Identification and Isolation
 of Stress Related Gene in
     Gray (Eschrichtius
 robustus) and Fin Whales
  (Balaenoptera ...
Background
• North Pacific is home to over 80 species of cetaceans
    • Whales
    • Dolphins
    • Porpoises

• OrderCet...
Gray Whale, Eschrichtius robustus
• Sub-Order Mysticeti

• Females are typically 11.7 and 15.2 m in length and males are 1...
Fin Whale, Balaenoptera physalus
• Sub-Order Mysticeti

• Males and Females are typically 18 to 21 m, up to 27 m

• Clearl...
Distribution Patterns
Environmental Factors
• Pollutant
     • organochlorine compounds like
     DDTs, hexachlorocyclohexanes
     (HCHs), chlo...
Objectives
• Identification of genes of interest
     •Glutathione S-transferase A4 (GStra)
     • Superoxide dismutase [C...
Results




Figure 1: Row one: Lane (1)100 bp ladder, (2)         Figure 2: Lane (1) 100 bp ladder, (2) Negative
Negative ...
Reference   Grey Whale
                  Reference Taxa                                 Fin Whale Coverage
               ...
Interleukin 17
Eschrichtius robustus                                Balaenoptera physalus

CTCCAGATCACAGAGGGGTACCTCTCAGGGT...
Reference   Grey Whale
                 Reference Taxa                                 Fin Whale Coverage
                ...
Prostaglandin-endoperoxide synthetase-2
        Eschrichtius robustus
        GTGTGAAGGTGAGTGAGAGGAAGCAATTAGACATGTATTAACTG...
Reference   Grey Whale
                 Reference Taxa                                 Fin Whale Coverage
                ...
tRNA syntetase

Eschrichtius robustus

CTGTGGGAATTAATTGGTGCTAAGGTCTAACATTGTTCTAATCTGAGTGC
CAGGGAATGTTTTCTGTCCCTTCTCACCCCTA...
Reference   Grey Whale
                 Reference Taxa                                 Fin Whale Coverage
                ...
Glutatione S-transferase A4
Eschrichtius robustus
TGACCCCGTAANACCTGCAGGGTATAAACATTTTACATTGGTTATAATAC
TTGAGATGGAGAAAATGATGG...
Interleukin 17
Prostaglandin-endoperoxide synthetase-2
tRNA syntetase
Glutathione S-transferase A4
Acknowledgement
Dr. Steven Roberts



Research Scientist
Sam White


National Oceanic and Atmospheric Association
 Seattle...
References
Aguilar, A., Borrell, A., P.J.H., Reijnders. 2002. Geographical and temporal variation in levels of organochlor...
References
Park, S.G., Shimmel, P., Kim, S. 2008. Aminoacyl-tRNA synthetase and their connection to disease. PNAS. Vol. 10...
Upcoming SlideShare
Loading in …5
×

Research Presentation C. McLemore

534 views
471 views

Published on

Presentation of C. McLemore on immune genes in whales. Part of FISH 495 course at UW.

Published in: Education, Technology, Travel
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
534
On SlideShare
0
From Embeds
0
Number of Embeds
13
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Research Presentation C. McLemore

