Bay Scallop Genetic Resources and Applications

Loading...

Flash Player 9 (or above) is needed to view presentations.
We have detected that you do not have it on your computer. To install it, go here.

0 comments

Post a comment

    Post a comment
    Embed Video
    Edit your comment Cancel

    Favorites, Groups & Events

    Bay Scallop Genetic Resources and Applications - Presentation Transcript

    1. Overview and Application of Bay Scallop Genomic Resources Steven Roberts Marine Biological Laboratory Woods Hole, MA USA
    2. Bay Scallop -fishery product -aquaculture product -scientific model -muscle biology -photoreception -essential environmental component
    3. Outline
      • Metamorphosis
        • DEG
        • ESTs (overview) [ example Iodothyronine Deiodinase ]
      • Muscle Growth
        • Candidate Gene [ example Myostatin ]
      • Other uses for ESTs
        • Environmental response
        • Population genetics and restoration evaluations
          • Available markers
    4. Metamorphosis Trocophore -> D-hinge Between day 9-20 larvae first become “competent” then metamorphose into adult form . High Mortality
    5. Why study bay scallop metamorphosis?
      • Evolutionary Perspective
      • Determine suitable natural habitat for successful recruitment
      • Baseline information for identifying abnormalities
      • Optimize aquaculture production
    6. Approach Comparative transcriptomic analysis of developing bay scallops prior to (D-hinge), during (pediveliger), and following metamorphosis (spat)
    7. Differentially Expressed Genes (DEG) Primer Pair B Primer Pair A Primer Pair C
    8. Differentially Expressed Genes (DEG) “ D” hinge pediveliger spat “ D” hinge pediveliger spat * * * * Arbitrary Primers: MW ACP 22 ACP 29 a= Heat shock protein 70 b= serine protease precursor c= pheromone receptor “ D” hinge pediveliger spat “ D” hinge pediveliger spat ACP 27 ACP 28 a b c
    9. Expressed Sequence Tags (ESTs) agtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc ttcgctgacacagtcgacagtcn agtacgtaccgatcgcgcgcc agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc tcgctgacacagtcgacagtc agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctannnggttctcgttga ttcgctgacacagtcgacagtcn mRNA cDNA mRNA cDNA mRNA cDNA Data Processing
    10. ESTs
      • Individual clones sequenced
        • D-hinge 671
        • Met 61
        • Set 932
        • Adductor 367
        • Gonad 58
      • 8% sequences <200 bp
      • Average length - 719 bp
      • 970 singletons
      • 217 contigs
    11. ESTs
      • A. irradians
        • ESTs 7057
        • CoreNucleotides 85
      • Contigs 845
      • Singletons 2746
      • Unique Seqs 3591
      • C.gigas granulocyte
      • Zap Express cDNA library
      • - 2646 ESTs sequenced and annotated
      • - 343 contigs and 1319 singletons
      • 1662 Unique Seqs
      • >40% not identified previously
    12. Hind limbs, rapid differentiation Fore-limb emergence to complete tail reabsorption Acquisition of hypothalamic sensitivity to thyroid hormones Premetamorphosis Prometamorphosis Climax Postmetamorphosis T3/T4 TSH TRH Frog Metamorphosis
    13. Iodothyronine Deiodinase Type 2 ID enzyme required for production of active thyroid hormone
      • Tissue Distribution in Adult Bay Scallops
        • Endostyle
      Mucus secreting pharyngeal organ that facilitates filter feeding. Iodine concentrating ability and can synthesize thyroid hormone.
    14. T-iso Day 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 T-iso T-iso T-iso T-iso T-iso T-iso T-iso T-iso T-iso Deiodinase u ( ai Du) Deiodinase v ( ai Dv) CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso
    15. Interrelationship with External Factors Diet: Pavlova (e.g. CCMP549) has over 3 times more (%) phenylalanine than Isochrysis Differential uptake by algae of selenium. Selenium required for synthesis of deiodinases.
    16. Does myostatin function in a similar manner in shellfish as it does in mammals? = =
    17. Myostatin expression in fish
    18. Scallop Myostatin Real-time RT-PCR – Dual labeled probes Northern Blot At least 6 times higher expression in adductor muscle tissue Heart 1 Heart 2 Gill 1 Gill 2 Digestive Gland 1 Digestive Gland 2 Gonad 1 Gonad 2 Mantle 1 & 2 Muscle 1 & 2
    19. Myo-Blast Experiment Figure 5. PCR products from RNA from adult scallops (N=2) treated with MyoZap and not treated (contols). Differentially expressed genes are indicated with lower case letters. Cyclin T
    20. Myo-Blast Experiment Control Experimental
    21. Other uses of ESTs
    22.  
    23. Enhancement Broodstock Condition Spawn x x
    24. Seed Wellfleet Chatham Dennis 32 101
    25. EST-SSR M26 Wellfleet Chatham Dennis 40 10 30 Falmouth Chilmark 20km
    26. Wellfleet Dennis 32 101 Chatham g340 m26 n391 s336 Diver (aug) Diver (nov) Diver (nov) Spat Bag
    27. Regional N391 G340 M26 N391 G340 M26
    28. Other Bay Scallop Markers
      • EST-SSRs
      • “ Conventional” Microsats (Poster)
    29. EST-SNPs
    30. Acknowledgments
      • USDA-NRI 2003-35206-12834
      • Barnstable County, MA - CCCE
      • Linda McCauley & Christina Romano
          • TECHNICAL [mbl]
      • Hyun-Woo Kim & Don Mykles
          • MYOSTATIN [csu]
      • Chris Dickson & Adam Bisonette
          • MYOSTATIN [undergraduate students]
      • Gary Wikfors & Mark Dixon
          • METAMORPHOSIS [nmfs]
      • Gabriele Gerlach
          • GENETICS [mbl]
      • Steve Tettlebach & Maria Kretzman
          • GENETICS New York [liu]

    sr320sr320, 2 years ago

    custom

    603 views, 0 favs, 1 embeds more stats

    More Info

    © All Rights Reserved

    Go to text version
    • Total Views 603
      • 587 on SlideShare
      • 16 from embeds
    • Comments 0
    • Favorites 0
    • Downloads 10
    Most viewed embeds
    • 16 views on http://genefish.tumblr.com

    more

    All embeds
    • 16 views on http://genefish.tumblr.com

    less

    Flagged as inappropriate Flag as inappropriate
    Flag as innappropriate

    Select your reason for flagging this presentation as inappropriate. If needed, use the feedback form to let us know more details.

    Cancel

    Categories