Your SlideShare is downloading. ×
0
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Session 5.3: Levy
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Session 5.3: Levy

760

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
760
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
23
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide
  • 20070212 combination of all data
  • 20070212 combination of all data
  • Transcript

    • 1. Levy Lab Matthew Levy Department of Biochemistry Albert Einstein College of Medicine Targeting cells with aptamers
    • 2. Aptamers <ul><li>Nucleic acid based binding species </li></ul><ul><li>Can be selected against a variety of targets </li></ul><ul><li>Kd’s in the sub-nanomolar to nanomolar range with specificities (comparable to monoclonal antibodies) </li></ul><ul><li>Small (ca. 10,000 MW) and easily synthesized in milligram or greater quantities </li></ul><ul><li>Can be readily derivatized for conjugation </li></ul><ul><li>Non-immunogenic </li></ul><ul><ul><li>Macugen, anti-VEGF aptamer, approved by FDA 2004 </li></ul></ul><ul><li>In vitro origin of aptamers allows for tailored selections </li></ul>
    • 3. Aptamers exist naturally <ul><li>Small RNA loop binds protein (U1A) with pM affinity </li></ul>
    • 4. In vitro selection of aptamers Constant regions Random region Of 40 nucleotides Library size = ~10 14-15
    • 5. Aptamers that target cell surface receptors can be used for delivery of cargoes to cells <ul><li>siRNA </li></ul><ul><li>Toxins </li></ul><ul><li>Small molecule drugs </li></ul>Hicke et al. J Nucl Med. 2006 Apr;47(4):668-78 Anti-PSMA aptamer Anti-hTfR aptamer Anti-Tenascin C aptamer Aptamers can be used to target in vivo
    • 6. Cancer/Aptamer projects underway in my lab <ul><li>Targeted drug delivery </li></ul><ul><ul><li>Transferrin Receptor </li></ul></ul><ul><ul><li>PSMA </li></ul></ul><ul><li>Vaccine Development </li></ul><ul><ul><li>DEC205 (dendritic cell receptor) </li></ul></ul>
    • 7. The transferrin receptor (TfR, CD71) <ul><li>Cell surface (type II) glycoprotein involved in iron uptake </li></ul><ul><li>Expressed at LOW levels on normal cells </li></ul><ul><li>Expressed at HIGH levels on cells with high proliferation rates </li></ul><ul><ul><li>Highly over expressed in many cancers </li></ul></ul><ul><ul><li>Expressed on activated PBMCs </li></ul></ul><ul><ul><li>Expressed on the BBB. </li></ul></ul><ul><ul><ul><li>Transferrin and anti-TfR Abs have been demonstrated to cross the BBB </li></ul></ul></ul><ul><li>Diagnostics </li></ul><ul><li>Therapeutics </li></ul>
    • 8. Selection for aptamers targeting the transferrin receptor <ul><li>4 rounds of selection against recombinant protein </li></ul><ul><li>Round 5 of selection conducted on HeLa cells (TfR+) </li></ul>
    • 9. Anti-TfR aptamers label multiple human cancer cell lines FACs based analysis using AF488 labeled aptamer
    • 10. Minimization eliminates more than half of the c2 sequence. c2 c2.min.2 c2.min.6 c2.min.9.1 38.6 kDa 14.0 kDa Brian Wengerter
    • 11. Prostate-specific membrane antigen <ul><li>Two 2’F modified RNA aptamers (A9 and A10) selected by Lupold et al. (2002) </li></ul><ul><li>110 kDa type II transmembrane protein </li></ul><ul><li>Expressed in high level by prostate tumor cells </li></ul><ul><li>Expressed in tumor neovasculature </li></ul><ul><li>Known to internalize via clatherin mediated endocytosis </li></ul>Using a library based on the A9 aptamer we have now performed a ‘doped’ selection Cytoplasmic domain Transmembrane domain Extracellular domain NH 2 COOH Catalytic domain NH 2 COOH Catalytic domain
    • 12. Doped A9 selection GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly Heavily mutagenize (30%) Reselect (HeLa-PSMA cells)
    • 13. Minimization of the anti-PSMA A9 aptamer GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly
    • 14. <ul><li>These aptamers are currently being adapted for the delivery of a variety of cargoes </li></ul>
    • 15. Targeting DEC 205 <ul><li>DEC205 is a C-type lectin expressed on the surface of dendritic cells (DCs) that is very efficient at cross-presentation. </li></ul><ul><li>Cross-presentation = the ability to process and present extracellular antigens with MHC class I molecules to CD8 T cells (cytotoxic T cells). </li></ul><ul><li>This process can be harnessed to enhance the immune response to tumors! </li></ul><ul><li>An anti-DEC205 antibody fused to the protein NY-ESO-1 is currently in phase II clinical trials. </li></ul>
    • 16. Targeting cell surface receptors with aptamers anti-DEC205 <ul><li>3 rounds of selection against recombinant protein </li></ul><ul><li>Round 4 and 5 conducted on CHO DEC 205 (+) </li></ul>
    • 17. <ul><li>Knocking down DEC205 with siRNA leads to decrease is surface staining </li></ul>Brian Wengerter Anti-DEC205 aptamers bind CHO cells that express DEC205
    • 18. <ul><li>We have now minimized our DEC205 aptamers </li></ul><ul><li>We have made aptamer OVA conjugates are learning to do antigen presentation assays on primary DCs (thank you Debbie Palliser). </li></ul>Brian Wengerter
    • 19. Summary <ul><li>Aptamers posses unique qualities that make them well suited for the targeted delivery of cargoes to cells and translation to the clinic. </li></ul><ul><ul><li>siRNA and drugs to cancer cells </li></ul></ul><ul><ul><li>Targeting dendritic cells (DEC205) for antigen presentation </li></ul></ul><ul><li>These technologies can be broadly applied to other receptors and multiple types of cancer. </li></ul>
    • 20. Acknowledgements <ul><li>Lab Members: </li></ul><ul><ul><ul><li>Amos Yan </li></ul></ul></ul><ul><ul><ul><li>Maria Magalhaes </li></ul></ul></ul><ul><ul><ul><li>Linsley Kelly </li></ul></ul></ul><ul><ul><ul><li>Brian Wengerter </li></ul></ul></ul><ul><li>Funding: </li></ul><ul><li>Albert Einstein College of Medicine </li></ul><ul><li>Marion Bessin Liver Research Center </li></ul><ul><li>NIH/NIGMS, 1R01GM087985-01 </li></ul><ul><li>SU2C/AACR, IRG </li></ul><ul><li>Collaborators: </li></ul><ul><li>AECOM </li></ul><ul><ul><li>Debbie Palliser </li></ul></ul><ul><ul><li>Steve Almo </li></ul></ul><ul><ul><li>Peng Wu </li></ul></ul><ul><ul><ul><li>David Soriano del Amo </li></ul></ul></ul><ul><li>Rockefeller University </li></ul><ul><ul><li>Steinmann Lab </li></ul></ul><ul><ul><ul><li>Chae Gyu Park </li></ul></ul></ul><ul><ul><ul><li>Jake Rosenberg </li></ul></ul></ul>

    ×