RNA Types <ul><li>Three types of RNA: </li></ul><ul><li>messenger RNA  ( mRNA ) -  brings DNA information from the nucleus...
Ribosomes <ul><li>the location where translation occurs </li></ul><ul><li>made of protein and rRNA </li></ul><ul><li>consi...
Ribosomal Role <ul><li>Ribosome recognizes 5’ cap of mRNA strand </li></ul><ul><li>mRNA is clamped between the two subunit...
Reading Frames <ul><li>reading frame  – a sequence of codon triplets which result in protein formation </li></ul>5’ AUGCCA...
Prokaryotic Ribosome Binding <ul><li>Prokaryotic mRNA transcripts have a  Shine-Dalgarno  sequence that ribosomes recogniz...
tRNA <ul><li>tRNA  – transfer RNA; translates between nucleic acids and amino acids </li></ul>amino acids attach here anti...
A snapshot of translation <ul><li>Codons on the mRNA are read in the 5’  3’ direction. </li></ul><ul><li>The mRNA is move...
 
Codons versus tRNA numbers <ul><li>61  different codons on mRNA (not including stop codons) </li></ul><ul><li>But only  45...
The wobble hypothesis  <ul><li>base pairing rules between the third base of the mRNA codon and its corresponding tRNA anti...
tRNA Activation <ul><li>tRNA activation  - enzymes attach the appropriate amino acid to a tRNA (according to genetic code)...
 
3.  Aminoacyl-tRNA synthetase <ul><li>Aminoacyl-tRNA (aatRNA)  </li></ul><ul><li>= tRNA + amino acid  </li></ul><ul><li>= ...
Aminoacyl-tRNA Synthetase Mechanism Fig. 17.14
Ribosomal Structure <ul><li>ribosomes have three pockets which can bind tRNA </li></ul><ul><ul><li>acceptor (A) site </li>...
Translation Steps <ul><li>Ribosome binds to mRNA strand </li></ul><ul><li>First tRNA  binds to A-site </li></ul><ul><li>Ri...
 
Translation Termination <ul><li>no tRNA exist for the STOP codons </li></ul><ul><li>a  release factor  recognizes the stop...
Protein Modification <ul><li>proteins are folded properly after being released from the ribosome by  chaperonin  proteins ...
Protein Modification chaperonin
Protein Modification
Protein Modification
Translation Animation <ul><li>Translation Animation </li></ul><ul><li>http://www.youtube.com/watch?v=-zb6r1MMTkc&feature=r...
Membrane Embedded Synthesis <ul><li>Ribosomes are found </li></ul><ul><ul><li>free in the cytoplasm </li></ul></ul><ul><ul...
Membrane Embedded Synthesis <ul><li>All membrane-embedded polypeptides begin with an N-terminal signal of ~20 amino acids ...
Membrane Embedded Synthesis
Upcoming SlideShare
Loading in...5
×

08 translation-2010 update stacy

1,365

Published on

Published in: Technology, Business
2 Comments
2 Likes
Statistics
Notes
No Downloads
Views
Total Views
1,365
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
2
Likes
2
Embeds 0
No embeds

No notes for slide

Transcript of "08 translation-2010 update stacy"

