• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Primer designgeneprediction
 

Primer designgeneprediction

on

  • 543 views

primer designing, restriction mapping, gene prediction

primer designing, restriction mapping, gene prediction

Statistics

Views

Total Views
543
Views on SlideShare
543
Embed Views
0

Actions

Likes
0
Downloads
10
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Primer designgeneprediction Primer designgeneprediction Presentation Transcript

    • IICB Course work, 8th Dec 2012
    • Topics to be covered Primer designing Restriction mapping Gene Prediction
    • ATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAAATGACGCATAGCAGCATAGACGCATAGACGACGCATAGACGACATAGAGACGAGACGCAGAATAGAGGACGAGCAATGATGATAGAA Oligo Analyzer: http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/ http://www.idtdna.com/Analyzer/Applications/Instructions/Default.as px?AnalyzerDefinitions=true
    • Primer Designing No non-specific binding Melting temperature Should not be forming dimers with itself or other primers.
    • Some thoughts 1. primers should be 17-28 bases in length; 2. base composition should be 50-60% (G+C); 3. primers should end (3) in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms between 55-80oC are preferred; 5. 3-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesised preferentially to any other product; 6. primer self-complementarity (ability to form 2o structures such as hairpins) should be avoided; 7. runs of three or more Cs or Gs at the 3-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided.Adapted from: Innis and Gelfand,1991
    • Reference:http://bioweb.uwlax.edu/genweb/molecular/seq_anal/primer_design/primer_design.ht
    • Restriction Analysis Found in Bacteria and archea. 4 types  Type -1: cleavage remote to recognition site (methylase activity)  Type-2: cleavage within a specific distance  Type-3: Cleavage within a short distance  Type-4: Cleaves modified DNA (methylated) Ref: http://insilico.ehu.es/restriction/long_seq/ http://molbiol-tools.ca/Restriction_endonuclease.htm
    • Gene Prediction Patterns Frame Consistency Dicodon frequencies PSSMs Coding Potential and Fickett’s statistics Fusion of Information Sensitivity and Specificity Prediction programs Known problems
    • Genes are all about Patterns – reallife example
    • Gene Prediction MethodsCommon sets of rules Homology Ab initio methods  Compositional information  Signal information
    • Pattern Recognition in GeneFinding atgttggacagactggacgcaagacgtgtggatgaactcgttttggagctgaac aaggctctatacgtacttaatcaagcggggcgtttgtggagcgagt tacttcacaaaaagctagccaatttgggttcaatgcagtgcctgaccgacatggg tatgtattagtaacgtttggaagaagaaactgttgtggttggtgt ttatgcagacaatctacaggtgactgcaacgaattcaactctcgtggacagttttt tcgttgatttacaggacctctcggtaaaggactatgaagaggtg acaaaattcttggggatgcgcatttcttatgcgcctgaaaatgggtatgattatat atcgagaagtgacaacccgggaaatgataaaggataa atggagaggatgctggagacggtcaagacgaccatcacccctgcgcaggcaatgaag ctgtttactgcacccaaagaacctcaagcgaacctggcccgag cacttcatgtacttggtggccatctcggaggcctgcggtggtacttagtcctgaataacg tcgtgccgtacgcgtccgcggatctacgaacggtcctgat agccaaagtggacggcacgcgtgtcgactacctacagcaagctgaggaactggcgca tttcgcgcaatcctgggagcttgaagcgcgcacgaagaacatt We need to study the basic structures of genes first ….!
