Your SlideShare is downloading. ×
08 translation-2010 update stacy
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

08 translation-2010 update stacy

1,351
views

Published on

Published in: Technology, Business

2 Comments
2 Likes
Statistics
Notes
No Downloads
Views
Total Views
1,351
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
2
Likes
2
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1.  
  • 2. RNA Types
    • Three types of RNA:
    • messenger RNA ( mRNA ) - brings DNA information from the nucleus to the cytoplasm
    • transfer RNA ( tRNA ) - translator molecule between nucleic acids and amino acids
    • ribosomal RNA ( rRNA ) – molecule used to make ribosomes, which synthesizes protein
  • 3. Ribosomes
    • the location where translation occurs
    • made of protein and rRNA
    • consists of two parts (eukaryotic)
      • 60S subunit – larger unit
      • 40S subunit – smaller unit
    • final “size” is 80S
    • S – Svedberg; a unit of measure of size based on how quickly an object sediments
  • 4. Ribosomal Role
    • Ribosome recognizes 5’ cap of mRNA strand
    • mRNA is clamped between the two subunits
    • rRNA recognize a specific mRNA Kozak sequence to find the correct start codon
    • ribosome moves along the mRNA 5’  3’ in a given reading frame to create a polypeptide from N-terminus  C-terminus
  • 5. Reading Frames
    • reading frame – a sequence of codon triplets which result in protein formation
    5’ AUGCCAGAUGCCAUCCAAGGCC 3’ 5’ AUG CCA GAU GCC AUC CAA GGC C 3’ 5’ A UGC CAG AUG CCA UCC AAG GCC 3’
  • 6. Prokaryotic Ribosome Binding
    • Prokaryotic mRNA transcripts have a Shine-Dalgarno sequence that ribosomes recognize
    • 5’ AGGAGG 3’
    • A complementary section of rRNA can bind to this region – anti Shine-Dalgarno sequence
  • 7. tRNA
    • tRNA – transfer RNA; translates between nucleic acids and amino acids
    amino acids attach here anticodon anticodon – three bases at the bottom of the tRNA which recognize the codon triplets on the mRNA through complementary base pairing
  • 8. A snapshot of translation
    • Codons on the mRNA are read in the 5’  3’ direction.
    • The mRNA is moved through the ribosome, starting with the 5’ end of the mRNA.
    Fig. 17.12 Codon Anticodon
  • 9.  
  • 10. Codons versus tRNA numbers
    • 61 different codons on mRNA (not including stop codons)
    • But only 45 different tRNA molecules
    • Conclusion?
    Fig. 17.4 Anticodons of some tRNAs recognize more than one codon on the mRNA.
  • 11. The wobble hypothesis
    • base pairing rules between the third base of the mRNA codon and its corresponding tRNA anticodon are more flexible
    • wobble position: third base of a codon and its corresponding anticodon.
    • For example: the base U of a tRNA anticodon, can pair with either A or G in the third position of an mRNA codon.
  • 12. tRNA Activation
    • tRNA activation - enzymes attach the appropriate amino acid to a tRNA (according to genetic code)
      • 20 different enzymes which attach the 20 different amino acids
    • aminoacyl-tRNA – a tRNA with the correct amino acid attached
  • 13.  
  • 14. 3. Aminoacyl-tRNA synthetase
    • Aminoacyl-tRNA (aatRNA)
    • = tRNA + amino acid
    • = activated amino acid
    • Enzyme aminoacyl-tRNA synthetase catalyze covalent joining of amino acid to tRNA
    • 20 different aatRNA synthetases for each of the 20 different amino acids
  • 15. Aminoacyl-tRNA Synthetase Mechanism Fig. 17.14
  • 16. Ribosomal Structure
    • ribosomes have three pockets which can bind tRNA
      • acceptor (A) site
      • peptide (P) site
      • exit (E) site
    • ribosomes translocate along the mRNA strand to make proteins
    A P E
  • 17. Translation Steps
    • Ribosome binds to mRNA strand
    • First tRNA binds to A-site
    • Ribosome shifts 5’  3’ on mRNA moving the first tRNA into the P-site
    • Second tRNA binds to A-site
    • Peptide bond forms between amino acids
    • Ribosome shifts 5’  3’ on mRNA moving first tRNA into E-site, second tRNA into P-site
    • New tRNA can now bind to A-site
    • Continue until a stop codon is reached
  • 18.  
  • 19. Translation Termination
    • no tRNA exist for the STOP codons
    • a release factor recognizes the stop codons and releases the peptide chain from the ribosome
    • ribosomes dissociate from the mRNA
  • 20. Protein Modification
    • proteins are folded properly after being released from the ribosome by chaperonin proteins
    • other functional groups or larger molecules may be added to the protein
    • proteins may also be cleaved into different pieces to carry out their specific functions
  • 21. Protein Modification chaperonin
  • 22. Protein Modification
  • 23. Protein Modification
  • 24. Translation Animation
    • Translation Animation
    • http://www.youtube.com/watch?v=-zb6r1MMTkc&feature=related
  • 25. Membrane Embedded Synthesis
    • Ribosomes are found
      • free in the cytoplasm
      • attached to the endoplasmic reticulum
    • Polypeptides designed to be integral proteins must be brought to the ER for synthesis.
  • 26. Membrane Embedded Synthesis
    • All membrane-embedded polypeptides begin with an N-terminal signal of ~20 amino acids called the signal peptide .
    • A signal recognition particle (SRP) binds to the signal peptide to bring the ribosome and growing polypeptide chain to the ER to continue synthesis
    • The signal peptide is cleaved once the polypeptide is secure in the membrane
  • 27. Membrane Embedded Synthesis

×