• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content

Loading…

Flash Player 9 (or above) is needed to view presentations.
We have detected that you do not have it on your computer. To install it, go here.

Like this document? Why not share!

Rekayasa genetik dan teknik

on

  • 6,268 views

 

Statistics

Views

Total Views
6,268
Views on SlideShare
6,268
Embed Views
0

Actions

Likes
4
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Upload Details

Uploaded via as Microsoft PowerPoint

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment
  • Figure 9.13
  • Figure 9.15
  • Figure 9.15 (cont’d)
  • Figure 9.12 b
  • Figure 9.17
  • Figure 9.17
  • Figure 9.17
  • Figure 9.18 a
  • Figure 9.18 b
  • Figure 9.18 c

Rekayasa genetik dan teknik Rekayasa genetik dan teknik Document Transcript

  • BIOTEKNOLOGI – REKAYASA SEL – JARINGAN REKAYASA GENETIK DAN TEKNIK TEKNIKNYA   Siti Julaiha / 0906597420 Pasca Sarjana Teknologi Biomedis Universitas Indonesia Pasca Sarjana Teknologi Biomedis Universitas Indonesia [Mei 2010]
  • Apa itu Gen? Gen -  subunit pekerja dari DNA. DNA --- > database informasi kimia instruksi membuat protein DNA-  dua pasang rantai heliks ganda Blok base DNA : Adenin, Timin, Sitosin, dan Guanin. 1 SEL = 46 molekul DNA untai ganda.   1 MOLEKUL DNA = 50-250000000 basis pada kromosom. DNA ---  messenger RNA (mRNA)  keluar nukleus menuju ke sitoplasma =  pada ribosom, --  molekul protein GENETIK
  • Gen-membawa kunci untuk kesamaan kita dan warisan keunikan; KERUSAKAN GEN >>> cacat dan penyakit, bahkan kematian GENETIK
  • Sel manusia .==  2 set kromosom, dari ibu dan ayah.  Tiap set = 23 kromosom tunggal = 22 autosom dan kromosom X atau Y seks..  (Wanita mewarisi X dari orang tua masing-masing, sementara laki-laki mendapat X dari ibu dan Y dari ayah.) GEN =  STRUKTUR DAN BENTUK PROTEIN --  BENTUK DAN FUNGSI SEL GENETIK
  • Bagaimana cara kerja gen? GEN -  PROTEIN =  FUNGSI DASAR , GEN HOUSEKEEPING >> AKTIF DI BERBAGAI SEL GEN  TIDAK AKTIF HAMPIR SEPANJANGN WAKTU GEN  HANYA BERFUNGSI PADA AWAL EMBRIO GEN  PROTEIN UNIK  KARAKTER UNIK SEL GEN  MUTASI, KERUSAKAN  Lebih dari 4.000 penyakit GENETIK
    • MUTASI GEN :
    • BASE MERUBAH BASE DNA (misspelling)
    • KEHILANGAN ATAU KELEBIHAN BASE
    • TIDAK TERLIHAT (SILENT)  STRUKTUR, FUNGSI TIDAK PENGARUH
    • MUTASI LAIN
    •  PERUBAHAN PROTEIN STRUKTUR DAN FUNGSI (CACAT HAEMOGLOBIN  SICKLE CELL ANEMIA)
    •  HILANG FUNGSI PROTEIN TOTAL
    MUTASI GENETIK
  • MUTASI BERBEDA PADA GEN YANG SAMA MENGHASILKAN EFEK BERBEDA CONTOH PROUKSI GEN MUCUS  300 MUTASI GEN  BEBERAPA SIMPTOM BERAT, BEBERAPA SIMPTON MENENGAH, TIDAK ADA SIMPTON SAMA SEKALI MUTASI GENETIK
    • MUTASI GERMLINE :
    • WARISAN ORANG TUA  PERUBAHAN GEN PADA SEL REPRODUKSI AWAL  PEMBELAHAN SEL  AKUMULASI  DNA SEMUA SEL TUBUH  DITURUNKAN
    • ACQUIRED MUTASI / MUTASI SOMATIK:
    • MUTASI DNA  KESALAHAN GEN PADA SEL TERTENTU  BERKEMBANG SAAT HIDUP
    • KESALAHAN SAAT PEMBELAHAN SEL
    • DAMPAK LINGKUNGGAN (RADIASI, RACUN)
    •  PERUBAHAN DNA SEL INDIVIDU
    MUTASI GENETIK
    • GANGGUAN GEN RESESIF
    • KEDUA ORANG TUA  FREE DESEASE
    •  SATU ALEL NORMAL, SATU MUTASI ALEL  DITURUNKAN  PROBABILITAS ANAK 
    • ¼ DUA MUTASI ALEL / AFFECTED,
    • ½ SEL NORMAL DAN ALEL / CARRIER,
    • ¼ ALEL NORMAL
    GANGGUAN GEN DOMINAN  SALAH SATU ORANG TUA  ALEL PENYEBAB PENYAKIT  DOMINASI SEL NORMAL  50% PROBABILITAS DITURUNKAAN PADA SETIAP ANAK MUTASI GENETIK
  • SEJARAH Jack Williamson’s Science Fiction Novel Dragon Island, 1951, ISTILAH GENETIC ENGINEERING 1952  JAMES WATSON, FRANCIS CRICK  STRUKTUR DAN FUNGSI DNA Rekayasa Genetic  1960’an  TEKNIK LABORATORIUM MERUBAH DNA ORGANISME HIDUP REKAYASA GENETIK
  • REKAYASA GENETIK GOAL
    • Menyisipkan gen ke spesies lainnya
    • Mengisolasi gen tertentu
    • Memproduksi RNA yang diinginkan atau molekul protein
    • Membentuk organisme transgenik
    • Merubah gen  perubahan produk gen
    • Merubah ekspresi gen  memberikan informasi dan aplikasi lain
    • Mengkoreksi cacat gen pada organisme komplek
    • Meningkatkan efisiensi produksi enzim dan obat
  • TEKNIK REKAYASA GENETIK REKAYASA GENETIK  TEKNOLOGI REKOMBINAN DNA  PENGUBAHAN GEN  GENETIK MODIFIKASI ORGANISM (GMO)  GENOME TIPE BARU METODE REKOMBINASI DNA : PENGGUNAAN BIOLOGIS VEKTOR (PLASMID/VIRUS)
  • TEKNIK REKOMBINASI DNA
    • 1. MEMOTONG RANTAI PANJANG DNA MENJADI FRAGMEN YANG LEBIH KECIL DENGAN ENZIM RESTRIKSI DAN MEMISAHKAN DENGAN GEL ELEKTROPHORESIS
    • (PEMOTONGAN-PEMETAAN DNA)
    • 2. ISOLASI, MEMPERBANYAK/ AMPLIFIKASI, DAN MEMURNIKAN FRAGMEN MELALUI MOLEKUL CLONING
    • (MENYISIPKAN GEN KE VEKTOR, MENYISIPKAN VEKTOR KE HOST), REPLIKASI, MULTIFIKASI)
    9- DIGUNAKAN UNTUK MELAKSANAKAN LIMA OPERASI DASAR DALAM REKAYASA GENETIK YAITU
    • 3. MENGGUNAKAN FRAGMEN DNA YANG TELAH DIMURNIKAN SEBAGAI PROBE HIBRIDISASI UNTUK MENGIDENTIFIKASI SUSUNAN YANG SERUPA PADA LIBRARIES CLONE ATAU MIXED MOLEKUL DNA DAN RNA
    • ( HIBRIDISASI , PROBE, LIBRARIES )
    • 4. MENGISOLASI SECARA CEPAT DAN MEMPERBANYAK GENOME ATAU SUSUNAN mRNA YANG TELAH DITENTUKAN SEBELUMNYA MELALUI POLYMERASE CHAIN REACTION(PCR)
    • (PRODUKSI GEN)
    • 5. MENENTUKAN SUSUNAN BASE YANG TEPAT DENGAN MENGISOLASI FRAGMEN DNA
    • (ISOLASI FRAGMEN DNA)
    9- TEKNIK REKOMBINASI DNA
  • E. coli is the most widely used cloning host for amplification of recombinant DNA http://www.bmb.psu.edu/courses/micro106/biotech/biotechover.jpg TEKNIK REKOMBINASI DNA
  • http://www.bmb.psu.edu/courses/micro106/biotech/biotech.htm TEKNIK REKOMBINASI DNA
