Genes and Proteins
DNA
 
Video Clip <ul><li>http://www.youtube.com/watch?v=NJxobgkPEAo </li></ul>
 
 
 
 
Codon Chart
Codon Chart
Activity <ul><li>Protein Synthesis Activity – DNA sequence </li></ul><ul><li>Obtain one DNA sequence (single strand) from ...
Upcoming SlideShare
Loading in …5
×

Genes and proteins

373 views
308 views

Published on

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
373
On SlideShare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Genes and proteins

  1. 1. Genes and Proteins
  2. 2. DNA
  3. 4. Video Clip <ul><li>http://www.youtube.com/watch?v=NJxobgkPEAo </li></ul>
  4. 9. Codon Chart
  5. 10. Codon Chart
  6. 11. Activity <ul><li>Protein Synthesis Activity – DNA sequence </li></ul><ul><li>Obtain one DNA sequence (single strand) from your teacher </li></ul><ul><li>Find the person with your complementary sequence to form a DNA helix (pair) </li></ul><ul><li>With your partner, choose one strand as the coding strand (sense), other as the non-coding strand (antisense) </li></ul><ul><li>Using the antisense strand as the template, write out the complementary RNA sequence (Remember T is replaced with U on the RNA strand) </li></ul><ul><li>On the RNA, locate the start codon(if unable to find start codon, use the other strand as the sense strand and repeat steps 4 & 5) and divide the RNA into triplet codes representing codons </li></ul><ul><li>Using the codon table translate the RNA into a polypeptide chain until a stop signal is reached </li></ul><ul><li>Analysis of Sequence </li></ul><ul><li>How many amino acids make up the polypeptide? </li></ul><ul><li>How many different amino acids make up the polypeptide? </li></ul><ul><li>How many different codons were used to code for these amino acids? </li></ul><ul><li>Randomly choose any nucleotide on your RNA strand and change it to a different RNA nucleotide. What are the effects of this mutation on your polypeptide chain? </li></ul><ul><li>GCGCGTATGCATTAGTCGTCACGTACATGGTACTGATCA </li></ul><ul><li>CGCGCATACGTAATCAGCAGTGCATGTACCATGACTAGT </li></ul>

×