• Save
GENETICA
Upcoming SlideShare
Loading in...5
×
 
  • 16,964 views

TEMA PARA LA MATERIA DE BIOLOGIA I...COLEGIO AMERICANO DE SAN CARLOS...t/t

TEMA PARA LA MATERIA DE BIOLOGIA I...COLEGIO AMERICANO DE SAN CARLOS...t/t

Statistics

Views

Total Views
16,964
Views on SlideShare
7,493
Embed Views
9,471

Actions

Likes
14
Downloads
0
Comments
2

40 Embeds 9,471

http://nidiaesparza-ciencias.blogspot.mx 4311
http://nidiaesparza-ciencias.blogspot.com 2976
http://almamater.bligoo.es 1003
http://nidiaesparza-ciencias.blogspot.com.es 267
http://nidiaesparza-ciencias.blogspot.com.ar 242
http://cienciaenmiescuela280ms.blogspot.mx 135
http://cienciaenmiescuela280ms.blogspot.com 126
http://nidiaesparza-ciencias.blogspot.com.br 84
http://lasclasesdepocha.blogspot.com 84
http://distancia.upla.edu.pe 41
http://www.lasclasesdepocha.blogspot.com 38
http://nidiaesparza-ciencias.blogspot.pt 35
http://nidiaesparza-ciencias.blogspot.in 30
http://cienciaenmiescuela280ms.blogspot.com.es 27
http://www.nidiaesparza-ciencias.blogspot.mx 13
http://cienciaenmiescuela280ms.blogspot.com.ar 11
http://www.google.com.mx 5
http://nidiaesparza-ciencias.blogspot.co.uk 5
https://www.google.com 3
https://www.google.com.mx 3
http://131.253.14.98 3
http://nidiaesparza-ciencias.blogspot.jp 2
http://webcache.googleusercontent.com 2
http://us-w1.rockmelt.com 2
http://www.lasclasesdepocha.blogspot.com.es 2
http://nidiaesparza-ciencias.blogspot.no 2
http://www.slideshare.net 2
http://cienciaenmiescuela280ms.blogspot.pt 2
http://www.cienciaenmiescuela280ms.blogspot.mx 2
http://nidiaesparza-ciencias.blogspot.ca 2
http://nidiaesparza-ciencias.blogspot.se 2
http://www.almamater.bligoo.es 1
http://nidiaesparza-ciencias.blogspot.hk 1
http://nidiaesparza-ciencias.blogspot.ro 1
http://nidiaesparza-ciencias.blogspot.ch 1
http://nidiaesparza-ciencias.blogspot.fr 1
http://cienciaenmiescuela280ms.blogspot.in 1
http://cienciaenmiescuela280ms.blogspot.ch 1
http://www.lasclasesdepocha.blogspot.ae 1
http://nidiaesparza-ciencias.blogspot.de 1
More...

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

GENETICA Presentation Transcript

  • 1. Genética y herencia El “padre” de la Genética Este insecto ha sido muy utilizado en investigaciones genéticas. Representación de la Primera Ley de Mendel. El material genético se reparte a las células hijas durante la división celular. Drosophila melanogaster El asesoramiento médico puede prevenir la aparición de algunas enfermedades genéticas en los bebés de una pareja. Gregorio Mendel Cromosoma A.D.N.
  • 2. La herencia. Los caracteres hereditarios
    • Es posible que tú tengas los ojos marrones y tu hermana azules, o quizás seas más bajo o más alto que ella; puede que una vaca determinada produzca más leche que su hermana…
    • ¿Crees que la transmisión de algunas características de los progenitores a su descendencia es una propiedad de todos los seres vivos?
    • Y, si es así, ¿cómo se transmiten los caracteres hereditarios?.
    Reflexiona 1
  • 3. La herencia. Los caracteres hereditarios ¿Cómo explicas que no pueda nacer un bebé de un tomate? ¿Por qué los hermanos gemelos son físicamente idénticos? ¿Por qué una loba no puede parir gatitos? ¿Cómo explicas los parecidos dentro de una familia? Reflexiona 1
  • 4. La herencia. Los caracteres hereditarios ¿Sabes qué hay que hacer para que nazcan perros y gatos de razas tan diversas? Reflexiona 1
  • 5. La herencia. Los caracteres hereditarios El ADN de King coincidía con el encontrado en una colilla recogida en el escenario del crimen contra Rocío. El jurado declara a Tony King culpable del asesinato de Rocío Wanninkhof ¿Sabes qué es el A.D.N.? 1
  • 6. La herencia. Los caracteres hereditarios ¿Sabes qué es el A.D.N.? 1
  • 7. ¿Qué crees que puede ser el “código del genoma humano”? ¿Has oído hablar de la “Ingeniería Genética”? (la foto del gallo es falsa, se trata de un montaje) Pero… ¿has pensado alguna vez por qué un animal no crece más de un cierto tamaño? Crean una vaca enana para que podamos consumir leche recién ordeñada. Recomiendan no guardar en la nevera al pobre animal. Prestigiosos biólogos sospechan que el campeón mundial de peleas de gallos se obtuvo haciendo trampa, por Ingeniería Genética.