  • Plasmids adalah potongan-potongan lingkaran genetik pada bakteri yang memiliki kemampuan untuk melewati batas spesies. Lingkaran dapat dipecah dan materi genetik baru ditambahkan dan menempatkan materi genetik baru terhadap gen bakteri itu sendiri. Virus juga dapat bertindak sebagai vektor dalam rekayasa genetika. Virus adalah partikel yang menular berisi materi genetik yang dapat dikombinasikan dengan sebuah gen baru. Virus ini dapat membawa gen baru ke dalam sel penerima dalam proses menginfeksi sel tersebut.  Juga dapat dinonaktifkan sehingga saat membawa gen baru ke dalam sel, virus tidak dapat menjalankan mesin genetik sel untuk membuat ribuan salinan itu sendiri. PLASMID/VEKTOR
    • VECTORS PEMBAWA GEN
    • Jenis Jenis Vektor diantaranya :.
      • retroviruses
      • adenoviruses
      • adeno-associated viruses (AAV)
      • herpes simplex virus
      • rhinoviruses
      • Human Immunodeficiency Virus (HIV)
      • pBR322 and pUC plasmids
      • phage lambda , untai tunggal DNA phages (berguna karena susunan DNA dibawa pada untai tunggal DNA pada Metode Sanger)
      • cosmids (hybrids dari phage lambda dan plasmids, sangat berguna karena digunakan untuk menyisipkan fragmen DNA yang relatif besar pada sel host
    PLASMID/VEKTOR
    • Vektor mengatasi masalah tidak berlangsungnya replikasi kerena memiliki sifat :
    • Cukup besar untuk membawa terus gen yang diinginkan
    • Namun cukup kecil untuk mengalami degradasi saat purifikasi atau proses pemurnian.
    • Bentuk sirkular/ lingkaran (atau lebih tepatnya loop tertutup), mengurangi faktorkerusakan
    • Memiliki sifat replikasi alam sehingga DNA endogenote dapat direplikasi dengan sel host.
    • mengandung susunan pengendali, seperti promotor transkripsi sehingga gen akan direplikasi atau diekspresikan.
    • Memiliki beberapa site restriksi unik sehingga vektor DNA akan terpotong pada lokasi yang diinginkan, dan beberapa lokasi untuk menyisipkan DNA asing
    • Mengandung Gen Marker/Penanda, seperti gen resitansi antibiotik, yang dapat mengidentifikasi sel-sel vektor untuk menganalisa proses transformasi.
    PLASMID/VEKTOR
    • EUKARIOTIK VEKTOR DIGUNAKAN :
    • DNA plasmid dan vektor bakteri tidak cukup memadai. 
    • E. coli tidak memiliki beberapa sistem enzim perubahan post-transcriptional/ post-translational protein. 
    • Studi fungsi genom eukariotik in vivo
    • Bidang kesehatan dan pertimbangan ekonomi
    EUKARYOTIC VECTORS
    • VEKTOR KHUSUS UNTUK HEWAN
    • Virus tumor DNA SV40 (Virus monyet vacuolating virus) - mengubah sel-sel eukariota normal menjadi sel kanker.
    • SV40 membawa DNA asing.
    • Dapat direplikasi dalam sel-sel eukariotik untuk kloning DNA
    • Virus lain dengan afinitas sel-sel hewan
    EUKARYOTIC VECTORS
    • VEKTOR KHUSUS UNTUK TANAMAN
    • Bakteri tanah Agrobacterium tumefaciens dikenal penyebab tumor tumbuhan dikotil empedu. 
    • Agen penyebab tumor plasmid Ti, mengubah sel tanaman normal menjadi sel kanker saat integrasi ke DNA tanaman. 
    • (Petunjuk vektor yang baik!!).
    • Genetika DNA asing ke plasmid, afinitas DNA tanaman dikotil untuk memfasilitasi penyisipan gen baru ke dalam tanaman.
    EUKARYOTIC VECTORS
  • PEMOTONGAN DNA
    • PEMOTONGAN DNA PADA BASE SPESIFIK
    • PEMOTONGAN DENGAN ENZIM RETRIKSI YANG SAMA (ENZIM EX EcoR1, HANYA MEMOTONG PADA BASE SPESIFIK, 4-8 PASANG BASE)
    • DNA  FRAGMEN RESTRIKSI
    • STICKE END ANNEAL KE DNA LAIN DENGAN PASANGAN BASE KOMPLEMENTER
    Pemotongan gen dengan menggunakan RESTRIKSI ENDONUKLEASE
  • PEMOTONGAN DNA Sticky Ends (Ujung Kohesif)
  • Teknnik Penghancuran sebagian  enzim memotong hanya sebagian dari total jumlah situs rekognasi pada genom Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- PEMOTONGAN DNA
  • Membuat komplek framen gen menjadi beberapa bagian Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- PEMOTONGAN DNA
  • Jumlah pasangan base dari enzim restriksi memulai penentuan jarak rata rata antara sites dan kemudian ukuran fragmen diproduksi
    • Kemungkinan empat base site rekognasi ditemukan pada =
    • ¼ x ¼ x ¼ x ¼ = 1/256.
    Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- PEMOTONGAN DNA
  • DNA plasmid / vektor sisipan (produk PCR) menggunakan enzim polimerase Taq , Menambahkan Adenin (A) yang mengantung pada ujung 3‘  Pemotongan secara tumpul  Penambahan ujung T yang menggantung dengan jalan mereaksikan ujung 3‘ DNA yang tumpul dengan dTTP menggunakan katalisator enzim polimerase Taq. Eisiensi proses ligasi DNA ujung tumpul tidak sebaik ujung kohesif dan lebih sulit dalam memperoleh plasmid rekombinasi. Pemotongan gen dengan menggunakan Kloning TA PEMOTONGAN DNA
  • Pada Gambar A terlihat enzim memotong molekul DNA pada lokasi spesifik TA dan memproduksi blunt ends. Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- PEMOTONGAN DNA
  • PEMOTONGAN DNA DNA  UNTAI TUNGGAL DENGAN ENZIM REVERSE TRANSKRIPSI  mRNA DIKONVERSI ENZIM DNA POLYMERASI  UNTAI GANDA / KOMPLEMENTARI DNA  DISEBUT cDNA Reverse transkripsi primed dari poly-A ditemukan pada hampir semua eukaryotic mRNAs Banyak variasi membuat rantai DNA kedua Rantai diciptakan menggunakan enzim kedua yang diprime kan melalui generasi Hairpin DNA dengan reverse transkripsi Pemotongan gen dengan menggunakan Reverse Transkripsi
  • Pemetaan restriksi disimpulkan dari pemotongan fragmen DNA dengan dua enzim, menyediakan alur peta fragmen DNA dan Genome Virus
    • Langkah untuk menentukan susunan site restriksi sepanjang fragmen DNA:
      • Pembagian pemurnian untuk cloned DNA menjadi tiga bagian/aliquots
      • Potong satu aliquot dengan Eco RI, satu dengan with Bam HI, dan yang ketiga dengan kedua enzim
      • Pisahkan fragmen dengan Gel Electrophoresis
      • Tentukan ukuran dengan perbandingan pada ukuran standar
      • Gunakan proses eliminasi untuk menghasilkan hanya susunan yang dapat menghitung ukuran fragmen yang didapat pada ketiga aliquot
    9- Restriction mapping PEMETAAN DNA
  • Restriction mapping Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- PEMETAAN DNA
  • Gel electrophoresis dan Blotting adalah teknik analisa yang umum digunakan untuk pemetaan DNA fragments
    • Southern blot
    • adalah metode penting untuk mengisolasi dan menguji Klone DNA
    9- PEMETAAN DNA SOUTHERN BLOT
    • mRNA memiliki sedikit introns, ada wilayah komplementer dari gen, probe bekerja, bahkan jika intron membentuk "outloopings" pada hibrida probe-DNA. .
    • Penggunaan autoradiograf untuk pengambilan gambar pada film ini yang dibentuk oleh paparan pada suatu radioaktivitas.
    • Northern Blot :untuk menguji RNA
    • Western Blot :untuk menguji protein melalui pengikatan antibody
    • Langkah langkahnya sebagai berikut :
      • Potong seluruh Gen DNA dengan enzim restriksi
      • Pisahkan fragmen DNA fragments dengan Electrophoresis.
      • Blot fragment DNA terhadap filter.
      • Hybridisasi DNA ke probe.
      • Amati band/rantai yang sesuai dengan Autoradiograph atau Fluorescence.
    PEMETAAN DNA SOUTHERN BLOT
  • SOUTHERN BLOT http://www.bio.miami.edu/dana/250/25003_10.html
    • Metode transfer gen langsung melibatkan pembentukan pori-pori atau lubang membran sel untuk masuknya gen baru. 
    • Dilakukan dengan :
    • Bathing sel larutan kimia khusus / Bahan kimia poration
    • Pengarahan sel sel kepada arus listrik lemah yang disebut Elektroporasi.
    • Berdasarkan :
    • - Perbedaan ukuran molekul
    • Perbedaan sifat perpindahan Kimia /listrik Fragmen DNA bermigrasi ke arah kutub positif (sugar phospate backbone adalah bermuatan negatif).
    • Jarak Migrasi berbanding terbalik dengan logaritma dari panjang fragmen (dalam basis pasangan).
    ELECTROPHORESIS PEMETAAN DNA
    • Elektrophoresis ada dua jenis
      • Polyacrylamide gels
      • Agarose gels
    • Polyacrylamide Gels
      • Memisahkan fragmen DNA hingga 1000 bp long
      • Kekuatan penyelesaian yang lebih tinggi dibanding agarose
      • Memisahkan fragmen yang berbeda pada single nucleotide panjang
    • Agarose Gels
      • Memisahkan campuran fragmen up to 20 kb
      • Mudah disiapkan
      • Memiliki Resolusi yang lebih rendah
    ELECTROPHORESIS PEMETAAN DNA
    • Agarose Gel Electrophoresis
      • Polimer Karbohidrat dimurnikan dari air garam algae
      • Kopolimer dari mannose dan galactose
      • Melebur dan mendingin menjadi bentuk gel dengan variasi ukuran lubang/pore
      • Overall kecepatan konsentrasi agarose :Pulsed-field gel electrophoresis
      • Migrasi DNA - Negative charged phosphate backbone
        • size DNA fragments- compared to standard
    Pemitaan gel divisualisasikan dengan sumber cahaya UV central dye Ethidium Bromide Fluorescent under UV light ELECTROPHORESIS PEMETAAN DNA
    • Persiapan Agarose gel untuk Elektroporesis
    Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- ELECTROPHORESIS PEMETAAN DNA
    • Visualisasi Fragmen DNA pada Agarose gel
    Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- ELECTROPHORESIS PEMETAAN DNA
  • http://www.bio.miami.edu/dana/250/25003_10.html ELECTROPHORESIS PEMETAAN DNA
  • Visualisasi Fragmen DNA pada Agarose Gel. Poliakrilamida Gel memisahkan framen kecil DNA dan Agarose gel memisahkan fragmen yang lebih besar Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- ELECTROPHORESIS PEMETAAN DNA
  • PENYISIPAN GENE KE VEKTOR
    • - Duplikasi gen hasil pada langkah sebelumnya.
    • Gen dimasukkan dalam organisme lain/ vector untuk menghasilkan rancangan yang telah ditetapkan.
    • Fragmen DNA dimasukkan ke Plasmid menggunakan restriksi dan enzim liase. 
    • Enzim restriksi (PstI), memotong plasmid pada bagian tengah salah satu dari marker gen. 
    • DNA asing anneal dengan plasmid dan bergabung kovalen oleh DNA ligase membentuk vektor hibrida (hibrida DNA bakteri-DNA asing). 
    • Produk lain :
    • Plasmid reanneal membentuk plasmid asli,
    • Fragmen DNA bergabung membentuk rantai  
    • Produk berbeda dipisahkan dengan gen penanda, dan mengidentifikasi vektor hibrida.
    PENYISIPAN GENE KE VEKTOR
  • PENYISIPAN GENE KE VEKTOR
  • PENYISIPAN GENE KE VEKTOR http://www.bio.miami.edu/dana/250/25003_10.html
  • PENYISIPAN VEKTOR KE HOST
    • - Plasmid host disiapkan menerima plasmid rekombinan
    • (pengolahan treatment shock, kejutan suhu, kalsium ion, dll)
    • Tidak semua bakteri mengambil vektor
    • Identifikasi dan isolasi
    • Identifikasi marker membedakan sel
  • http://www.bio.miami.edu/dana/250/25003_10.html PENYISIPAN VEKTOR KE HOST
  • PELAPISAN REPLIKASI Teknik sederhana membuat salinan piring agar. Pad kain steril ukuran yang sama sebagai pelat ditekan pada permukaan pelat agar dengan bakteri yang tumbuh di atasnya.  Beberapa sel koloni akan menempel pada kain. Jika kain tersebut kemudian ditekan ke piringan agar-agar baru, beberapa sel akan tertanam dan koloni tumbuh dalam posisi yang sama persis pada pelat baru.
    • Identifikasi sel transformed bacterial dengan plasmids dan penyisipan
    Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- ISOLASI GENE INTEREST
