lacroix, Steven Lin, PaulLundquist, Congcong Ma, Patrick Marks, Mark Maxham, Devon Murphy, InsilPark, Thang Pham, Michael Phillips, Joy Roy, Robert Sebra, Gene Shen, JonSorenson, Austin Tomaney, Kevin Travers, Mark Trulson, John Vieceli, JeffreyWegener, Dawn Wu, Alicia Yang, Denis Zaccarin, Peter Zhao, Frank Zhong,Jonas Korlach, Stephen Turner. Press Release Pacific Biosciences Announces Early Access Customers for Its Single Molecule Real Time System Eleven Leading Companies Support Launch of Third-generation DNA Sequencing MENLO PARK, Calif., Feb 23, 2010 Pacific Biosciences, a private company developing a disruptive technology platform for real- time detection of biological events at single molecule resolution, today announced the 10 institutions that have purchased its Single Molecule Real Time (SMRT(TM)) DNA sequencing system http://www.pacificbiosciences.com as part of the companys early access program in North America.
  • 47. Programa del curso De Sanger hacia NGS 454 de Roche  Cómo funciona  Flujo de trabajo de la tecnología Comparación con otros Sistemas NGS Aplicaciones de las tecnologías de ultrasecuenciación.  Estudio de quasiespecies virales mediante análisis de amplicones.  Secuenciación de genomas “de novo”.  Metagenómica  RNAseq  Aplicaciones de los arrays de captura de secuencia:  Análisis de exomas  Estudio de mutaciones en leucemia mediante arrays de captura de secuencia. Análisis de datos de ultrasecuenciación (UEB)
  • 48. PAUTAS PARA EL DISEÑO EXPERIMENTAL DE UN ESTUDIO DE ULTRASECUENCIACIÓNPautes para el Diseño experimental de un estudio de ultrasecuenciación
  • 49. UCTS WORKFLOW ResearcherStatistics and Bioinformatics UCTS (UEB) EXPERIMENTAL DESIGN QUALITY SAMPLES COLLECTION RESULTS CHECKING EXPERIMENTS SAMPLE PROCESSING DATA ANALYSIS SEQUENCING UEB UCTS Others
  • 50. Programa del curso De Sanger hacia NGS 454 de Roche  Cómo funciona  Flujo de trabajo de la tecnología Comparación con otros Sistemas NGS Aplicaciones de las tecnologías de ultrasecuenciación.  Estudio de quasiespecies virales mediante análisis de amplicones.  Secuenciación de genomas “de novo”.  Metagenómica  RNAseq  Aplicaciones de los arrays de captura de secuencia:  Análisis de exomas  Estudio de mutaciones en leucemia mediante arrays de captura de secuencia. Análisis de datos de ultrasecuenciación (UEB)
  • 51. Fin

×