  • 8. La herencia. Los caracteres hereditarios Noooooo, no te descargamos de Internet, tú naciste... 1
  • 9. La herencia. Los caracteres hereditarios Todos los seres vivos tienen características que se pueden transmitir de padres a hijos. La genética es la ciencia que estudia los componentes hereditarios que producen variabilidad entre los seres vivos, esto es, la herencia. Como sabes, tanto las plantas como los animales están formados por células. En el núcleo de todas las células se encuentran los cromosomas , que son los encargados de transmitir los caracteres. Aunque no conocía el microscopio ni los cromosomas, realizó los primeros descubrimientos genéticos, fundando las bases de la Genética. Célula en reposo (sin dividirse) Célula en división Los cromosomas se ven al microscopio cuando la célula está dividiéndose Núcleo Cromatina Nucleolo Gregorio Mendel 1
  • 10. Agua y sustancias disueltas. En él se encuentran los ORGÁNULOS Membrana celular Citoplasma Núcleo Dirige la actividad celular porque contiene “las instrucciones”: el ADN o material genético Regula el intercambio de sustancias Un repaso a la estructura celular La célula constituye la unidad estructural y funcional básica de los seres vivos, ya que es capaz de realizar por sí misma las tres funciones vitales: Nutrición, Relación y Reproducción. Célula eucariota
  • 11. Un repaso a la estructura celular Las células eucariotas están constituidas por tres estructuras básicas: la membrana plasmática, el citoplasma y el núcleo. Membrana plasmática . Es la capa exterior que aísla y protege a la célula del medio que la rodea, regulando el intercambio de sustancias con él. Citoplasma . Es una sustancia viscosa en la que se encuentran los orgánulos celulares responsables de las diferentes funciones de la célula, como la respiración celular, el almacenamiento y el transporte de proteínas, etcétera. Núcleo celular . Es el orgánulo responsable de controlar las funciones celulares. En su interior se encuentra el material genético o ADN (*), que contiene toda la información relacionada con la organización y funcionamiento celulares. El ADN que está unido a proteínas recibe el nombre de cromatina y se encuentra repartido de forma difusa por todo el núcleo, constituyendo una masa de aspecto filamentoso. Al iniciarse la división celular, la cromatina adquiere una estructura definida y da lugar a los cromosomas. Membrana Citoplasma Núcleo (*) ADN: ácido desoxirribonucleico, molécula orgánica portadora de la información genética
  • 12. Es una fina capa que constituye el límite de la célula, separándola del medio externo. Su función es proteger la célula regulando el intercambio de sustancias que entran y salen a través de ella. Entrada y salida de sustancias Algunas sustancias tienen “permiso” para entrar. Otras para salir. Algunas no entran ni salen, o lo harán dependiendo de las circunstancias del momento. La membrana
  • 13. Célula eucariota animal Membrana Citoplasma Núcleo Retículo Endoplasmático Aparato de Golgi Ribosomas Mitocondrias Vacuola Lisosoma Citocentro Ya vimos en 3º de E.S.O. que el citoplasma contiene varios tipos de orgánulos, cada uno de ellos con una estructura y función determinada.
  • 14. El núcleo celular Núcleo Ampliación del núcleo El núcleo dirige toda la actividad de la célula porque contiene las “instrucciones” o el “programa” de ésta. Esta información con las “instrucciones” se almacena en una molécula llamada ADN (ácido desoxirribonucleico), que está unida a proteínas formando una masa filamentosa llamada CROMATINA. Célula eucariota (*) (*) Como vimos en 3º de E.S.O., las células eucariotas son más evolucionadas, más complejas, con varios tipos de orgánulos, con el material genético envuelto por una membrana nuclear: tienen un verdadero núcleo. Son eucariotas las células de todos los seres vivos menos las bacterias.
  • 15. Tú comenzaste siendo una célula, luego dos, luego cuatro… ¿Cuántas células crees que tienes ahora? 2 células 4 células 8 células
  • 16. ¡50.000 mil millones! ¡Es el número de células que tiene tu organismo! Células Células Células Células Células Células de la sangre Glóbulos blancos Glóbulos rojos Músculo Capa grasa del abdomen Esófago Cartílago Hueso
  • 17. Los cromosomas y los genes Los cromosomas son cadenas de ADN superenrolladas, compuestas por moléculas unidas como las cuentas de un collar. Cada cierto número de cuentas constituye un gen, es decir, un determinado trozo de ADN. Los genes portan la información que permitirá crear un nuevo organismo y la transmiten mediante un código químico. Existen genes para el tamaño, el color, la forma, etc. Cada cromosoma contiene numerosos genes. 2
  • 18. Los cromosomas y los genes Un gen es un fragmento de ADN que lleva la información para un carácter hereditario. El conjunto de genes que determina todos los caracteres hereditarios de una especie recibe el nombre de genoma . Clic aquí para ver un vídeo sobre el ADN y la Genética 2
  • 19. En el ADN están impresas las instrucciones que necesita un ser vivo para nacer y reproducirse.
  • 20. Los cromosomas pueden compararse con un lápiz de memoria, un CD o cualquier otro soporte físico de almacenamiento de datos informáticos. Los datos o archivos (la información), podrían compararse con los genes. Al igual que en un CD o lápiz de memoria caben muchos datos, en los cromosomas hay muchísima información (se calcula que hay unos 100.000 genes en la especie humana).
    • No puede haber datos si no hay un soporte físico.
    • No puede haber genes si no hay ADN.
    • El ADN de los cromosomas es el soporte físico de los genes.
    Shakira.mp3 ……………… Gen responsable del color de ojos Bisbal.mp3 ……………… Gen responsable del color del pelo Foto001.jpg ……………... Gen responsable de la forma de la oreja Cromosoma Archivos Genes Comparación: A.D.N.
  • 21. En nuestra lengua, podemos escribir innumerables palabras, frases, libros… Para ello necesitamos las 28 letras del abecedario: A B C D E F G H … H O L A En el lenguaje genético, con cuatro “letras” se construyen innumerables genes ATTCCGGATCCTAGGCTATA….. Gen color ojos En el lenguaje informático, un archivo es una sucesión de ceros y unos 001010100010101011101000… Shakira.mp3 Ordenando letras construimos palabras Las cuatro “letras del abecedario genético”
  • 22. Si tuviésemos la información contenida en el ADN de los dinosaurios, podríamos –al menos en teoría- hacer “resucitar” a estas especies de reptiles extinguidos.
  • 23. Pero dejémonos ahora de dinosaurios y volvamos a los cromosomas. Célula en reposo (sin dividirse) Célula en división Los cromosomas se ven al microscopio cuando la célula entra en división Núcleo Cromatina Nucleolo Esta fotografía muestra, al microscopio, células de la epidermis de cebolla en división. Los cuerpos oscuros son los cromosomas.