  • Untuk membedakan sel-sel yang telah mengambil vektor plasmid hibrida (dengan gen asing di dalamnya) dari sel-sel yang telah mengambil plasmid tanpa gen  Gen penanda/marker (ketahanan terhadap ampisilin).  Gen asing dimasukkan ke gen marker,  Produk gen yang tidak tepat.  Sel-sel dengan plasmid hibrida dibunuh ampisilin, sel-sel dengan plasmid normal kebal terhadap ampisilin.  Koloni sel berisi plasmid vektor hibrida teridentifikasi, dapat dipilih dan ditanam pada piring lain. Teknik replikasi ini dijabarkan pada metod Hibridasasi dan Probe yang disiapkan dari kumpulan fragmen DNA pada Libraries PELAPISAN REPLIKASI
  • Mendeteksi susunan RNA atau DNA yang spesifik pada sampel biologis DNA dan RNA , 4 nucleotide bases : CGAT(U) Target gene Probe Base Nukleotida Komplementari Hybridisasi ; Reaksi kimia antara probe dan DNA atau RNA yang akan dideteksi PRINSIP HYBRIDISASI HIBRIDISASI - PROBE C G A T G C T A CTTAGGTCAGTAA GAATCCAGTCATT HYBRID
  • Hybridisasi digunakan untuk mengidentifikasi susunan DNA yang serupa
    • NORMAL HYBRIDIZATION
    • Ekstrasi dan isolasi DNA atau RNA
    • Penghancuran DNA dengan enzim restriksi
    • Pemisahannya pada Gel
    • Blotting pada nitrocellulose
    • Probing dengan susunan komplementar
    • Prinsip dasar pada hibridisasi in situ serupa, kecuali probe diutilisasikan untuk mendeteksi susunan nukleotida yang spesifik pada sel dan jaringan.
    HIBRIDISASI - PROBE
  • HIBRIDISASI - PROBE IN-SITU HYBRIDIZATION (ISH)
    • Tipe hibridisasi yang menggunakan Rantai Komplementari DNA atau RNA yang berlabel (ex. probe) untuk melokalisasi susunan mRNA atau DNA yang spesifik pada bagian morfologis yang diawetkan dari bagian jaringan akutal, persiapan sel atau kromoson yang terisolasi, atau jika jaringan cukup kecil (misalnya bibit tanaman, embrio Drosophila) pada seluruh jaringan ( seluruh ISH)
    • Dengan hibridasasi rantai komplementari dari probe nukleotida pada susunan yang diinginkan
    • ISH memungkinkan visualisasi pada :
    • -autoradiographic in-situ hybridization ( 35 S, 32 P)
    • -Fluorescence in-situ hybridization (FITC dye)
    • -enzymatic in-situ hybridization (biotin, digoxigenin
  • Autoradiografi In situ Hibridisasi Prinsip : setiap base nukleotida mengikat setiap base nukleotida komplementari Pengikatan spesifik Probe DNA label pada susunan komplementari sampel jaringan diikuti visualisasi Probe Deteksi susunan spesifik nukleotida DNA (Northern blotting), RNA (Southern Blotting) UCCAAUGGCUUAUUUCCCUA 5’ 3’ transcripts RNA Radiolabelled-RNA RNAprobes-DNA - stable hybrids RNAprobes-RNA – stable hybrids HIBRIDISASI - PROBE
    • Persiapan Library.
      • Distribusi Klone library pada petri dish.
      • Transfer klone pada nitrocellulose disk.
    • Persiapan probe.
      • Klone DNA sebelumnya
      • PCR fragment
      • Oligonucleotide
    • Screen/Saring library.
      • Tampilkan probe untuk klone pada nitrocellulose.
      • Tentukan lokasi klone yang sesuai oleh Autoradiographi atau fluorescence.
    Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- HIBRIDISASI - PROBE
    • Sebuah PROBE genetika adalah fragmen asam nukleat yang berlabel radioaktif.
    • Urutan fragmen asam nukleat dari susunan yang diketahui dapat memungkinkan lokasi yang tepat dari susunan DNA tertentu pada untai tunggal DNA yang tidak diketahui (rantai tunggal terjadi karena denaturasi buatan melalui panas, dll) sampel dengan hibridisasi padanya.
    HIBRIDISASI - PROBE
    • Berikut adalah salah satu cara membuat Probe Berlabel:
    •   Memillih produk protein yang diinginkan, dan menentukan urutan aa. 
    • Dari urutan aa , kemudian urutan mRNA dapat diekstrapolasi, dan mRNA diisolasi
    • Menggunakan reverse transcripsi untuk memproduksi DNA dari mRNA terisolasi
    • Supply radioaktif nukleotida (biasanya dilabeli dengan 32P) sebagai bahan baku untuk sintesis
    • Proses Denaturasi hybrid DNA-RNA asam nukleat dan didapatkan rantai tunggal, probe DNA radioaktif yang akan berikatan dengan DNA yang dikodekan untuk mRNA Anda awalnya terisolasi
    • Lakukan proses Klon
    HIBRIDISASI - PROBE
  • HIBRIDISASI - PROBE
    • REVERSE GENETICS
      • Radioactive klone sebagai Probe untuk gen yang relevan.
      • Sisipan susunan mutasi ke gen bakteri untuk menentukan fungsi gen terganggu, karena bakteri tidak dapat memproduksi produk gen terganggu/ disrupted gene . (gen eukaryote disisipkan pada bakteri selalu mengekspresikan (dalam keadaan wild type atau mutant), bakteri tidak memiliki sekuens gen eukariotik yang akan mengaktifkan/menonaktifkannya).
      • Teknologi ini penting dalam GENE KNOCKOUT.
      • Rekayasa gen bakteri (dan fungi) ini digunakan untuk memproduksi produk gen eukaryotic pada jumlah yang besar gene--a commercial boon!
  • 12/26/11 http://www.bio.miami.edu/dana/250/25003_10.html HIBRIDISASI - PROBE
  • Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- Pewarnaan dengan Ethidium bromide HIBRIDISASI - PROBE
  • Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- Blot dihilangkan Pencucian dan Penampilan pada film X-ray HIBRIDISASI - PROBE
  • Pustaka adalah kumpulan dari fragmen fragmen yang telah di klon.
    • Langkah mengumpulkan pustaka genome
      • Lengkapi pustaki genome dengan mengumpulkan klon klon yang mengandung satu kopi dari setiap susunan pada semua genom
        • Ekuivalen Genom – jumlah klon klaon pada pustaka yang sempurna
          • Bagi panjang genome dengan rata rata ukuran sisipan yang dibawa oleh vektor pustaka.