  1. 1. Identification and Isolation of Stress Related Gene in Gray (Eschrichtius robustus) and Fin Whales (Balaenoptera physalus) Christin McLemore June 04, 2009 School of Aquatic and Fishery Science University of Washington Box 355020 Seattle, WA 98195
  2. 2. Background • North Pacific is home to over 80 species of cetaceans • Whales • Dolphins • Porpoises • OrderCetacea • Sub-Order Odontoceti • Sub-Order Mysticeti
  3. 3. Gray Whale, Eschrichtius robustus • Sub-Order Mysticeti • Females are typically 11.7 and 15.2 m in length and males are 11.1 to 14.3 m (Evans 1987). • Grey colored skin with barnacles (Cryptolepas rachianecti) and barnacle scars • Only large whale where the upper jaw extends over the lower jaw (Reeves, 1987)
  4. 4. Fin Whale, Balaenoptera physalus • Sub-Order Mysticeti • Males and Females are typically 18 to 21 m, up to 27 m • Clearly defined grey, white, brown and black, chevron-shaped coloration pattern on the right side, behind the head and an asymmetrical coloration of the lower jaw: white on right, dark on left • The status of Atlantic and Pacific Fin Whale assigned by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC) • April 1987 – “of special concern” • May 2002 – Pacific Fin whale is classified as THREATENED
  5. 5. Distribution Patterns
  6. 6. Environmental Factors • Pollutant • organochlorine compounds like DDTs, hexachlorocyclohexanes (HCHs), chlordane compounds (CHLs) and polychlorinated biphenyls (PCBs) can disrupt normal endocrine physiology in marine mammals (Tanabe, 2002). • Climate Change • reduction of available habitat •the acidification of the oceans as they absorb growing quantities of CO2 • Disease • Increased susceptibility of cetaceans to diseases • reduced reproductive success •body condition •survival rates (World Wide Fund, 2007)
  7. 7. Objectives • Identification of genes of interest •Glutathione S-transferase A4 (GStra) • Superoxide dismutase [Cu-Zn] (SD) • Heat shock 70kDa protein 6 (HSP6) • Interleukin-2 precursor (IL-2) • Interleukin 17 (IL17) • Interleukin 13 precursor (IL13) • Toll-like receptor 5 (TLR5) • Cyclooxygenase (COX-2) • Isolation of the expressed gene of interest • Interleukin 17 • Prostaglandin-endoperoxide synthetase-2 • tRNA synthetase • Glutathione S-transferase A4 • Homology of genes from other organisms with Grey and Fin Whale
  8. 8. Results Figure 1: Row one: Lane (1)100 bp ladder, (2) Figure 2: Lane (1) 100 bp ladder, (2) Negative Negative control Gstra, (3) Grey whale Gstra, (4) control IL17, (3) Grey whale IL17, (4) Fin whale Fin whale Gstra, (5) Negative control HSP6, (6) IL17, (5) Negative control IL13, (6) Grey whale Grey whale HSP6, (7) Fin whale HSP6, (8) Negative IL13, (7) Fin whale IL13, (8) Negative control control SD, (9) Grey whale SD, (10) Fin whale SD. IL2, (9) Grey whale IL2, (10) Fin whale IL2, (11) Row 2: Lane (1) 100 bp ladder, (2) Negative control Negative control TLR5, (12) Grey whale COX2, (3) Grey whale COX2, (4) Fin whale COX2. TLR5, (13) Fin whale TLR5, (14) 100 bp ladder.