  • 24. Cuando la célula va a comenzar la división, la cromatina se individualiza y adquiere una forma condensada parecida a un bastón. Núcleo Cromatina Nucleolo La cromatina es como un largo hilo de lana Cromosoma Condensación e individualización de la cromatina Un cromosoma es como un ovillo Este punto es el centrómero Puede transportarse mucho mejor un ovillo de lana que la misma cantidad de lana suelta. Del mismo modo, es mucho mejor para la célula repartir el material genético a las células hijas si la cromatina se ha condensado en cromosomas.
  • 25. Duplicación Cada una de las copias es una cromátida Cromátida 1 Cromátida 2 centrómero Cuando la célula va a comenzar la división, el material genético produce una copia exacta de sí mismo, por lo que en vez de un filamento, contiene dos, llamados cromátidas, que están unidos por el centrómero. En la división celular, el material genético (ADN) se reparte por igual entre las células hijas. Para ello es necesario que, previamente, se halla producido la duplicación de este ADN. División celular . Las células hijas necesitan heredar la información genética de la célula madre. Animación realizada con fotos reales
  • 26. Veamos más cosas importantes que debes saber sobre los cromosomas: En casi todas las células, los cromosomas se observan siempre en parejas . Los dos cromosomas de una pareja reciben el hombre de homólogos . Pareja de homólogos 1 Pareja de homólogos 2
    • El número de parejas de homólogos es siempre el mismo en todas las células de una especie. Por ejemplo:
    • Los seres humanos tenemos 23 parejas (en total: 46 cromosomas)
    • La mosca del vinagre tiene sólo 4 parejas (en total: 8 cromosomas)
    Drosophila melanogaster (mosca del vinagre)
  • 27. Veamos más cosas importantes que debes saber sobre los cromosomas: En casi todas las células, los cromosomas se observan siempre en parejas . Los dos cromosomas de una pareja reciben el hombre de homólogos . Pareja de homólogos 1 Pareja de homólogos 2 Metacéntrico Submetacéntrico Acrocéntrico Es posible ordenar los cromosomas por parejas, ya que los homólogos tienen exactamente la misma forma y el mismo tamaño. Aquí puedes ver los nombres de los tipos de cromosomas según la posición que ocupa el centrómero. Tipos de cromosomas
  • 28. El conjunto de características de los cromosomas de la célula de una especie constituyen el CARIOTIPO . Cuando se ordenan por parejas en un gráfico, este recibe el nombre de CARIOGRAMA Cariotipo humano. En total hay 23 parejas de homólogos. Suele expresarse como 2n = 46 ( n = 23 ) 23 parejas de cromosomas Cromosomas sexuales
  • 29. ¿Cómo se heredan los cromosomas? Normalmente (*), cada célula de nuestro cuerpo tiene un total de 46 cromosomas, o 23 pares. Heredamos la mitad de los cromosomas (un miembro de cada par) de nuestra madre biológica y la otra mitad (el miembro homólogo de cada par) de nuestro padre biológico. Los científicos han enumerado los pares de cromosomas de 1 a 22, habiéndole dado al par 23 el nombre de X o Y, según la estructura. Los primeros 22 pares de cromosomas se llaman " autosomas ". Los cromosomas del par 23 se conocen como los " cromosomas sexuales " porque determinan si el bebé será varón o mujer. Las mujeres tienen dos cromosomas "X" y los hombres tienen un cromosoma "X" y un cromosoma "Y". La representación gráfica de los 46 cromosomas, ordenados en pares, recibe el nombre de cariotipo. El cariotipo normal de la mujer se escribe 46, XX , mientras que el cariotipo normal del hombre se escribe 46, XY . (*) La excepción son los gametos (espermatozoides y óvulos), que tienen la mitad (n) de cromosomas (un cromosoma de cada pareja de homólogos) óvulo espermatozoides 2n n n 2n Célula huevo o cigoto
  • 30. LA HERENCIA DEL SEXO Como ya sabemos el sexo en la especie humana está determinado por los cromosomas sexuales X e Y. Las mujeres son homogaméticas (XX) y los hombres heterogaméticos (XY). Si en el momento de la concepción se unen un óvulo X con un espermatozoide X, el zigoto dará una mujer. Si se unen un óvulo X con un espermatozoide Y, dará una hombre. ♂ Hombre ♀ Mujer XX XY X X Y XX XY (i+5)
  • 31. 2n Las células con 2n cromosomas se dice que son DIPLOIDES Las células con n cromosomas se dice que son HAPLOIDES (del griego diplo = doble ; haplos = simple) Cada una de tus células es diploide (2n) desde que fuiste un cigoto. Fíjate que debe existir un mecanismo por el cual se reduzca a la mitad el número de cromosomas para formar óvulos o espermatozoides. Después veremos que este mecanismo se llama MEIOSIS ( del griego meios = mitad ) n n 2n Célula huevo o cigoto 2n 2n
  • 32. Reproducción celular En las células procariotas (*) se produce la división simple por bipartición : el ADN de la bacteria se duplica y forma dos copias idénticas. Cada copia se va a un punto de la célula y más tarde la célula se divide en dos mitades. Así se forman dos células hijas iguales, más pequeñas que la progenitora. Mediante el proceso de reproducción, las células dan lugar a nuevas células. En los organismos unicelulares, la reproducción coincide con la creación de un nuevo ser; en los pluricelulares, las nuevas células forman parte de los diferentes tejidos para sustituir a las que mueren o para crecer. (*) Como vimos en 3º de E.S.O., hay dos tipos de células: procariotas y eucariotas. Las procariotas son más primitivas, más sencillas, con muy pocos orgánulos, con el material genético disperso en el citoplasma, no envuelto por una membrana nuclear: no tienen un verdadero núcleo. Son las bacterias. Células hijas formándose Material genético División bacteriana. 3
  • 33. Reproducción celular En las células eucariotas (*), se diferencian dos procesos en la reproducción celular: la división del núcleo y la división del citoplasma. (*) Como vimos en 3º de E.S.O., las células eucariotas son más evolucionadas, más complejas, con varios tipos de orgánulos, con el material genético envuelto por una membrana nuclear: tienen un verdadero núcleo. Son eucariotas las células de todos los seres vivos menos las bacterias. 3