    • Gene Structure – Common sets ofrules• Generally true: all long (> 300 bp) orfs in prokaryotic genomes encode genesBut this may not necessarily be true for eukaryotic genomes• Eukaryotic introns begin with GT and end with AG(donor and acceptor sites) – CT(A/G)A(C/T) 20-50 bases upstream of acceptor site.
    • Gene Structure Each coding region (exon or whole gene) has a fixed translation frame A coding region always sits inside an ORF of same reading frame All exons of a gene are on the same strand. Neighboring exons of a gene could have different reading frames . Exons need to be Frame consistent! GATGGGACGACAGATAAGGTGATAGATGGTAGGCAGCAG 0 3 6 9 12 01
    • Gene Structure – reading frame consistency  Neighboring exons of a gene should be frame-consistent Frame 0 Frame 2 GATGGGACGACAGATAGGTGATTAAGATGGTAGGCCGAGTGGTC 1 16 33 GATGGGACGACAGATAGGTGATTAAGATGGTAGGCCGAGTGGTC 1 16 40 Frame 0 Frame 2 Exon1 (1,16) -> Frame = a = 0 ; i = 1 and j = 16 Case1: Exon2 (33,100): Frame = b = 2; m = 33 and n = 100 Case2: Exon2 (40,100): Frame = b = 2; m = 40 and n =100 exon1 (i, j) in frame a and exon2 (m, n) in frame b are consistent if b = (m - j - 1 + a) mod 312/7/2012 …31,34,37,40,43,46,49,52…
    • Codon Frequencies  Coding sequences are translated into protein sequences  We found the following – the dimer frequency in protein sequences is NOT evenly distributed  Organism specific!!!!!!!!!!! The average frequency is ¼% (1/20 * 1/20 = 1/400 = ¼%) Some amino acids prefer to be next to each other Some other amino acids prefer to be not next to each other
    • ALA ARG ASN AS CYS GLU GLN GLY HIS ILE LEU LYS MET PHE PRO SER THR TRP TYR VAL PA .99 .5 .27 .45 .13 .52 .34 .51 .19 .38 .83 .46 .2 .31 .37 .73 .56 .09 .18 .65R .5 .5 .2 .3 .1 .4 .3 .4 .18 .25 .63 .37 .14 .22 .26 .54 .34 .08 .17 .46N .31 .19 .11 .2 .05 .23 .23 .26 .07 .13 .27 .16 .07 .11 .15 .24 .16 .04 .08 .27D .54 .32 .17 .47 .08 .51 .19 .42 .13 .25 .48 .26 .12 .20 .24 .40 .29 .06 .14 .5C .14 .11 .05 .09 .04 .09 .06 .13 .04 .08 .14 .08 .03 .06 .07 .14 .10 .02 .04 .13E .57 .43 .22 .42 .09 .59 .30 .33 .16 .28 .64 .40 .17 .20 .21 .44 .36 .06 .16 .44Q .34 .31 .11 .20 .06 .27 .29 .20 .12 .15 .45 .21 .10 .13 .17 .29 .22 .05 .10 .29G .50 .39 .22 .37 .11 .37 .21 .50 .16 .28 .50 .33 .14 .23 .21 .54 .35 .07 .17 .46H .21 .17 .07 .14 .04 .16 .10 .17 .08 .09 .22 .10 .05 .09 .12 .17 .11 .03 .06 .21I .37 .25 .13 .27 .08 .27 .15 .27 .09 .15 .34 .22 .08 .14 .18 .29 .21 .04 .11 .32L .79 .65 .30 .53 .16 .62 .45 .50 .25 .31 .97 .47 .19 .32 .44 .71 .49 .10 .22 .67K .43 .41 .19 .26 .08 .35 .24 .26 .14 .20 .49 .41 .13 .17 .20 .37 .32 .07 .15 .33M .23 .17 .09 .17 .04 .19 .12 .14 .06 .10 .25 .15 .07 .08 .11 .20 .17 .03 .06 .17F .30 .20 .11 .22 .07 .22 .13 .26 .08 .14 .33 .15 .08 .14 .14 .27 .18 .04 .10 .28P .35 .28 .13 .23 .05 .27 .16 .24 .10 .17 .39 .19 .10 .15 .26 .42 .29 .04 .09 .33S .68 .51 .26 .46 .14 .43 .26 .55 .17 .33 .68 .38 .18 .28 .36 .93 .55 .09 .17 .56T .51 .36 .19 .29 .10 .31 .21 .37 .12 .25 .52 .32 .13 .21 .31 .54 .42 .07 .13 .39W 0.07 .08 .05 .06 .02 .06 .05 .06 .03 .06 .12 .07 .03 .04 .04 .09 .07 .02 .03 .07Y .21 .16 .09 .15 .05 .16 .09 .17 .06 .10 .23 .11 .06 .10 .1 .17 .13 .03 .07 .2V .69 .42 .24 .46 .13 .48 .31 .42 .18 .29 .72 .37 .16 .27 .33 .55 .42 .07 .18 .61