  9. 9. Reference Grey Whale Reference Taxa Fin Whale Coverage Size Coverage Homo sapien Interleukin 17 (AY460616) 7,422 1,729 - 3,093 2,385 – 2,756 Prostaglandin- Homo sapien endoperoxide 11,449 4,041 – 5,563 (AY229989) synthetase-2 Bos taurus tRNA synthetase (BC122671) 1,538 1 - 360 Glutathione S- Homo sapien 21,305 12,394 – 12,942 12,790 - 13,423 transferase A4 (AY878121)
  10. 10. Interleukin 17 Eschrichtius robustus Balaenoptera physalus CTCCAGATCACAGAGGGGTACCTCTCAGGGTCCTCATTGCGGCTATAAGG AGGATAAATCTCTGTATTCTTCTACCCTGTATGTATCAGACTGCCAATTA GAGACAAAAGCCAGGAAGAGAGTGAAATCCTCGTAGAGCAGGAAGGAAAT AATCACCTTGAGAATGGTATTACTCACTCAGAATCATCCGTCAAAACTGG CAAACAGGAATAAACAAAGGGAGACAAATTCACAAGGGTGCAAATGATAG AAGAGCCATTGTGTAAACCAATGATTCTCAAACTTTCATTCTACAGATTT GCATTGTGAATTCTCTGAGTGCTGTTAGTCTGAAAAAGAAGTAGTTTGGG CTTTGATAGAGCACAGCTCACCCCACCCCCCATAACACCTATTCTACTAG GAAAACTTGTGTTTGCAAGCCCATGAAGTGTTATAGAAAAAAAGACAATG TTCTGATTGTCCCAGAAATCCATCCAAACGAACGGTGGTCATCATTCTCA ATTAGTTTTTCCCAATTTCTTTCCAACATACACAAAAGAAGATAGACTGA TATTTATGACACCCCAAGTCTGTTGTTTATTTATTTTAAAAAGAAATAGA AACTACAGAATGGATTTAAGTTTGACACAAAGGTTAATTTGTTTAGGGTA CATTTTTCATAGGAGATTAGTGCTTGAATTCTCTTCACCAGAGCTCCCAA CATTTGATGGATGAAAAAAGACTAAAGGAATAGTATAGAAACAAGATAAC AGAAGATTTGTTGAAAATAACTATTAATTAACTGGGATTTTTGTGCTTTT TGTTAATCTGACTTAATGAAGTCTGTCTTTGAAACAGAGAATGCACCCAA TTGGTTGTATTAACACTGGGAAAATATAGCTTGAATACCAGTGGAAGAAG ATTTTATCTGACAGCACGCTGATGGAACAGAGCCCACGGCTGATATGAAG TATCATGCTGGGTATTTCCACCCTTTTTTGACTTAGACAACATCCCCAAC GGCTGCAAACAAAATCTTAAGCCCCTTTATAACCTTCTCTTCTCACTCCC AGACCAATATTTGCTGTGTCCTTAGTACATCTAGTATTTAGABNNATNAA CTCCAGCTGAGTGAATAATTTGCTTCGACTTCTGAATTAATTTATTTGAA GGGTTAAATACNAAATGTATTTTGATAATTTGATTTTAGGCAAATAANNN CTATTCTTAGTAAGTAGAAGTAAGAAGACAAGAAACCCTACAGTCAGGTG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN AATCTGTAGGCTCCATATAACTGAGGTTTATTTGCCTAAAATCAAATTAT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN CAAAATACATTTTGTACTTAATCCATCTAAATACTAGATGTACTAAGGAC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN ACAGCAAANTATTGKTCTGTTGGGGATGTTGTCTAAGTCAAAAAAGGGTG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GAAATACCCAGCATGATACTTCTTCCACTGGTATTCAAGCTATATTTTCC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN CAGTGTTAATACAATCAAAAAAGCACAAAAATCCCAGTTAATTAATAGTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN ATTTTCAACAAATCTTCTCTGGGAGCTCTGGTAAAGAGAATTCAAGCACT NNNNNNNNNNNNNNNNNNNNNNNNNNNTCCATCAAATGTACCCTAAACAA AATCTCCTACGATAAATGTCTATTTCTTTTAAAAATAAATAAACAACAGA ATTAACCTTTGTGTCAAATTTAAATCCATTCTGTAGTTTCAGTCTATCTT CTTGGGGTGTCATAAATATGAGAATGATGACCACCGTTCATTTGGATGGA CTTTTGTGTATGTTGGAAAGAAATCGGGAAAAACTAATCATTGTCTTTTT TTTCTGGGACAATGAGAACTAGTAGAATAGGTGTTATGGGGGGTGGGGTG TTCTATAACACTTCATGGGCTTTGAAACACAAGTTTTCCCCAAACTACTT AGCTGTGCTCTATCAAAGAAATCTGTAGAATGAAAGTTTGAGAATCATTG CTTTTTCAGACTAACAGCACTTAGAGAATTCACAATGCCTATCATTTGCG GTTTACACAATGGCCCTTCCAGTTTTGACGGATGATTCTGAGTGAGTAAC CCCCTGTGAATTTGTCTCCCTTTGTTTATTCCTGTTTGATTTCCTTCCTG ACCATTCTCAAGGTGATTTAACTGGCAGTCTGATACATACAGGGTAGAAG CTCTACGAGGATTTCACTCTCTTCCTGGCTTTTGTCTCCCTTGTAGACGC AATACTGAGATTATCCT TAATGAGGACCCTGAGAGGTACCCCTCTGTGATCTGG
