Dna fingerprinting
Upcoming SlideShare
Loading in...5
×
 

Dna fingerprinting

on

  • 1,365 views

 

Statistics

Views

Total Views
1,365
Views on SlideShare
1,365
Embed Views
0

Actions

Likes
0
Downloads
80
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Dna fingerprinting Dna fingerprinting Presentation Transcript

  • DNAFingerprintingBYN.ALAGESWARI
  • DNA Extraction:DNA can be extracted fromalmost any human tissue. •Buccal cells from inside cheek for paternity tests.•Sources of DNA at crime scene: blood,semen, hair follicle, saliva. •DNA extracted from evidence is compared to DNA from known individuals
  • •Extracted DNA molecules are incubatedwith restriction enzymes (endonucleases). Restriction enzymes are produced by bacteria as a defense against viruses. These enzymes cut DNA at specific base sequences called recognition sites. Results in smaller pieces of DNA called RFLP’s.
  • An EcoR1 restriction enzyme
  • RFLP Analysis: •RF stands for Restriction Fragments. Those are the fragments that were cut by restriction enzymes. •L stands for Length, and refers to the length of the restriction fragment. •P stands for Polymorphisms, a Greek term for “many shapes”. The lengths of some of the restriction fragments differ greatly between individuals.RFLP = Restriction Fragment LengthPolymorphism
  • Electrophoresis of these RFLP’s producedifferent patterns of DNA bands.With 3 billion base pairs in the humangenome, however, RFLP analysis wouldproduce a ‘smear’ of many similar sizedfragments.Molecular biologists have identified regionsof the human genome where restrictionfragment lengths are highly variablebetween individuals.
  • VNTR alleles are highly variable regions ofhuman DNA. •VNTR stands for ‘variable number of tandem repeats. •A tandem repeat is a short sequence of DNA that is repeated at a specific chromosomal locus. •Tandem repeats are interspersed throughout the human genome.
  • VNTR’s continued: •The number of repeats at a given place on a certain chromosome is highly variable from one person to another. •The number of such repeats is usually different on the paternal and maternal members of the same person’s chromosome pair.
  • Red boxes represent the repeat unit and the blue lollipopsrepresent cut sites for a restriction endonuclease. (Here 3different variants, may be 50 in reality).
  • •Analysis of a VNTR locus most commonly results in a two-band pattern, one band inherited from each parent. •A one-band pattern can occur if the size of the two parental bands are the same or nearly the same.•For our simple example of three different allelesdesignated A, B, and C illustrated above, six uniqueDNA profiles are possible.
  • The possible genotypesare AA, BB, CC, AB,BC, and AC
  • RFLP Analysis:•The RFLP markers most commonly used for DNAprofile analysis are found on chromosomes 1, 2, 4,5, 10 and 17.•These RFLP markers are named after theirlocations on these chromosomes.••For example, the marker on chromosome 2 iscalled D2S44 (section 44 of chromosome 2).•These chromosomal locations are also referred toas DNA loci.
  • •The Federal Bureau of Investigation (FBI) hasbeen a leader in developing DNA typingtechnology for use in the identification ofperpetrators of violent crime.•In 1997, the FBI announced the selection of 13STR (short tandem repeat) loci to constitute thecore of the United States national database,CODIS.•All CODIS STRs are tetrameric repeat sequences.•All forensic laboratories that use the CODISsystem can contribute to a national database.
  • •For example, D7S280 is one of the 13 coreCODIS STR genetic loci. This DNA isfound on human chromosome 7.•The tetrameric repeat sequence of D7S280 is"gata". Different alleles of this locus havefrom 6 to 15 tandem repeats of the "gata"sequence.
  • How many tetrameric repeats are present in theDNA sequence shown below? Notice that one of thetetrameric sequences is "gaca", rather than "gata".1 aatttttgta ttttttttag agacggggtt tcaccatgttggtcaggctg actatggagt61 tattttaagg ttaatatata taaagggtat gatagaacacttgtcatagt ttagaacgaa121 ctaacgatag atagatagat agatagatag atagatagatagatagatag atagacagat181 agatagtttt tttttatctc actaaatagt ctatagtaaacatttaatta ccaatatttg241 gtgcaattct gtcaatgagg ataaatgtgg aatcgttataattcttaaga atatatattc301 cctctgagtt tttgatacct cagattttaa ggcc
  • DNA profiles vary from person to person. •When profiles from a single VNTR locus from unrelated individuals are compared, the profiles are normally different. •However, it is possible for two individuals to have the same profile at one or two loci. •But the chance of more than one person having the same DNA profile at 4, 5, or 6 different VNTR loci is extremely small.
  • DNA ProfilingDNA primers have been optimized to allow amplificationof multiple STR loci in a single reaction mixture.
  • Norma’s genotype is 15, 15 at the locus D3S1358, 14, 16at vWA, and 24, 25 at FGA.
  • A DNA Profile: The 13 CODIS STR loci Locus D3S1358 vWA FGA D8S1179 D21S11 D18S51 D5S818 Geno- 15, 18 16, 16 19, 24 12, 13 29, 31 12, 13 11, 13 type Fre- 8.2% 4.4% 1.7% 9.9% 2.3% 4.3% 13% quencyLocus D13S317 D7S820 D16S539 THO1 TPOX CSF1P AMEL OGeno- 11, 11 10, 10 11, 11 9, 9.3 8, 8 11, 11 XY type Fre- 1.2% 6.3% 9.5% 9.6% 3.52% 7.2% Malequency
  • How common or rare would this 13 locus DNAprofile be in the reference population?In most cases, a "product rule" calculation can bedone by multiplying each individual probabilitytogetherBy combining the frequency information for all13 CODIS loci, this frequency of this profilewould be 1 in 7.7 quadrillion Caucasians…that’s1 in 7.7 x 1015 power!