    • Dicodon Frequencies Believe it or not – the biased (uneven) dimer frequencies are the foundation of many gene finding programs! Basic idea – if a dimer has lower than average dimer frequency; this means that proteins prefer not to have such dimers in its sequence; Hence if we see a dicodon encoding this dimer, we may want to bet against this dicodon being in a coding region!
    • Dicodon Frequencies - Examples  Relative frequencies of a di-codon in coding versus non-coding  frequency of dicodon X (e.g, AAAAAA) in coding region, total number of occurrences of X divided by total number of dicocon occurrences  frequency of dicodon X (e.g, AAAAAA) in noncoding region, total number of occurrences of X divided by total number of dicodon occurrences In human genome, frequency of dicodon “AAA AAA” is ~1% in coding region versus ~5% in non-coding region Question: if you see a region with many “AAA AAA”, would you guess it is a coding or non-coding region?
    • Basic idea of gene finding  Most dicodons show bias towards either coding or non-coding regions; only fraction of dicodons is neutral  Foundation for coding region identification Regions consisting of dicodons that mostly tend to be in coding regions are probably coding regions; otherwise non-coding regions  Dicodon frequencies are key signal used for coding region detection; all gene finding programs use this information
    • Prediction of Translation Starts Using PSSM Certain nucleotides prefer to be in certain position around start “ATG” and other nucleotides prefer not to be there 75,100, 75 ATG TCTAGAAGATGGCAGTGGCGAAGA A 0,0,0,100 ,0, TCTAGAAAATGACAGTGGCGAAGA T 100,0,100,0,0, 25, 0, 0 ATG TCTAGAAAATGGCAGTAGCGAAGA G 0, 0, 0, 0, 75 ,0, 0, 25 ATG TCTACT A AATGATAGTAGCGAAGA ATG C 0,100,0,0, 25 ,0, 0, 0 ATG A C G T -4 -3 -2 -1 +3 +4 +5 +6 CACC ATG GC TCGA ATG TT The “biased” nucleotide distribution is information! It is a basis for translation start prediction Question: which one is more probable to be a translation start?
    • Prediction of Translation Starts  Mathematical model: Fi (X): frequency of X (A, C, G, T) in position i  Score a string by log (Fi (X)/0.25) CACC ATG GC TCGA ATG TT log (58/25) + log (49/25) + log (40/25) + log (6/25) + log (6/25) + log (15/25) + log log (50/25) + log (43/25) + log (39/25) = (15/25) + log (13/25) + log (14/25) = 0.37 + 0.29 + 0.20 + 0.30 + 0.24 + 0.29 -(0.62 + 0.62 + 0.22 + 0.22 + 0.28 + 0.25) = 1.69 = -2.54 The model captures our intuition! A C G T12/7/2012
    • Evaluation of Gene prediction TP FP TN FN TPRealPredicted • Sensitivity = No. of Correct exons/No. of actual exons(Measurement of False negative) -> How many are discarded by mistake Sn = TP/TP+FN • Specificity = No. of Correct exons/No. of predicted exons(Measurement of False positive) -> How many are included by mistake Sp=TP/TP+FP • CC = Metric for combining both (TP*TN) – (FN*FP)/sqrt( (TP+FN)*(TN+FP)*(TP+FP)*(TN+FN) ) 12/7/2012
    • Challenges of Gene finder• Alternative splicing• Nested/overlapping genes• Extremely long/short genes• Extremely long introns• Non-canonical introns• Split start codons• UTR introns• Non-ATG triplet as the start codon• Polycistronic genes• Repeats/transposons
    • Known Gene Finders  GeneScan  GeneMarkHMM  Fgenesh  GlimmerHMM  GeneZilla  SNAP  PHAT  AUGUSTUS  Genie Ref: http://bioinf.uni-greifswald.de/augustus/submission