        • Peneliti biasanya membuat pustaka dengan empat atau lima ekuivalen geneome untuk probabilitas 95% yang setiap lokus ditampilkan paling sedikit satu kali.
    9- PUSTAKA
  • DNA LIBRARIES Perpustakaan DNA sebagai satu buku kompilasi informasi yang besar. Setiap organisme memiliki genom,. PERPUSTAKAAN DNA , kumpulan fragmen restriksi kloning dari genom organism tunggal.  Tujuannya untuk memiliki perpustakaan berisi klon geln SEMUA organisme. tapi semua perpustakaan DNA lengkap. Genomik PERPUSTAKAAN berisi DNA genom lengkap suatu organisme, dalam bentuk fragmen DNA kecil/oligonucleotides mewakili gen dikenal. Bidang bioinformatika melibatkan penggunaan komputer untuk menganalisis dan menyimpan data genetik, seperti perpustakaan DNA dari spesies tertentu. cDNA PERPUSTAKAAN adalah library DNA dari klon DNA direkonstruksi (menggunakan reverse transcriptase) beberapa molekul organisme mRNA.
  • http://www.bio.miami.edu/dana/250/25003_10.html DNA LIBRARIES
  • http://www.bio.miami.edu/dana/250/25003_10.html DNA LIBRARIES
  • http://www.bio.miami.edu/dana/250/25003_10.html DNA LIBRARIES
    • dibuat dengan vektor kloning mengandung unsur teratur dibutuhkan ekspresi gen, seperti wilayah promotor.
    • Dalam vektor ekspresi E. coli, merupakan promotor berada di samping daerah unik restriksi tempat DNA diinginkan dapat disisipkan.
    • Jika berhasil, penyisipan gen asing ke dalam kerangka baca yang benar akan menghasilkan transkrip gen &diterjemahkan sel inang E. coli.
    • Blotting dan perlakuan kultur memungkinkan protein diinginkan tetap difilter nitroselulosa.
    • Antibodi yang diiketahui, dilabelkan radioaktif, dicuci ke saringan dan dibiarkan glom ke protein yang diinginkan.
    • Antibodi yang tidak terikat kemudian dibilas
    • Filter diatur di atas film radiografi, dan diberi label koloni yang terungkap.
    • Kembali ke piring asli, ambil sedikit klon yang membawa gen interest yang telah disisipkan ,dan lakukan replikasi
    EXPRESSION LIBRARIES
  • http://www.bio.miami.edu/dana/250/25003_10.html EXPRESSION LIBRARIES
  • Pustaka cDNA membawa informasi dari Transkrip TNA pada jaringan tertentu.
    • Semua Pustaka genom mengandung semua DNA pada genom.
    • Pustka cDNA mengandung hanya informasi dari gene’s exons.
    • Lankah langkahnya :
      • Siapkan total mRNA dari jaringan
      • Tambahkan reverse transcriptase
      • Untuk memulai sintesa, tambahkan empat hal berikut
        • deoxyribose
        • nucleotide
        • triphosphates, dan
        • primers
    9- PUSTAKA cDNA
  • Screening pada Ekspresi Library
    • Expressi library – seluruh pustaka cDNA
      • Probe library dengan fluorescen yang di label antibody yang mengikat protein produk gen
    Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- PUSTAKA cDNA
  • KONSTRUKSI PUSTAKA cDNA Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- PUSTAKA cDNA
  • Perbandingan Pustaka Genomic dan cDNA Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- PERBANDINGAN LIBRARIES
  • MULTIPLIKASI DNA
    • Multiplikasi DNA memungkinkan untuk menumbuhkan fragmen DNA dalam jumlah besar yang merupakan DNA Clone yang diinginkan. Fermentor skala besar oleh cloning ini memiliki semua genetik identik karena reproduksi aseksual.
    • Jumlah cloned DNA yang besar, memerlukan proses karakterisasi, metode diantaranya :
    • Karakterisasi Susunan dengan DNA Sekuensi (Metode Sanger), Gene Fungsi, PCR
    • Modifikasi yang diinginkan
    • Penyisipan pada organisme host
    • DNA klone yang diinginkan telah ditumbuhkan tetapi urutan atau susunan basenya tidak diketahui,
    • Maka Ditentukan urutan kloning fragmen DNA
    • dengan berbagai metode sekuensing DNA, diantaranya :
    • Metode dideoksi
    • Ide Utama:
    • Setelah proses pengikatan dideoksi selesai, maka metode Sanger sequencing gel (melalui elektroforesis) dilakukan. Sejumlah besar fragmen DNA, masing-masing satu nukleotida lebih panjang dari yang terakhir.  Urutan nukleotida pada dasarnya dapat dibaca langsung dari gel tersebut.
    MULTIPLIKASI DNA DNA SEKUENSI
  • Dideoksi nukleotida menyebabkan penghentian proses perpanjangan rantai selama replikasi DNA. Konfigurasi Dideoksi primer kekurangan group 3’-OH yang dibutuhkan untuk perpanjangan rantai pada konfigurasi primer. DNA SEKUENSI
  • Step pertama metode Dideoksi: Asteris/dideoksinukleotida. DNA disekuensi ditempatkan pada konfigurasi primer(a,b).4 reaksi campuran diciptakan, reaksi dengan 4 normal nukleotida plus 1 dideoksinukleotida. Sintesis DNA eaksi campuran berhenti saat complement dideoksinukleotida muncul template (c ). DNA SEKUENSI
  • Elektroporesis produk segmen dilakukan dengan metode dideoksi DNA sekuensi memungkinkan pembacaan langsung susunan DNA. Asterisk/dideoksinukleotida. Reaksi sintesa produkdiisolasi dengan penghilangan primer dan template. Setiap reaksi campuran (contoh :ddTT adalah campuran mengandung dideoksitimin) menghasilkan produk spesifik terhadap panjang yang dapat ditentukan dengan elektroporesis. Pada kasus campuran ddTTP, Kedua ujung framen berhenti pada Timin adalah mungkin, satu dengan panjang dua base, dan satunya dengan panjang tujuh base. Kemudian komplemen dari timin, adenine, muncul pada posisi 2 dan 7 pada DNA asli. Namun, baik pada untai asli atau komplemen (sintesa baru) memberikan susunan original karena DNA adalah double helix yang susunannya pada satu rantai tunggal didefinisikan oleh susunan komplementari rantai lainnya. DNA SEKUENSI
    • Semua proyek sekuensing menggunakan protokol dasar yang sama.
    • Urutan ditentukan sekitar 800 basis pada suatu waktu.
    • Metode Maxim-Gilbert