  • 34. Reproducción celular En las células eucariotas hay dos tipos de división celular: mitosis y meiosis. Célula madre Células hijas MITOSIS MEIOSIS 2n 2n 2n 2n n n n n Cuando una célula se divide por mitosis, las células hijas son idénticas a la célula madre. Cuando la división es por meiosis, se reduce a la mitad el número de cromosomas. diploides haploides Por meiosis se dividen las células germinales (madres) de los espermatozoides (situadas en los testículos) y las células germinales (madres) de los óvulos (en los ovarios). Las células hijas, los gametos, son haploides (n). (*) Células somáticas: células que constituyen el organismo, excepto las sexuales. El cuerpo crece porque las células somáticas (*) se dividen por mitosis. En un adulto la mitosis hace posible la regeneración de las células muertas. Célula madre Células hijas 3
  • 35. Reproducción celular Cuando los organismos crecen o reparan tejidos dañados, forman nuevas células mediante el proceso de división celular llamado mitosis. 3.1.- La mitosis Para que pueda darse la división nuclear es necesario que se de previamente otro proceso, que es la replicación o autoduplicación del ADN . Observa el dibujo durante un buen rato. Se trata de una animación que, tras acabar (células hijas), vuelve a empezar (célula madre), formando un ciclo. Del mismo modo, la vida de una célula real es un ciclo . Fíjate que las dos cromátidas de un cromosoma terminan separándose y repartiéndose a las células hijas La autoduplicación del ADN ocurre al final etapa del ciclo celular llamada interfase . 3
  • 36. 3.1.- La mitosis La mitosis no es una reproducción en sí misma, sino que es un proceso de división nuclear que sirve para repartir las cadenas de ADN de forma que todas las células hijas que se originan tengan la MISMA INFORMACIÓN GENÉTICA que su madre y entre ellas. La mitosis es continua, sin interrupciones, relativamente rápida, que para ser estudiada se suele dividir en varias fases, que son la PROFASE, la METAFASE, la ANAFASE y la TELOFASE. DIVISIÓN NUCLEAR (CARIOCINESIS) Animación de la mitosis
  • 37. Comienza con la conversión de la CROMATINA en CROMOSOMAS (1) por un proceso de espiralización de las cadenas (igual que si tenemos un alambre largo y lo convertimos en un muelle), seguiremos teniendo lo mismo, pero de forma diferente: las dos cadenas que son completamente idénticas (ya que una se ha formado por replicación de la otra) se espiralizan juntas originando las cromátidas del cromosoma. Se duplican los centríolos (2). La membrana nuclear desaparece (3). Cuando ya ha desaparecido la membrana nuclear, los centríolos migran hacia los polos (extremos) de la célula (4), apareciendo entre los dos pares de centríolos una serie de fibras de proteína dispuestas de polo a polo que reciben el nombre en conjunto de HUSO ACROMÁTICO (5). Los cromosomas ya formados se mueven y se unen a una fibra del huso por su centrómero (un sólo cromosoma por fibra) (6), de manera que las cromátidas miran hacia los polos de la célula. Cuando se han unido se van moviendo hasta situarse en el centro de la célula. En la célula vegetal no existen centríolos y a veces no se ve el huso acromático. 3.1.- La mitosis PROFASE
  • 38. 3.1.- La mitosis Es una fase breve en la que todos los cromosomas se encuentran situados en el ecuador (parte media) de la célula, formando una figura muy característica llamada PLACA ECUATORIAL (1). Tras colocarse aquí comienza la siguiente fase. METAFASE
  • 39. 3.1.- La mitosis Las cromátidas se separan y se desplazan hacia los centríolos, al tiempo que van desapareciendo las fibras del huso. En este momento ya se ha repartido el material hereditario (las cadenas de ADN) de forma idéntica en dos partes. ANAFASE
  • 40. 3.1.- La mitosis Es como una profase al revés, los cromosomas se desespiralizan y se transforman en cromatina (2); aparece la membrana nuclear (1), quedando una célula con dos núcleos. Aquí concluye la mitosis propiamente dicha. TELOFASE
  • 41. 3.1.- La mitosis No es una fase de la mitosis . Es la división del citoplasma en dos partes, con la repartición aproximada de los orgánulos celulares. En las células animales se hace por estrangulación, desde fuera hacia adentro, y en las vegetales se hace por crecimiento de la pared celular desde dentro hacia afuera. El resultado final es que la célula madre se ha transformado en dos células hijas idénticas genéticamente. DIVISIÓN CITOPLASMÁTICA (CITOCINESIS)
  • 42. 3.2.- La meiosis MEIOSIS 2n n n n n haploides Por meiosis se dividen las células germinales (madres) de los espermatozoides (situadas en los testículos) y las células germinales (madres) de los óvulos (en los ovarios). Las células hijas, los gametos, son haploides (n). Célula madre Células hijas Cuando la división es por meiosis, se reduce a la mitad el número de cromosomas. Recuerda que ya hemos visto que: Debe existir un mecanismo por el cual se reduzca a la mitad el número de cromosomas para formar óvulos o espermatozoides. Este mecanismo es la MEIOSIS ( del griego meios = mitad ) 2n 2n 2n 2n n n
  • 43. 3.2.- La meiosis Tampoco es una reproducción en sí misma, sino que es un proceso de división nuclear que utiliza los mismos mecanismos que la mitosis, por lo que es bastante parecida, aunque su significado biológico es diferente ya que es reducir a la mitad el número de cromosomas para que no se duplique el número de la especie tras la fecundación (= fusión de gametos). La meiosis es en realidad una doble división (de las cuales la segunda es como una mitosis normal) que se da exclusivamente en células diploides. El proceso comienza igual que la mitosis, es decir, con una replicación previa de todas las cadenas de ADN al final de la interfase, de manera que al comenzar la división tenemos doble número de cadenas; tras la duplicación comienza la meiosis. Animación de la meiosis Primera división Segunda división 2n n n n n Como hay dos divisiones, se forman cuatro células hijas, que son haploides (n) Célula madre
