Your SlideShare is downloading. ×
Bay Scallop Genetic Resources and Applications
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×

Introducing the official SlideShare app

Stunning, full-screen experience for iPhone and Android

Text the download link to your phone

Standard text messaging rates apply

Bay Scallop Genetic Resources and Applications

1,199
views

Published on

Published in: Technology

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
1,199
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
10
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide
  • Transcript

    • 1. Overview and Application of Bay Scallop Genomic Resources Steven Roberts Marine Biological Laboratory Woods Hole, MA USA
    • 2. Bay Scallop -fishery product -aquaculture product -scientific model -muscle biology -photoreception -essential environmental component
    • 3. Outline
      • Metamorphosis
        • DEG
        • ESTs (overview) [ example Iodothyronine Deiodinase ]
      • Muscle Growth
        • Candidate Gene [ example Myostatin ]
      • Other uses for ESTs
        • Environmental response
        • Population genetics and restoration evaluations
          • Available markers
    • 4. Metamorphosis Trocophore -> D-hinge Between day 9-20 larvae first become “competent” then metamorphose into adult form . High Mortality
    • 5. Why study bay scallop metamorphosis?
      • Evolutionary Perspective
      • Determine suitable natural habitat for successful recruitment
      • Baseline information for identifying abnormalities
      • Optimize aquaculture production
    • 6. Approach Comparative transcriptomic analysis of developing bay scallops prior to (D-hinge), during (pediveliger), and following metamorphosis (spat)
    • 7. Differentially Expressed Genes (DEG) Primer Pair B Primer Pair A Primer Pair C
    • 8. Differentially Expressed Genes (DEG) “ D” hinge pediveliger spat “ D” hinge pediveliger spat * * * * Arbitrary Primers: MW ACP 22 ACP 29 a= Heat shock protein 70 b= serine protease precursor c= pheromone receptor “ D” hinge pediveliger spat “ D” hinge pediveliger spat ACP 27 ACP 28 a b c
    • 9. Expressed Sequence Tags (ESTs) agtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc ttcgctgacacagtcgacagtcn agtacgtaccgatcgcgcgcc agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc tcgctgacacagtcgacagtc agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctaagtacgtaccgat agcatgatgcatgcatgctagc agcattacgagctagcgcattc gcaagctannnggttctcgttga ttcgctgacacagtcgacagtcn mRNA cDNA mRNA cDNA mRNA cDNA Data Processing
    • 10. ESTs
      • Individual clones sequenced
        • D-hinge 671
        • Met 61
        • Set 932
        • Adductor 367
        • Gonad 58
      • 8% sequences <200 bp
      • Average length - 719 bp
      • 970 singletons
      • 217 contigs
    • 11. ESTs
      • A. irradians
        • ESTs 7057
        • CoreNucleotides 85
      • Contigs 845
      • Singletons 2746
      • Unique Seqs 3591
      • C.gigas granulocyte
      • Zap Express cDNA library
      • - 2646 ESTs sequenced and annotated
      • - 343 contigs and 1319 singletons
      • 1662 Unique Seqs
      • >40% not identified previously
    • 12. Hind limbs, rapid differentiation Fore-limb emergence to complete tail reabsorption Acquisition of hypothalamic sensitivity to thyroid hormones Premetamorphosis Prometamorphosis Climax Postmetamorphosis T3/T4 TSH TRH Frog Metamorphosis
    • 13. Iodothyronine Deiodinase Type 2 ID enzyme required for production of active thyroid hormone
      • Tissue Distribution in Adult Bay Scallops
        • Endostyle
      Mucus secreting pharyngeal organ that facilitates filter feeding. Iodine concentrating ability and can synthesize thyroid hormone.
    • 14. T-iso Day 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 T-iso T-iso T-iso T-iso T-iso T-iso T-iso T-iso T-iso Deiodinase u ( ai Du) Deiodinase v ( ai Dv) CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso CCMP 459 T-iso
    • 15. Interrelationship with External Factors Diet: Pavlova (e.g. CCMP549) has over 3 times more (%) phenylalanine than Isochrysis Differential uptake by algae of selenium. Selenium required for synthesis of deiodinases.
    • 16. Does myostatin function in a similar manner in shellfish as it does in mammals? = =
    • 17. Myostatin expression in fish
    • 18. Scallop Myostatin Real-time RT-PCR – Dual labeled probes Northern Blot At least 6 times higher expression in adductor muscle tissue Heart 1 Heart 2 Gill 1 Gill 2 Digestive Gland 1 Digestive Gland 2 Gonad 1 Gonad 2 Mantle 1 & 2 Muscle 1 & 2
    • 19. Myo-Blast Experiment Figure 5. PCR products from RNA from adult scallops (N=2) treated with MyoZap and not treated (contols). Differentially expressed genes are indicated with lower case letters. Cyclin T
    • 20. Myo-Blast Experiment Control Experimental
    • 21. Other uses of ESTs
    • 22.  
    • 23. Enhancement Broodstock Condition Spawn x x
    • 24. Seed Wellfleet Chatham Dennis 32 101
    • 25. EST-SSR M26 Wellfleet Chatham Dennis 40 10 30 Falmouth Chilmark 20km
    • 26. Wellfleet Dennis 32 101 Chatham g340 m26 n391 s336 Diver (aug) Diver (nov) Diver (nov) Spat Bag
    • 27. Regional N391 G340 M26 N391 G340 M26
    • 28. Other Bay Scallop Markers
      • EST-SSRs
      • “ Conventional” Microsats (Poster)
    • 29. EST-SNPs
    • 30. Acknowledgments
      • USDA-NRI 2003-35206-12834
      • Barnstable County, MA - CCCE
      • Linda McCauley & Christina Romano
          • TECHNICAL [mbl]
      • Hyun-Woo Kim & Don Mykles
          • MYOSTATIN [csu]
      • Chris Dickson & Adam Bisonette
          • MYOSTATIN [undergraduate students]
      • Gary Wikfors & Mark Dixon
          • METAMORPHOSIS [nmfs]
      • Gabriele Gerlach
          • GENETICS [mbl]
      • Steve Tettlebach & Maria Kretzman
          • GENETICS New York [liu]