      • Kimia pembelahan DNA pada jenis nukleotida yang spesifik
    • Metode Sanger
      • P erpanjangan enzimatis DNA untuk menentukan penghentian duplikasi base
      • Metode ini sangat popular dan efisien, terutama untuk metode automasi
    • Kedua teknik menghasilkan keakuratan kira kira 99.9%
    9- DNA SEKUENSI
  • Prinsip Umum Metode Susunan Sanger 9- DNA SEKUENSI
  • 9- DNA SEKUENSI
  • Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- DNA SEKUENSI
  • Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- DNA SEKUENSI
  • Automasi Susunan DNA
    • Output dari reaksi automasi DNA sequencing
      • Setiap baris menampilkan susunan yang didapat dari pemisahan DNA sampel dan primer
    Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- DNA SEKUENSI
  • Automasi Susunan DNA
    • Pembacaan komputer pada susunan komplementari terhadap templat strand dari kanan ke kiri (5’ – 3’ direction). Mesin menghasilkan rantai komplementari. Ambiguities direkam sebagai “N” dan dapat diselesaikan oleh teknisi.
    Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display DNA SEKUENSI
  • Susunan Daerah Panjang DNA
    • Primer walking
      • Susunan dimulai dari kedua ujung klone yang disisipkan
      • Primer baru didapat dari susunan pada round sebelumnya
    9-
    • Shotgun sequencing
      • Susunan panjang DNA di potong menjadi fragmen kecil yang masing masing akan diklone
      • Semua susunan fragmen kecil ditentukan
      • Fragmen kecil diselaraskan oleh komputer untuk menghasilkan satu urutan kontinu panjang
    DNA SEKUENSI
    • Pendekatan Susunan Shotgun bergantung pada redundansi. - Harus mengumpulkan urutan informasi 3-4 kali jumlah sebenarnya Pasangan basa dari klon asli untuk cakupan penuh - Kadang-kadang harus mengisi kekosongan dengan primer walking - Harus memiliki banyak otomatis sequencer - Sangat cepat jika laboratorium memiliki peralatan cukup
    • Primer Walking - Tidak memerlukan redundansi - Tidak memerlukan penyelarasan - Lebih lambat dari sekuensing shotgun karena harus membuat primer setelah setiap putaran urutan - Bekerja dengan baik di dalam laboratorium tanpa sejumlah besar sequencers otomatis
    9- Susunan DNA Cepat/Rapid DNA SEKUENSI
  • Polymerase chain reaction untuk mengisolasi fragmen DNA secara cepat
    • PCR ( polymerase chain reaction) mencapai akumulasi eksponensial dari target DNA
      • Berdasarkan urutan DNA yang telah ditentukan sebelumnya, oligonucleotides pendek (~ 20bp) dikembangkan dan dilengkapi untuk menyusun DNA target yang diapit .
      • Oligonucleotides bertindak sebagai primers untuk menyalin DNA yang serupa (Replikasi DNA).
    9- MULTIPLIKASI DNA REAKSI RANTAI POLIMER (PCR)
  • Primer Oligonucleotide mulai menyalin DNA. 9- REAKSI RANTAI POLIMER
  • Setiap siklus replikasi menggandakan jumlah target DNA. 9- REAKSI RANTAI POLIMER
  • Amplifikasi Exponential 9- REAKSI RANTAI POLIMER
  • Copyright © The McGraw-Hill Companies, Inc. Permission required to reproduce or display 9- REAKSI RANTAI POLIMER
  • PCR juga dapat digunakan untuk bermacam fungsi seperti :
    • Pemetaan Genetic
    • Mendeteksi tipe Geno
    • Analisa jejak kerusakan sebagian DNA
    • Studi Evolutionari
      • Bandingkan susunan homologous dari organmisma yang berhubungan
      • Bandingkan susunan dari variasi sumber
      • Studi keanekaragaman gene
    • Diagnosa Penyakit Menular
    • BEBERAPA CONTOH PCR DIPAPARKAN SEBAGAI BERIKUT:
    9- REAKSI RANTAI POLIMER
  • metode sensitif mendeteksi dan menganalisa transkripsi mRNA/RNA pada porsi yang rendah RNA tidak dapat digunakan sebagai template PCR, sehingga harus ditranskripsikan menjadi cDNA dengan reverse transcriptase dari Moloney murine virus atau Avian virus, duplikat cDNA kemudian diperbanyak. Teknik diawali pencampuran mixing short (12-18 base) polymers thymidine (oligo dT) dengan mRNA, dan anneal RNA's polyadenylate tail. Reverse transcriptase ditambahkan dan oligo dT sebagai primer untuk sintesa first strand cDNA . Roche Molecular Biochemicals: PCR Application Manual. RT-PCR Reverse Transcriptase-PCR REAKSI RANTAI POLIMER
  • (PCR based) dengan Turunan primer (mutagenesis saturasi) REAKSI RANTAI POLIMER
  • Gene Sequencing for mutation REAKSI RANTAI POLIMER
  • Restriction fragment length polymorphism REAKSI RANTAI POLIMER
  • TaqMan ™ assay Allele specific PCR using the 5’ to 3’ exo activity and a third primer with a Fluor and Quencher. REAKSI RANTAI POLIMER
  • DOP-PCR REAKSI RANTAI POLIMER
  • Linker Primed PCR REAKSI RANTAI POLIMER
  • Genomic Walking REAKSI RANTAI POLIMER
  •   Teknik yang mengubah cara campuran PCR dengan pemanasan awal.  Polimerase aktif, tapi target belum didenaturasi dan Primer dapat mengikat ke lokasi non-spesifik (atau bahkan satu sama lainnya).  Teknik dilakukan manual dengan memanaskan komponen reaksi pada suhu pencairan (mis. 95 ° C) sebelum menambahkan polimerase .   Atau, sistem yang menghambat aktivitas polimerase yang pada suhu lingkungan, baik oleh pengikatan suatu antibodi, atau dengan adanya inhibitor yang terikat kovalen yang hanya terdisosiasi setelah langkah aktivasi temperatur tinggi. ‘ Hot-start/cold-finish PCR dicapai dengan polimerase hibrida baru yang tidak aktif pada suhu lingkungan dan hanya diaktifkan pada temperatur tinggi. Hot-start PCR REAKSI RANTAI POLIMER
