Bay Scallop Genetic Resources and Applications

Bay Scallop Genetic Resources and Applications - Presentation Transcript

Overview and Application of Bay Scallop Genomic Resources Steven Roberts Marine Biological Laboratory Woods Hole, MA USA

Bay Scallop -fishery product -aquaculture product -scientific model -muscle biology -photoreception -essential environmental component

Outline

Metamorphosis

DEG

ESTs (overview) [ example Iodothyronine Deiodinase ]

Muscle Growth

Candidate Gene [ example Myostatin ]

Other uses for ESTs

Environmental response

Population genetics and restoration evaluations

Available markers

Metamorphosis Trocophore -> D-hinge Between day 9-20 larvae first become “competent” then metamorphose into adult form . High Mortality

Why study bay scallop metamorphosis?

Evolutionary Perspective

Determine suitable natural habitat for successful recruitment

Baseline information for identifying abnormalities

Optimize aquaculture production

Approach Comparative transcriptomic analysis of developing bay scallops prior to (D-hinge), during (pediveliger), and following metamorphosis (spat)

Differentially Expressed Genes (DEG) Primer Pair B Primer Pair A Primer Pair C

Differentially Expressed Genes (DEG) “ D” hinge pediveliger spat “ D” hinge pediveliger spat * * * * Arbitrary Primers: MW ACP 22 ACP 29 a= Heat shock protein 70 b= serine protease precursor c= pheromone receptor “ D” hinge pediveliger spat “ D” hinge pediveliger spat ACP 27 ACP 28 a b c

Expressed Sequence Tags (ESTs) agtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc ttcgctgacacagtcgacagtcn agtacgtaccgatcgcgcgcc agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc tcgctgacacagtcgacagtc agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctannnggttctcgttga ttcgctgacacagtcgacagtcn mRNA cDNA mRNA cDNA mRNA cDNA Data Processing

ESTs

Individual clones sequenced

D-hinge 671

Met 61

Set 932

Adductor 367

Gonad 58

8% sequences <200 bp

Average length - 719 bp

970 singletons

217 contigs

ESTs

A. irradians

ESTs 7057

CoreNucleotides 85

Contigs 845

Singletons 2746

Unique Seqs 3591

C.gigas granulocyte

Zap Express cDNA library

- 2646 ESTs sequenced and annotated

- 343 contigs and 1319 singletons

1662 Unique Seqs

>40% not identified previously

Hind limbs, rapid differentiation Fore-limb emergence to complete tail reabsorption Acquisition of hypothalamic sensitivity to thyroid hormones Premetamorphosis Prometamorphosis Climax Postmetamorphosis T3/T4 TSH TRH Frog Metamorphosis

Iodothyronine Deiodinase Type 2 ID enzyme required for production of active thyroid hormone

Tissue Distribution in Adult Bay Scallops

Endostyle

Mucus secreting pharyngeal organ that facilitates filter feeding. Iodine concentrating ability and can synthesize thyroid hormone.

T-iso Day 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 T-iso T-iso T-iso T-iso T-iso T-iso T-iso T-iso T-iso Deiodinase u ( ai Du) Deiodinase v ( ai Dv) CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso

Interrelationship with External Factors Diet: Pavlova (e.g. CCMP549) has over 3 times more (%) phenylalanine than Isochrysis Differential uptake by algae of selenium. Selenium required for synthesis of deiodinases.

Does myostatin function in a similar manner in shellfish as it does in mammals? = =

Myostatin expression in fish

Scallop Myostatin Real-time RT-PCR – Dual labeled probes Northern Blot At least 6 times higher expression in adductor muscle tissue Heart 1 Heart 2 Gill 1 Gill 2 Digestive Gland 1 Digestive Gland 2 Gonad 1 Gonad 2 Mantle 1 & 2 Muscle 1 & 2

Myo-Blast Experiment Figure 5. PCR products from RNA from adult scallops (N=2) treated with MyoZap and not treated (contols). Differentially expressed genes are indicated with lower case letters. Cyclin T

Myo-Blast Experiment Control Experimental

Other uses of ESTs

Enhancement Broodstock Condition Spawn x x

Seed Wellfleet Chatham Dennis 32 101

EST-SSR M26 Wellfleet Chatham Dennis 40 10 30 Falmouth Chilmark 20km

Wellfleet Dennis 32 101 Chatham g340 m26 n391 s336 Diver (aug) Diver (nov) Diver (nov) Spat Bag

Regional N391 G340 M26 N391 G340 M26

Other Bay Scallop Markers