  11. 11. Reference Grey Whale Reference Taxa Fin Whale Coverage Size Coverage Homo sapien Interleukin 17 (AY460616) 7,422 1,729 - 3,093 2,385 – 2,756 Prostaglandin- Homo sapien endoperoxide 11,449 4,041 – 5,563 (AY229989) synthetase-2 Bos taurus tRNA syntetase (BC122671) 1,538 1 - 360 Glutathione S- Homo sapien 21,305 12,394 – 12,942 12,790 - 13,423 transferase A4 (AY878121)
  12. 12. Prostaglandin-endoperoxide synthetase-2 Eschrichtius robustus GTGTGAAGGTGAGTGAGAGGAAGCAATTAGACATGTATTAACTGTAACTG AGATTGGATTGCTACCTAGAAAATTTGACCATAAACCATGATTTATTTGT TCATAAAGCCATTTTTTCCTTATGGATATCTCTGGAGATTTTTTGAAAGT GAGTCCATGTAAACTACTCCATGAAAGTGAATGGGCATTTTGGTATAATG GCATGATGTTTTCAAATTCTATCATTAAAACTGAATTAATGCTGTAAACA AAACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGGT GGACTTAAATCATGTTTATGGTGAATCTTTGGAGAGACAGCATAAACTGC GCCTTTTCAAGGATGGAAAAATGAAATATCAGGTTTGTCCCATTTAAATA TTAAGAATTAGTTATGACTCACCACCCACCTATGTTCAAAATCTCTCATG ATTAAAATTTGTTCCTTACCTTTTT
  13. 13. Reference Grey Whale Reference Taxa Fin Whale Coverage Size Coverage Homo sapien Interleukin 17 (AY460616) 7,422 1,729 - 3,093 2,385 – 2,756 Prostaglandin- Homo sapien endoperoxide 11,449 4,041 – 5,563 (AY229989) synthetase-2 Bos taurus tRNA syntetase (BC122671) 1,538 1 - 360 Glutathione S- Homo sapien 21,305 12,394 – 12,942 12,790 - 13,423 transferase A4 (AY878121)
  14. 14. tRNA syntetase Eschrichtius robustus CTGTGGGAATTAATTGGTGCTAAGGTCTAACATTGTTCTAATCTGAGTGC CAGGGAATGTTTTCTGTCCCTTCTCACCCCTACATGCTTGTGGTATTTTT TTTTTATCTTAGGGAATTCCCTGGCASGACCGTGGCTAAGGCTCTGCGCT TTCACTGCCAAGGGTGCAAGTTAAATCCCTGGTCAGGGAACTAAAATCCC ACAAGCTGTGCTGTGTGTCCCCCGCCCCCCCCCCCCAAAAAAAAAAAAAA AACCYCAGGCATTTTTAATTTTTTGGGGCCCAACCCCTTAGGGGACCCCG AATCCATCTCAGGACCTTTGCACTTACTAGTTCTGCTTGAAACCCTCTTT CCTCAATCCTGTAATGGATCCCGATTT
  15. 15. Reference Grey Whale Reference Taxa Fin Whale Coverage Size Coverage Homo sapien Interleukin 17 (AY460616) 7,422 1,729 - 3,093 2,385 – 2,756 Prostaglandin- Homo sapien endoperoxide 11,449 4,041 – 5,563 (AY229989) synthetase-2 Bos taurus tRNA syntetase (BC122671) 1,538 1 - 360 Glutathione S- Homo sapien 21,305 12,394 – 12,942 12,790 - 13,423 transferase A4 (AY878121)