  • (PCR based) dengan Error – Prone PCR dengan ketelitian yang rendah! Dicapai dengan: - Peningkatan konsentrasi ion Mg2 + - Penambahan Mn2 + - Konsentrasi yang tidak sama pada keempat dNTPs - Penggunaan dITP - Meningkatkan jumlah Taq polimerase (Polymerase tanpa bukti fungsi pembacaan) REAKSI RANTAI POLIMER Menentukan varians baru protein Berdasarkan prinsip bahwa Taq Polymerase dapat berannealing pada pasangan base yang tidak kompatibel satu sama lain selama proses amplifikasi / penguatan dalam kondisi PCR yang tidak sempurna.
  • TEKNOLOGI REKOMBINASI DNA
    • REKOMBINASI DNA JUGA DAPAT MENGGUNAKAN TEKNIK TEKNIK LAIN :
    • TRANSFORMASI
    • TRANSFEKSI
    • TRANSFEKSI STABIL DAN TRANSIENT
    • TRANSDUKSI
    • MICROINJEKSI
    • BALIASTIK
    • ELEKTROPORASI
    • Transformasi, >>> molekul sel host DNA dimasukkan pada DNA lain.
    • Transgenik dengan melibatkan transformasi DNA inang, dengan DNA dari spesies yang berbeda.
    • Beberapa spesies bakteri akan dengan mudah mengambil DNA asing, dan dikatakan KOMPETEN. Namun, jenis bakteri lainnya dapat digunakan dengan "dipaksa" untuk mengambil fragmen DNA melalui metode seperti terpapar/exposure pada larutan garam (misalnya, klorida kalsium), atau Kejutan panas .
    • Transformasi sel eukariotik bukan lah merupakan metode yang sederhana. 
    TRANSFORMASI
  • TRANSFORMASI Transformation: DNA picked up directly from the medium and recombined into the genome Competent cell: bacterial cell capable of picking up DNA
  • TRANSFORMASI Other vectors include viruses (transduction) as well as otherwise inert projectiles Note that plasmid is vector that carries DNA into recipient cells
    • Bila DNA asing dimasukkan ke dalam genom eukariotik, Transfeksi dikatakan telah terjadi (mirip dengan transformasi bakteri, namun penamaannya dibedakan dari eukariotik "transformasi" yang umumnya mengacu ke suatu sel menjadi kanker). 
    • Organisme eukariotik yang telah mengambil DNA asing dengan vektor dikatakan transgenik. 
    • Transgenik melampaui hubungan taksonomi.  Organisme terkait yang sangat jauh dapat secara artifisial diimplantasi dengan DNA masing-masing. 
    TRANSFEKSI
    • Masuknya benda asing ke dalam sel eukariotik.
    • Melibatkan pembukaan pori-pori transien atau 'lubang' di membran plasma sel, untuk memungkinkan penyerapan bahan.
    • Bahan genetik (seperti superkoil plasmid DNA atau siRNA konstruksi), atau bahkan protein seperti antibodi, dapat transfeksikan.
    • Transfeksi sering dilakukan dengan mencampur lipid kationik dengan bahan untuk memproduksi liposom, yang menyatu dengan membran plasma sel dan mengendapkannya di dalam kargo.
    • Istilah transfeksi ini paling sering digunakan dalam referensi untuk sel mamalia, sedangkan istilah transformasi lebih sering digunakan untuk proses yang sama pada bakteri dan, kadang-kadang, tanaman.
    TRANSFEKSI
  • TRANSFEKSI
    • Methode Transfecksi:
    • Transfeksi presipitasi Kalsium Fosfat, metode termurah (paling diandalkan) , ditemukan S. Bacchetti dan FL Graham 1977 .
    • HEPES-buffered larutan garam (HeBS) mengandung ion fosfat dikombinasikan dengan larutan kalsium klorida mengandung DNA yang akan transfeksikan.  Ketika keduanya digabungkan, presipitat halus kalsium fosfat membentuk, mengikat DNA yang akan transfeksikan pada permukaannya. Larutan presipitat ditambahkan ke sel-sel yang akan transfeksikan (biasanya tumbuh pada kultur sel monolayer).  Dengan proses yang tidak sepenuhnya dipahami, sel akan mengambil beberapa presipitat, dan termasuk dengannya adalah, DNA.
    • Elektroporasi, heat shock, dan transfeksi dengan reagen seperti Lipofectamine dan Fugene.
  • TRANSFEKSI
    • Metode senyawa organik dendrimers, untuk mengikat DNA dan mengambilnya ke dalam sel. 
    • Metode efisien dengan memasukkan DNA yang ditransfeksikan ke liposom (membran tubuh yang sangat kecil mirip struktur sel dan dapat menyatu dengan membran sel), melepaskan DNA ke dalam sel . 
    • Untuk sel-sel eukariotik, lipid-kation berbasis transfeksi biasanya lebih digunakan, karena sifat sel-selnya yang lebih sensitif.
    • Metode Gene Gun yaitu metode sasaran lansgsung dengan penggabungan DNA pada nanopartikel dari inert padatan (biasanya emas) yang kemudian "ditembak" langsung ke dalam inti sel seperti Biolistik
    • .
  • Plasmids dan gen sisipan dipisahkan dari bakteri dan vektor dengan sentrifugasi, penghancuran restriksi digests dan Gel electrophoresis TRANSFEKSI
    • Kadang kadang sulit menentukan apakah gen yang disisipkan " turned on “, geneticists kadangkala menyisipkan REPORTER GENE di samping gene interest. Reporter gene ini mudah dideteksi pada phenotype. Ketika berfungsi, produk menampilkan indikasi yang baik bahwa gen interest yang berdekatan juga berfungsi.
    • Salah satu reporter gene yang memberikan hasil agak luar biasa adalah gen LUCIFERASE, yang menyebabkan transgenic organism mengekspresikan ke bioluminesce.
    • Glowing mouse embryos atau glowing tobacco plants, adalah hasil dari genetic marker yang digunakan untuk mendeteksi kemungkinan aktifitas gen disekitarnya yang benar benar di inginkant.
    • The race is on. Organisme transgenic kebanyakan diciptakan untuk mempelajari fungsi tertentu pada manusia atau gangguan pada manusia.
    TRANSFEKSI
    • Beberapa contoh ...
    • Tikus transgen secara rutin didapatkan dengan menginjeksikan vektor mengandung kloning DNA menjadi oosit atau bahkan satu atau dua-sel embrio yang kemudian kembali implan.
    • Hanya dalam sekitar 15% dari operasi sebenarnya ini DNA asing dimasukkan ke genom inang. Itu tidak selalu bekerja!
    • Eukariota transgenik pertama yang pernah dibuat (1988) adalah seorang tikus yang membawa gen yang cenderung ke kanker. Hal ini digunakan sebagai model untuk mempelajari kanker. 