  • 44. 3.2.- La meiosis DIVISIÓN I PROFASE I Es similar a la de mitosis en cuanto a que es una fase de preparación: - desaparece la membrana nuclear (3) - se espiralizan las cadenas de ADN, apareciendo los cromosomas (1) - se duplican los centríolos (2) y migran a los polos (4) - se forma el huso acromático (6) - cada par de cromosomas se une a una fibra del huso (5) 
  • 45. 3.2.- La meiosis DIVISIÓN I PROFASE I Hasta aquí sucede como en una profase mitótica normal. Las diferencias con la profase normal se dan en el comportamiento de los cromosomas, ya que éstos antes de unirse a las fibras del huso se van moviendo y se agrupan por parejas de manera que los cromosomas que son iguales (CROMOSOMAS HOMÓLOGOS) quedan formando pares unidos cromátida contra cromátida; esta unión va a permitir que se lleve a cabo el proceso más importante de la reproducción sexual ya que es el que permite que las generaciones filiales sean diferentes a las parentales, es la RECOMBINACIÓN GENÉTICA, que consiste en que las cromátidas de los cromosomas homólogos que quedan juntas se intercambian trozos de sus cadenas de ADN, apareciendo cromátidas nuevas que antes no existían, las cromátidas recombinadas, que darán lugar a la aparición de individuos adultos nuevos que tampoco existían anteriormente. Animación de la recombinación genética Una vez realizada la recombinación en todos los cromosomas cada par de homólogos se une a una fibra del huso (5), es decir, se colocan dos cromosomas por cada fibra del huso acromático , en lugar de un cromosoma por fibra como sucedía en la mitosis; luego los pares se desplazan para colocarse en el centro de la célula.
  • 46. 3.2.- La meiosis DIVISIÓN I METAFASE I Los pares de cromosomas homólogos se sitúan en la parte media de la célula formando la placa ecuatorial (1). ANAFASE I Se produce la separación y migración de los cromosomas homólogos, por lo que a diferencia de lo que sucedía en la mitosis, los que se desplazan son cromosomas enteros en lugar de cromátidas. Al final de la anafase I tenemos dos juegos de cromosomas separados en los polos opuestos de la célula, uno de cada par, por lo que es en esta fase cuando se reduce a la mitad el número de cromosomas.
  • 47. 3.2.- La meiosis DIVISIÓN I TELOFASE I Como en la telofase normal, se puede regenerar nuevamente el núcleo (1), iniciándose inmediatamente la División II CITOCINESIS I La célula binucleada divide su citoplasma en dos, quedando dos células hijas que van a entrar en la segunda división meiótica. Animación de la división I
  • 48. 3.2.- La meiosis DIVISIÓN II Es como una mitosis normal que se da simultáneamente en las dos células hijas; en profase II se unen cromosomas individuales a las fibras del huso y en anafase II se separan cromátidas; al final de la citocinesis II tendremos cuatro células hijas que tendrán cada una la mitad de las cadenas de ADN que tenían en la interfase; serán por tanto células haploides cuya función será la de intervenir en la fecundación, es decir, serán gametos. En las células vegetales la meiosis es similar pero con las mismas diferencias que en la mitosis normal Animación de la meiosis Primera división Segunda división 2n n n n n Como hay dos divisiones, se forman cuatro células hijas, que son haploides (n) Célula madre Recuerda:
  • 49. LA MEIOSIS Las células reproductoras se producen mediante un proceso llamado meiosis que reduce a la mitad el número de cromosomas. En este proceso sólo va a cada célula reproductora uno de los cromosomas de cada par de homólogos. Esta es la razón por la que los gametos son haploides en lugar de diploides. La meiosis
  • 50. La mitosis y la meiosis Mitosis Meiosis Compara con estas animaciones las semejanzas y diferencias entre mitosis y meiosis: Partimos de una célula con 3 parejas de cromosomas 1 y 2 representan los miembros de una pareja de cromosomas homólogos. Cada pareja está representada con el mismo color.
  • 51. Cromosomas homólogos y genes alelos Heredamos de nuestros progenitores dos juegos de cromosomas, uno procedente del padre, y otro, de la madre. Todas las células somáticas del ser humano tienen 23 pares de cromosomas. Cada par contiene uno de los caracteres, una pareja de genes en posiciones análogas (*), aunque no necesariamente con las misma información. Esos dos genes portadores de la información para el mismo carácter se denominan alelos , y la pareja de cromosomas se conoce como par de cromosomas homólogos. Cromosoma procedente del padre Cromosoma procedente de la madre Par de cromosomas homólogos Los ALELOS son formas alternativas del mismo gen que ocupan una posición idéntica en los cromosomas homólogos y controlan los mismos caracteres (pero no necesariamente llevan la misma información) (*) Análoga: semejante; se aplica a genes que ocupan una misma posición en el cromosoma. 4
  • 52. Cromosomas homólogos y genes alelos Los genes trabajan por parejas, ya que para un mismo carácter (por ejemplo color de ojos) hay dos alelos que se encargan de ello. Alelo A procedente del padre Alelo a procedente de la madre Cromosoma procedente del padre Cromosoma procedente de la madre Par de cromosomas homólogos Gen responsable del carácter “color de los ojos” Si lo piensas, sólo podrá haber tres tipos de personas: AA, Aa y aa AA aa Aa Los individuos con el mismo tipo de alelo se denominan HOMOCIGOTOS para ese carácter Los individuos con los dos alelos diferentes se denominas HETEROCIGOTOS para ese carácter 4
  • 53. 4.1.- ¿Qué genes se manifiestan? El conjunto de genes de un individuo es su genotipo . Aunque haya al menos dos genes (dos alelos) para cada carácter, no siempre se manifiestan los dos, ya que unos genes son dominantes y otros son recesivos (*). Cuando hay genes dominantes, los recesivos no se manifiestan. Así, una persona que tenga genes para el color de pelo negro, procedentes del padre, y para el color rubio, procedentes de la madre, será morena, ya que el gen dominante es el del color de pelo negro. (*) recesivo: alelo que no se manifiesta cuando hay otro dominante. Para que se manifieste un carácter recesivo, el gen para ese carácter tiene que estar presente en los dos cromosomas.
