Your SlideShare is downloading. ×

Genes and proteins

244

Published on

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
244
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Genes and Proteins
  • 2. DNA
  • 3.  
  • 4. Video Clip
    • http://www.youtube.com/watch?v=NJxobgkPEAo
  • 5.  
  • 6.  
  • 7.  
  • 8.  
  • 9. Codon Chart
  • 10. Codon Chart
  • 11. Activity
    • Protein Synthesis Activity – DNA sequence
    • Obtain one DNA sequence (single strand) from your teacher
    • Find the person with your complementary sequence to form a DNA helix (pair)
    • With your partner, choose one strand as the coding strand (sense), other as the non-coding strand (antisense)
    • Using the antisense strand as the template, write out the complementary RNA sequence (Remember T is replaced with U on the RNA strand)
    • On the RNA, locate the start codon(if unable to find start codon, use the other strand as the sense strand and repeat steps 4 & 5) and divide the RNA into triplet codes representing codons
    • Using the codon table translate the RNA into a polypeptide chain until a stop signal is reached
    • Analysis of Sequence
    • How many amino acids make up the polypeptide?
    • How many different amino acids make up the polypeptide?
    • How many different codons were used to code for these amino acids?
    • Randomly choose any nucleotide on your RNA strand and change it to a different RNA nucleotide. What are the effects of this mutation on your polypeptide chain?
    • GCGCGTATGCATTAGTCGTCACGTACATGGTACTGATCA
    • CGCGCATACGTAATCAGCAGTGCATGTACCATGACTAGT

×