    • Organisme Transgenik dapat digunakan untuk mempelajari fungsi gen
    TRANSFEKSI
  • Transfeksi Stable dan transient
    • Suffisien atau memadai jika gen ditransfeksikan hanya ekspresi sementara/transient. 
    • Bila DNA diperkenalkan dalam proses transfeksi biasanya tidak dimasukkan ke dalam inti genom, DNA asing hilang pada tahap berikutnya, ketika sel mengalami mitosis.
    • Transfeksi stabil >> gen transfeksi tertinggal pada sel genome dan sel sel keturunannya.
    • Ko-transfeksi pada gen lain memberikan keuntungan sel seleksi, seperti resistensi terhadap racun tertentu.
  • Transfeksi Stable dan transient
    • Sel transfeksi memasukkan bahan genetik asing ke dalam genom mereka. 
    • Toksin menuju ke arah gen ko-transfeksi menawarkan perlawanan, kemudian ditambah kan ke kultur sel, hanya beberapa sel dengan gen asing disisipkan ke genom mereka akan dapat berkembang biak, sedangkan sel lain akan mati. 
    • Setelah menerapkan seleksi tekanan ini selama beberapa waktu, hanya sel-sel dengan transfeksi stabil bertahan dan dapat dibudidayakan lebih lanjut.
    • Bahan kimia agen yang umum digunakan untuk transfeksi stabil adalah Geneticin / G418, yang merupakan racun yang bisa dinetralisir oleh produk resistansi gen neomisin (neo gen ).
    • Disebut transduksi viral, dan, sel dikatakan sebagai transduksi.
    • Virus dengan afinitas untuk jenis sel tertentu digunakan sebagai vektor jika mereka "dimuat" dengan DNA asing yang diinginkan dan diizinkan untuk menginfeksi sel inang sasaran.
    • Transduksi adalah proses dimana DNA bakteri dipindahkan dari satu bakteri yang lain dengan media virus. 
    TRANSDUCTION
  • TRANSDUCTION
    • Memungkinkan Transformasi sel mutasi gen dan substitusi gen fungsional kepada gen yang rusak.
    • Regenerasi seluruh hewan dari transformasi satu sel tunggal tidak memungkinkan.
    • Mikroinjeksi digunakan untuk menghasilkan hewan transgenik, DNA asing dimasukkan ke dalam sebuah zigot atau embrio awal. DNA disuntikkan langsung ke inti sel dengan pipet yang sangat mungil. Setelah transfer DNA selesai, dimasukkan ke dalam kromosom sel host.
    • Zigot/embrio yang bertransformasi kemudian dapat ditanamkan ke dalam ibu pengganti untuk pertumbuhannya.
    MICROINJECTION
  • MICROINJECTION
    • Metode Proyektil menggunakan potongan logam untuk menyampaikan materi genetik ke interior sel.
    • Proses membombardir sel dengan proyektil mikroskopis diameter lebih kecil dari sel target , terbuat dari zat inert seperti tungsten atau emas serta dilapisi dengan DNA/bahan genetik.
    • Penembakan dilakukan dengan kecepatan tinggi dari pistol partikel ke dalam sel atau jaringan. Sebuah plat logam berlubang menghentikan cartridge shell, tapi memungkinkan slivers/potongan melewati dan masuk ke sel-sel hidup pada sisi lainnya
    • Setelah di dalam sel, materi genetik diangkut menuju inti di mana ia akan bergabung di antara gen host.
    • Teknik ini menjanjikan untuk digunakan dalam organisme hidup ditemukan oleh A.Guy.
    BIOLISTICS
    • Jika sel inang memiliki dinding sel, enzim dapat digunakan untuk membubarkan dinding, dan kemudian hanya menyisakan protoplas (sel tanpa dinding)
    • DNA asing kemudian dimasukkan melalui elektroporasi - protoplas yang diekspose terhadap pulsa arus listrik pendek dan membuka saluran membran transien yang dapat dilalui DNA .
    • Sel sel transformasi kemudian dapat dikultur dalam media yang memungkinkan pembentukan kembali dinding sel dan pertumbuhan normal menjadi organisme keseluruhan (tumbuhan, jamur, beberapa protista).
    • Sel Hewan memiliki sel dinding yang sedikit, sehingga dapat dengan mudah ditranformasi melalui metode elektroporasi ini.
    ELECTROPORASI
  • ELECTROPORASI
  • ELECTROPORASI Phonophoresis (Sonophoresis) Pulsa Ultrasoundare passed melalui probe ke permukaan , memfluidakan lapisan lemak dengan pembentukan gelembung yang disebabkan kavitasi
    • Menggunakan energi Ultrasound agar penetrasi pada substansi aktif meningkat
    • Efek utamanya adalah pembentukan dan subsekuensi ancurnya gelembung gas pada larutan yang disebut Kavitasi
    • Efek pemanasan meningkatkan fluiditas dan difusivitas molekul melalui penghalang
    • Ultrasound dapat mendorong partikel melalui nya dengan meningkatkan tekanan walaupun hanya sedikit
  • ELECTROPORASI Iontophoresis (Electrophoresis) Arus mengalir antara elektroda aktif dan elektroda indifferent electrode repelling drug away dari aktif elektroda dan memasuki permukaan
    • Menggunakan aliran listrik kecil
    • Menyediakan driving force untuk dapat memulai penerasi dengan menCharge- mengalirkan arus molekul pada permukaan
    • Terdiri dari dua elektroda, aktif elektroda dnegan penetrat charged yang sama dan posisi elektroda positif dimanapun
    • Efektif terutama untuk mengalirkan aris ke molekul dan molekul kecih yang mempunyai masa jenis kurang dari 5,000 daltons
  • Electroporation
    • Menggunakan tegangan tinggi 30~1,000V (dengan tujuan aestetik, terbatas apada 50V untuk periode pendek (10µs to 100ms) berlawanan dengan iontophoresis yang menggunakan tegangan rendah.
    • Membuat pore hidrofilik transient (aqueous pathways)
    • (Electropore bervariasi ukuran dari 40-250µm)
    • Memungkinkan lewatnya molekul makro melalui kombinasi difusi , elektrophoresis dan elektroosmosis
    • Efektif untuk charged, neutral dan molekul natural serta molekul besar bermasa jenis lebih dari 40,000 daltons
    ELECTROPORASI
  • ELECTROPORASI Electroporation vs Iontophoresis
  • ELECTROPORASI Electroporation vs Iontophoresis
  • THANK YOU