  • 54. 4.1.- ¿Qué genes se manifiestan? El conjunto de genes de un individuo es su genotipo . El aspecto que un individuo presenta es su fenotipo . Homocigoto AA Heterocigoto Aa Homocigoto aa Genotipos Fenotipos Ojos marrones Ojos azules Como A domina sobre a , sólo tendrán fenotipo ojos azules los individuos con genotipo aa A A A a a a
  • 55. 4.1.- ¿Qué genes se manifiestan? El conjunto de genes de un individuo es su genotipo . El aspecto que un individuo presenta es su fenotipo . Pero… ¿crees que el aspecto o fenotipo de una persona depende sólo de sus genes?
  • 56. 4.1.- ¿Qué genes se manifiestan? El ambiente puede influir en la manifestación de los genes, de manera que un mismo carácter genético puede presentarse de diversas formas. El ambiente de un gen lo constituyen los otros genes, el citoplasma celular y el medio externo donde se desarrolla el individuo. La altura es un factor genético sobre el que ejerce una gran influencia el ambiente externo al individuo, ya que, dependiendo de la alimentación, el sol, las vitaminas, etc., este será más o menos alto. La obesidad de este chico no depende de sus genes. Simplemente, ingiere demasiadas calorías y no practica el suficiente ejercicio físico. ¿Tu salud depende sólo de los genes que has heredado?
  • 57. 4.1.- ¿Qué genes se manifiestan? Fenotipo pelo moreno; genotipo MM o Mn Fenotipo pelo rubio; genotipo mm El alelo dominante se representa con letra mayúscula. La misma letra, pero en minúscula, se emplea para el alelo recesivo
  • 58. 4.2.- ¿Cómo se transmiten los genes? MEIOSIS MEIOSIS Madre Padre Si la madre es Aa , la mitad de los óvulos que produzca serán A y la otra mitad a Si el padre es Aa , la mitad de los espermatozoides que produzca serán A y la otra mitad a Así son los gametos Así son las células madre de los gametos Durante la meiosis se separan las parejas de cromosomas homólogos
  • 59. 4.2.- ¿Cómo se transmiten los genes? MEIOSIS MEIOSIS Madre Padre Así son los gametos Así son las células madre de los gametos Aa Aa A a A a AA Aa Aa aa Durante la meiosis se separan los alelos Así son los hijos Este diagrama hace todas las combinaciones posibles entre los óvulos de la madre y los espermatozoides del padre Puede nacer un niño de ojos azules, de padres de ojos marrones, si se encuentra un óvulo a con un espermatozoide a
  • 60. 4.2.- ¿Cómo se transmiten los genes? Puede nacer un niño de ojos azules, de padres de ojos marrones, si se combina un óvulo a con un espermatozoide a A A a A AA Aa Aa aa Esta es otra forma de representar las combinaciones posibles entre los gametos masculinos y los femeninos: Cuadro de Punnett
  • 61. 4.2.- ¿Cómo se transmiten los genes? A: alelo dominante; se pone en mayúscula a: alelo recesivo; se escribe en minúscula A > a Cuando el alelo de un gen (por ejemplo A ) domina sobre otro alelo del mismo gen (por ejemplo a ) se expresa así: Se pone el signo matemático “mayor que”, que aquí significa “ domina sobre ” En estos casos se habla de DOMINANCIA
  • 62. 4.3.- Codominancia Como ves, en este caso R no domina sobre r Veamos un ejemplo: RR rr Rr Puede suceder que los dos alelos de un determinado carácter sean equipotentes, es decir, que ninguno domine sobre el otro. En este caso, los individuos heterocigotos o híbridos, portadores de ambos alelos, tendrán características intermedias o manifestarán las dos. Se habla entonces de CODOMINANCIA .
    • En la especie Mirabilis jalapa (dondiego de noche), hay tres fenotipos posibles para el color de la flor:
    • Flor roja. Genotipo RR
    • Flor blanca. Genotipo rr
    • Flor rosa. Genotipo Rr
  • 63. Mendel y las leyes de la herencia Gregorio Mendel (1822 - 1884). En su juventud Mendel tuvo una intensa formación práctica en el cultivo de la mayoría de las especies vegetales de consumo cotidiano. Como monje agustino tuvo oportunidad de estudiar botánica, matemática y química en la Universidad de Viena. A mediados del siglo XIX propuso la primera explicación científica en relación al modo en que se transfieren los caracteres hereditarios entre padres e hijos, la que hoy se conoce como las Leyes de Mendel 5
  • 64. Mendel y las leyes de la herencia El éxito científico de los experimentos realizados por Mendel en la huerta del monasterio de la que hoy es la ciudad de Brno en la República Checa, radica en el material biológico elegido, es decir, la capacidad de auto polinizarse de las flores de la planta del guisante y la sencilla identificación de sus caracteres; en la metodología empleada en la planificación de sus experimentos, es decir, en la aplicación del método científico y en la aplicación de las leyes de las probabilidades. 5
  • 65. [Esquema que muestra las etapas del Método Científico como se le conoce hoy y como fuera aplicado por Mendel en la realización de sus ensayos experimentales]
  • 66. Mendel y las leyes de la herencia
    • EXPERIMENTOS DE MENDEL
    • Mendel publicó sus experimentos con guisantes en 1865 y 1866. Los principales motivos por los que Mendel eligió el guisante como material de trabajo fueron los siguientes:
    • Material: Pisum sativum (guisante).