  16. 16. Glutatione S-transferase A4 Eschrichtius robustus TGACCCCGTAANACCTGCAGGGTATAAACATTTTACATTGGTTATAATAC TTGAGATGGAGAAAATGATGGAGCTGTGGAATCAGTGCAGTATCTGAGAA GGGCTGAAACGACGACCTTGTCCTTTTATCCTTTTACGAATAACATCAAC TAAGAAGAAGTTCCCTATATGAGAGGGAGAGAGCGAAAAAGGTGTAGAAA TGAAAGCATCCTTAAGTATCTGCTTTACATCAGAATGAGACCCTAAAAAG GGGAAGGAAATATTAATTCTAGATTTAGCATCCAGGGCTTTAAAAGGATA CCTCTATTCCATAAATGTATCTACAGAAAAGAATTAGCCCTGATGCATTC AGGGGAAGTGATGTAAGACGTAAAGCCACTGGTCCTGTCCAAGGAGTCTA ATCTCATTTGCCAGTTCTGTGTTTCTGTGTGTCAGGACTCACAGTCATAA ACTAGACATGACAGTAAAAAAGCAGGCTTCCTTTCACGTCTTCTAAGACA GGGAAAATTAAA Balaenoptera physalus AATWAGATACTTTCCTGTGTTCGANAAAGGTAGGTGGCAGTGAAGCCTGT GAACGCGGCATCACCAGACCACAAACGCCCCTTTCTGCTCAGGCAGAGTA AAGCTGAGCCCTGCTAGACCAACCTCCTGAGGGCTCACAGGTGCCATCAG CACAAAGCCAGGATGTCTTGGAGCCGCCCAGACTCTTCCAGAGTCTTCCA TGTTTTCTGGGAAAAATATGGGCTCTCCCACGTGTGCATTGTCATTGCTT ACATTCGCCAGGTGCCACCTTGTGCAGGGTACAGAAGAGAAGAAGCCACC TACTTCATTCATTCGTTCATCATCCTACCTGATAGTTTGGTATAAAGAGA AGAACCATTGCTGTTTTATTTCTCTTCCCTGTGCTCTTTTTGTTTTCTCT TTTGTTACTTCTTGTCTCATTGCCGTATCTGTTTTTCTGAGCTTCAAACT CCTCCTCTCTTTTCCTCAACTGAGAGGGACTATTTTAAATGCTTCAATTA AAAAACAAGAGAACGTGAAAATCTGGAATTGGCAGAC
  17. 17. Interleukin 17
  18. 18. Prostaglandin-endoperoxide synthetase-2
  19. 19. tRNA syntetase
  20. 20. Glutathione S-transferase A4
  21. 21. Acknowledgement Dr. Steven Roberts Research Scientist Sam White National Oceanic and Atmospheric Association Seattle, Washington Jina Ylitalo Capstone Coordinator Greg Jensen
  22. 22. References Aguilar, A., Borrell, A., P.J.H., Reijnders. 2002. Geographical and temporal variation in levels of organochlorine contaminants in marine mammals. Marine Environmental Research. Vol.53:425–452 Baird, Robin W. 2002. Killer Whales of the world, Natural history and Conservation. Stillwater, MN.:Voyageur Press. Beineke, A., Siebert, U., Baumgartner, W. 2006. The immune system of marine mammals. Part 1: Immune response, cytokines and immunotoxicity. Tieraerztliche Paraxis Ausgabe Kleintiere Heimtiere. Vol.34(2): 118-126. Beineke, A., Siebert, U., Muller, G., Baumgartner, W. 2007. Increased blood interleukin-10 mRNA levels in diseased free-ranging harbor porpoises (Phocoena phocoena). Veterinary Immunology and Immunopathology. Vol.115: 100-106. Brunstrom B., Halldin K. 2000. Ecotoxicological risk assessment of environmental pollutants in the Arctic:Toxicology Letters 112–113:111–118. Chang, P.K., Dignam, J.D. 1990.Primary Structure of Alanyl-tRNA synthetase and the Regulation of Its mRNA Levels in Bombyx mori. The Journal of Biological Chemisrty. Vol. 265:34, pg. 20898-20906. Evans, P.G.H. 1987. The natural history of whales and dolphins. Christopher Helm, London, UK Forbes VE, Palmqvist A, Bach L. 2006. The use and misuse of biomarkers in ecotoxicology. Enviromental toxicology and chemistry. Vol.25(1): 272-280. Forney, KA. 2000. Environmental models of cetacean abundance: reducing uncertainty in population trends. Conservation B iology. Vol.14:1271–1286. Gilroy, D.W., Colville-Nash, P.R., Willis, D., Chivers, J., Paul-Clark, M.J., Willoughby, D.A. 1999. Inducible cyclooxygenase may have anti-inflammatory properties. Nature