  1. 2. RNA Types <ul><li>Three types of RNA: </li></ul><ul><li>messenger RNA ( mRNA ) - brings DNA information from the nucleus to the cytoplasm </li></ul><ul><li>transfer RNA ( tRNA ) - translator molecule between nucleic acids and amino acids </li></ul><ul><li>ribosomal RNA ( rRNA ) – molecule used to make ribosomes, which synthesizes protein </li></ul>
  2. 3. Ribosomes <ul><li>the location where translation occurs </li></ul><ul><li>made of protein and rRNA </li></ul><ul><li>consists of two parts (eukaryotic) </li></ul><ul><ul><li>60S subunit – larger unit </li></ul></ul><ul><ul><li>40S subunit – smaller unit </li></ul></ul><ul><li>final “size” is 80S </li></ul><ul><li>S – Svedberg; a unit of measure of size based on how quickly an object sediments </li></ul>
  3. 4. Ribosomal Role <ul><li>Ribosome recognizes 5’ cap of mRNA strand </li></ul><ul><li>mRNA is clamped between the two subunits </li></ul><ul><li>rRNA recognize a specific mRNA Kozak sequence to find the correct start codon </li></ul><ul><li>ribosome moves along the mRNA 5’  3’ in a given reading frame to create a polypeptide from N-terminus  C-terminus </li></ul>
  4. 5. Reading Frames <ul><li>reading frame – a sequence of codon triplets which result in protein formation </li></ul>5’ AUGCCAGAUGCCAUCCAAGGCC 3’ 5’ AUG CCA GAU GCC AUC CAA GGC C 3’ 5’ A UGC CAG AUG CCA UCC AAG GCC 3’
  5. 6. Prokaryotic Ribosome Binding <ul><li>Prokaryotic mRNA transcripts have a Shine-Dalgarno sequence that ribosomes recognize </li></ul><ul><li>5’ AGGAGG 3’ </li></ul><ul><li>A complementary section of rRNA can bind to this region – anti Shine-Dalgarno sequence </li></ul>
  6. 7. tRNA <ul><li>tRNA – transfer RNA; translates between nucleic acids and amino acids </li></ul>amino acids attach here anticodon anticodon – three bases at the bottom of the tRNA which recognize the codon triplets on the mRNA through complementary base pairing
  7. 8. A snapshot of translation <ul><li>Codons on the mRNA are read in the 5’  3’ direction. </li></ul><ul><li>The mRNA is moved through the ribosome, starting with the 5’ end of the mRNA. </li></ul>Fig. 17.12 Codon Anticodon
  8. 10. Codons versus tRNA numbers <ul><li>61 different codons on mRNA (not including stop codons) </li></ul><ul><li>But only 45 different tRNA molecules </li></ul><ul><li>Conclusion? </li></ul>Fig. 17.4 Anticodons of some tRNAs recognize more than one codon on the mRNA.
  9. 11. The wobble hypothesis <ul><li>base pairing rules between the third base of the mRNA codon and its corresponding tRNA anticodon are more flexible </li></ul><ul><li>wobble position: third base of a codon and its corresponding anticodon. </li></ul><ul><li>For example: the base U of a tRNA anticodon, can pair with either A or G in the third position of an mRNA codon. </li></ul>
  10. 12. tRNA Activation <ul><li>tRNA activation - enzymes attach the appropriate amino acid to a tRNA (according to genetic code) </li></ul><ul><ul><li>20 different enzymes which attach the 20 different amino acids </li></ul></ul><ul><li>aminoacyl-tRNA – a tRNA with the correct amino acid attached </li></ul>
  11. 14. 3. Aminoacyl-tRNA synthetase <ul><li>Aminoacyl-tRNA (aatRNA) </li></ul><ul><li>= tRNA + amino acid </li></ul><ul><li>= activated amino acid </li></ul><ul><li>Enzyme aminoacyl-tRNA synthetase catalyze covalent joining of amino acid to tRNA </li></ul><ul><li>20 different aatRNA synthetases for each of the 20 different amino acids </li></ul>
  12. 15. Aminoacyl-tRNA Synthetase Mechanism Fig. 17.14
  13. 16. Ribosomal Structure <ul><li>ribosomes have three pockets which can bind tRNA </li></ul><ul><ul><li>acceptor (A) site </li></ul></ul><ul><ul><li>peptide (P) site </li></ul></ul><ul><ul><li>exit (E) site </li></ul></ul><ul><li>ribosomes translocate along the mRNA strand to make proteins </li></ul>A P E
  14. 17. Translation Steps <ul><li>Ribosome binds to mRNA strand </li></ul><ul><li>First tRNA binds to A-site </li></ul><ul><li>Ribosome shifts 5’  3’ on mRNA moving the first tRNA into the P-site </li></ul><ul><li>Second tRNA binds to A-site </li></ul><ul><li>Peptide bond forms between amino acids </li></ul><ul><li>Ribosome shifts 5’  3’ on mRNA moving first tRNA into E-site, second tRNA into P-site </li></ul><ul><li>New tRNA can now bind to A-site </li></ul><ul><li>Continue until a stop codon is reached </li></ul>
  15. 19. Translation Termination <ul><li>no tRNA exist for the STOP codons </li></ul><ul><li>a release factor recognizes the stop codons and releases the peptide chain from the ribosome </li></ul><ul><li>ribosomes dissociate from the mRNA </li></ul>
  16. 20. Protein Modification <ul><li>proteins are folded properly after being released from the ribosome by chaperonin proteins </li></ul><ul><li>other functional groups or larger molecules may be added to the protein </li></ul><ul><li>proteins may also be cleaved into different pieces to carry out their specific functions </li></ul>
  17. 21. Protein Modification chaperonin
  18. 22. Protein Modification
  19. 23. Protein Modification
  20. 24. Translation Animation <ul><li>Translation Animation </li></ul><ul><li>http://www.youtube.com/watch?v=-zb6r1MMTkc&feature=related </li></ul>
  21. 25. Membrane Embedded Synthesis <ul><li>Ribosomes are found </li></ul><ul><ul><li>free in the cytoplasm </li></ul></ul><ul><ul><li>attached to the endoplasmic reticulum </li></ul></ul><ul><li>Polypeptides designed to be integral proteins must be brought to the ER for synthesis. </li></ul>
  22. 26. Membrane Embedded Synthesis <ul><li>All membrane-embedded polypeptides begin with an N-terminal signal of ~20 amino acids called the signal peptide . </li></ul><ul><li>A signal recognition particle (SRP) binds to the signal peptide to bring the ribosome and growing polypeptide chain to the ER to continue synthesis </li></ul><ul><li>The signal peptide is cleaved once the polypeptide is secure in the membrane </li></ul>
  23. 27. Membrane Embedded Synthesis

×