    • Los guisantes eran baratos y fáciles de obtener en el mercado.
    • Ocupaban poco espacio y tenían un tiempo de generación relativamente corto.
    • Producían muchos descendientes.
    • Existían variedades diferentes que mostraban distinto, color, forma, tamaño, etc. Por tanto, presentaba Variabilidad Genética.
    • Es una especie Autógama , se autopoliniza, de manera que el polen de las anteras de una flor cae sobre el estigma de la misma flor.
    • Era fácil realizar cruzamientos entre distintas variedades a voluntad. Es posible evitar o prevenir la autopolinización castrando las flores de una planta (eliminando las anteras).
    5
  • 67. Aquí puedes ver en detalle una flor de la planta del guisante cortada en parte para ver su interior. Estambres (parte masculina de la flor). En el extremo de cada estambre está la antera, que produce el polen. El conjunto de estambres recibe el nombre de androceo. Estilo Ovario El ovario, el estilo y el estigma constituyen el gineceo o pistilo, parte femenina de la flor.
  • 68. No te líes con los nombres: El ovario contiene en su interior los óvulos. Tras la polinización, cada óvulo dará lugar a una semilla: un guisante. (El conjunto de estambres de una flor constituye el Androceo) (Gineceo) Fruto (tipo legumbre) Semillas
  • 69. En el guisante era fácil realizar cruzamientos entre distintas variedades a voluntad. Es posible evitar o prevenir la autopolinización castrando las flores de una planta (eliminando las anteras). Se quitan las anteras
  • 70. Mendel y las leyes de la herencia
    • Los principales aciertos de Mendel fueron los siguientes:
    • Utilizar en sus experimentos una especia autógama, ya que de esta manera se aseguraba de que las variedades que manejaba eran Líneas puras, constituidas por individuos idénticos y homocigóticos.
    • Elegir caracteres cualitativos fácilmente discernibles en sus alternativas. Por ejemplo, flores color blanco o púrpura.
    • Iniciar los experimentos fijándose cada vez en un sólo carácter. De está manera obtenía proporciones numéricas fáciles de identificar.
    • Utilizar relaciones estadísticas en varias generaciones sucesivas. Contar el número de individuos de cada tipo en las sucesivas generaciones y proponer proporciones sencillas.
    • Llevar a cabo experimentos control y cruzamientos adicionales (retrocruzamientos) para comprobar sus hipótesis.
    • Analizar caracteres independientes para demostrar su principio de la combinación independiente.
    5
  • 71. Mendel y las leyes de la herencia
    • Mendel estudió los siguientes siete caracteres en guisante:
    • Forma de la semilla: lisa o rugosa
    • Color de la semilla: amarillo o verde.
    • Color de la Flor: púrpura o blanco.
    • Forma de las legumbres: lisa o estrangulada.
    • Color de las legumbres maduras: verde o amarillo.
    • Posición de las flores: axial o terminal.
    • Talla de las plantas: normal o enana.
    5
  • 72. La primera ley de Mendel: . Ley de la uniformidad de los híbridos de la primera generación: Cuando se cruzan dos variedades individuos de raza pura ambos (homocigotos ) para un determinado carácter, todos los híbridos de la primera generación son iguales. Mendel llegó a esta conclusión al cruzar variedades puras de guisantes amarillas y verdes pues siempre obtenía de este cruzamiento variedades de guisante amarillas. X AA aa A a Aa P F 1 P : Generación Parental (padres) F 1 : Primera Generación Filial El signo x significa “cruzamiento con” Gametos
  • 73. La segunda ley de Mendel: . Ley de la separación o disyunción de los alelos. Mendel tomó plantas procedentes de las semillas de la primera generación (F 1 ) del experimento anterior, amarillas Aa, y las polinizó entre sí. Del cruce obtuvo semillas amarillas y verdes en la proporción 3:1 (75% amarillas y 25% verdes). Así pues, aunque el alelo que determina la coloración verde de las semillas parecía haber desaparecido en la primera generación filial, vuelve a manifestarse en esta segunda generación. Aa X AA Aa Aa aa P F 1 F 2 Gametos Aa A a A a A A a a
  • 74. La Tercera Ley de Mendel: . Ley de la independencia de los caracteres no antagónicos. Mendel se planteó cómo se heredarían dos caracteres. Para ello cruzó guisantes amarillos lisos con guisantes verdes rugosos. En la primera generación obtuvo guisantes amarillos lisos. X AABB aabb AB ab AaBb P F1 Gametos
  • 75. La Tercera Ley de Mendel: . Ley de la independencia de los caracteres no antagónicos. Al cruzar los guisantes amarillos lisos obtenidos dieron la siguiente segregación: 9 amarillos lisos 3 verdes lisos 3 amarillos rugosos 1 verde rugoso. De esta manera demostró que los caracteres color y textura eran independientes. AaBb X AB Ab aB ab AB Ab aB ab AaBb Gametos aabb aaBb Aabb AaBb ab aaBb aaBB AaBb AaBB aB Aabb AaBb AAbb AABb Ab AaBb AaBB AABb AABB AB ab aB Ab AB
  • 76. Teoría cromosómica de la herencia Cuando Mendel realizó sus experimentos, no se conocía la existencia de la molécula de ADN ni, por tanto, que esta se encontrara en los cromosomas. En 1902, W.S. Sutton y T. Boveri observaron que había un paralelismo entre la herencia de los factores hereditarios y el comportamiento de los cromosomas durante la meiosis y la fecundación, por lo que dedujeron que los factores hereditarios se encontraban en los cromosomas . Walter Stanborough Sutton Theodor Boveri Estos dos genetistas vivían en países diferentes (Sutton en Estados Unidos y Boveri en Alemania) y trabajaron independientemente, pero descubrieron lo mismo en el mismo año. Esta afirmación sirvió de base para la formulación de la teoría cromosómica de la herencia unos años más tarde. 6