Medicine. Vol.5:6, pg. 698-701. Helliwell, R.J.A., Adams, L.F., Mitchell, M.D. 2004. Prostaglandin synthase: recent developments and novel hypothesis. Prostaglandins, Leukotrienes, and essential fatty acids. Vol 70, pg. 101-113. Hubatsch I., Ridderstorm M., and Mannervik B. 1998. Human Glutathione transferase A4-4: an alpha class enzyme with high catalytic efficiency in the conjugation of 4-hydroxynonenal and other genotoxic products of lipid peroxidation. Biochem. J., 330(Pt 1), 175-179. Kolls, Jay and A. Linden. 2004. Interluekin-17 Family Members and inflammation. Immunity. Vol. 21: 467-476. Misra, P., Srivastava S.K., Singhal S.S., Awasthi S., Awasthi, Y.C., and Boor P.J. 1995.Glutatione S-transferase 8-8 is localized in smooth muscle cells of rat aorta and is induced in an experimental model of atherosclerosis. Toxicology Appl. Pharmacol., 290, G222-G231. Moore, S. 2008. Marine mammals as ecosystem sentinels. Journal of Mammalogy. Vol.89(3):534–540. Moseley, T.A., Haudenschild, D.R., Rose, L., and Reddi, A.H. (2003). Interleukin-17 family and IL-17 receptors. Cytokine Growth Factor Rev. 14, 155–174.
  23. 23. References Park, S.G., Shimmel, P., Kim, S. 2008. Aminoacyl-tRNA synthetase and their connection to disease. PNAS. Vol. 105:34, pg. 11043-11049. Reeves, R.R. and E. Mitchell. 1987. COSEWIC status report on the grey whale (Eastern North Pacific population) Eschrichtius robustus in Canada. Committee on the Status of Endangered Wildlife in Canada. 36 pp. Silva, W.A., Jr., Covas, D.T., Panepucci, R.A., Proto-Siqueira, R., Siufi, J.L., Zanette, D.L., Santos, A.R., and Zago, M.A. (2003). The profile of gene expression of human marrow mesenchymal stem cells. Stem Cells 21, 661–669. Sitt, T., Bowen, L., Blanchard, M. T., Smith, B.R., Gershwin, L. J., Byrne, B. A., Stott, J. L.2008. Quantitation of Leukocyte Gene Expression in Cetaceans. Developmental and Comparative Immunology. Vol. 32, pg. 1253 – 1259. Stoneg, L.,Florez-Gonzalaenzd S.K., Katona. 1990. Whale migration record. Nature, London. Vol. 346:705. Tanabe, S. 2002. Contamination and toxic effects of persistent endocrine disrupters in marine mammals and birds. Marine Pollution Bulletin. Vol.45: 69–77. World Wildlife Fund (2007, May 23). Whales In Hot Water: Global Warming's Effect On World's Largest Creatures. ScienceDaily. Retrieved June 2, 2009, from http://www.sciencedaily.com- /releases/2007/05/070522125023.htm Yang, Y., Yang, Y., Trent, M.B., He, N., Lick, S.D., Zimniak, P., Awasthi Y.C., and Boor P.J. 2004. Glutathione-S-Transferase A4-4 modulates oxidative stress inendothelium: possible role in human atherosclerosis. Atherosclerosis, 173, 211-221. Xu, Y., Gong, B., Yang, Y., Awasthi, Y.C., Woods, M., Boor, P.J. 2007. Glutathione-S-transferase protects against oxidative injury of endothelial cell tight junctions. Endothelium, 14:333-343.

×