  • 77. Teoría cromosómica de la herencia En 1909, W. Johannsen designó el “factor hereditario” de Mendel con el término gen . Wilhelm Ludvig Johannsen (1857 - 1927) 6
  • 78. Teoría cromosómica de la herencia En los años siguientes Morgan realizó importantes observaciones en los cromosomas de la mosca del vinagre. Llegó a la conclusión de que los genes estaban en los cromosomas y de que aquellos que se encontraban en el mismo cromosoma tendían a heredarse juntos, por lo que los denominó genes ligados . Se llegó a la TEORÍA CROMOSÓMICA DE LA HERENCIA Thomas Hunt Morgan (1866-1945), Drosophila melanogaster 6
  • 79. El código genético Este es uno de los descubrimientos más importantes del siglo XX y de toda la Historia de la Ciencia y de la Humanidad: Veamos qué significa esto… Pero antes, ¿sabes qué es un CÓDIGO ? Un código es el conjunto de rasgos que tiene el mensaje para que pueda ser entendido por el emisor y el receptor. El código que se ha usado en este texto, por ejemplo, es la lengua española o el castellano. El mensaje contenido en los genes es entendido por la célula, “traduciéndose” al “lenguaje” de las proteínas. Esto es estudiado por la GENÉTICA MOLECULAR . 7 ADN ARN Proteínas
  • 80. El código genético Esto significa que el ADN es capaz de sacar copias idénticas de sí mismo Esto significa que el ADN es capaz de sacar copias de su información en forma de otra molécula: El ARN (ácido ribonucleico) Esto significa que el mensaje de los genes, en forma de ARN, sirve para formar proteínas Veamos qué significa esto… Replicación Transcripción Traducción Estos son los nombres de estos procesos. Veamos cómo son… 7 ADN ARN Proteínas
  • 81. Replicación ADN El ADN es capaz de sacar copias idénticas de sí mismo Esto ocurre antes de que la célula se divida. Esto es lógico, puesto que las células hijas deben llevar toda la información genética.
  • 82. Replicación ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Como sabes, el ADN es una cadena doble “con cuatro letras”: Fíjate que siempre están unidas, una frente a otra, la A con la T y la C con la G. Por ello se dice que las dos cadenas son complementarias . Las “letras” son las bases nitrogenadas: A= Adenina T= Timina C= Citosina G= Guanina
  • 83. Replicación ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando va a copiarse el ADN ocurre esto: ATTCGCGGCATTAATCCG ATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGC TATGGATCATGGCGCCTAAATTTGTACCTAG 1º se abre la doble cadena: 2º se van añadiendo nuevas letras, de forma complementaria : ATTCGCGGCATTAATCCG ATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGC TATGGATCATGGCGCCTAAATTTGTACCTAG C T C C A A ATACCTAGT T T GTACCTAG La doble cadena se terminará abriendo del todo
  • 84. Replicación 3º Continúa el proceso de añadir “letras” hasta formarse dos doble cadenas hijas, idénticas a la original: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG En rojo se muestran las nuevas “letras” que se han ido uniendo de la manera “correcta” o complementaria (A con T y C con G). De este modo, cada una de las cadenas originales ha servido de MOLDE para crear otra A veces se producen errores en este proceso, dando lugar a genes alterados, distintos al original. Son las MUTACIONES .
  • 85. Estos son algunos de los dibujos de la replicación o duplicación del ADN que pueden encontrarse en Internet:
  • 86. Transcripción ADN ARN Los genes del ADN son capaces de sacar copias de su información en forma de otra molécula: El ARN (ácido ribonucleico) GGCGCCUAAAUUUG Las cadenas de ARN son más cortas que las de ADN y están formadas por una cadena simple (no doble como ocurría con el ADN) La letra U (Uracilo) sustituye a la T en el ARN
  • 87. 1º se abre una parte de la doble cadena de ADN: 2º se copia la información del gen añadiendo letras, de forma complementaria, para formar ARN: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando se transcribe el ADN a ARN ocurre esto: ATTCGCGGCATTAATCCGATACCTAGTA CCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA TACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCAT GGCGCCTAAATTTGTACCTAG La doble cadena de ADN NO se terminará abriendo del todo. Sólo se transcribe a ARN la información de algunos genes. ADN ATTCGCGGCATTAATCCGATACCTAGTA CCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA GGCGCCUAAAUUUG TACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCAT GGCGCCTAAATTTGTACCTAG C G U A La letra U (Uracilo) sustituye a la T en el ARN ARN Gen trascrito a ARN Gen que va a transcribirse Transcripción
  • 88. Transcripción GGCGCCUAAAUUUG Finalmente, el ARN sale fuera del núcleo. Gracias a los ribosomas, en el citoplasma, la información que lleva el ARN es “leída” por los ribosomas para formar proteínas en el proceso llamado TRADUCCIÓN o SÍNTESIS DE PROTEÍNAS ARN ribosomas Este ARN también se llama ARN mensajero , porque lleva un mensaje para fabricar proteínas. Núcleo celular Citoplasma Clic aquí para ver un vídeo de la Transcripción
  • 89. Traducción o síntesis de proteínas GGCGCCUAAAUUUAUGGCACCAUGCCAUG Ocurre en el citoplasma celular, fuera del núcleo. La información del ARN mensajero es “leída” por los ribosomas para fabricar proteínas. Cada grupo de tres bases (o “letras”) del ARN mensajero determina la unión, a la cadena proteica, de uno de los 20 aminoácidos que existen. Clic aquí para ver un vídeo de la traducción o síntesis de proteínas
  • 90. Clic aquí para realizar actividades interactivas de Genética