bioinfolec_2nd_20070622

893 views
830 views

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
893
On SlideShare
0
From Embeds
0
Number of Embeds
37
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

bioinfolec_2nd_20070622

  1. 1. • • •
  2. 2. • • • •
  3. 3. • • • • •
  4. 4. • • • • • • • • • • • •
  5. 5. agcaaaagaa
  6. 6. • • • • • • •
  7. 7. • • • • • • • • • • • •
  8. 8. $ rm -r arg1 arg2
  9. 9. -u Date DATE
  10. 10. ✴ ✴ ✴ ✴$ man man ✴ ✴ ✴ ✴ $ man date
  11. 11. • • • • • • / C: usr Volume WINDOWS Program Files bin lib cdrom system CD-ROM D: pics CD-ROM pics
  12. 12. • • • • • • • • / usr Volume / bin lib cdrom pics
  13. 13. • • • $ pwd • • • • • • • ~ $HOME • •
  14. 14. • /usr/lib / • • • usr/lib usr Users • • / • /Users/sesejun bin lib sesejun • usr • /Users/sesejun/ • . • . /Users/sesejun lib • ./usr/lib • .. • .. /Users • ../../usr/lib
  15. 15. • cd destination-dir • destination-dir • cd .. jsmbp:~ sesejun$ pwd /Users/sesejun jsmbp:~ sesejun$ cd /usr/ jsmbp:/usr sesejun$ pwd /usr jsmbp:/usr sesejun$ cd lib jsmbp:/usr/lib sesejun$ pwd /usr/lib jsmbp:/usr/lib sesejun$ cd /usr/bin/ jsmbp:/usr/bin sesejun$ pwd /usr/bin jsmbp:/usr/bin sesejun$ cd jsmbp:~ sesejun$ pwd /Users/sesejun jsmbp:~ sesejun$
  16. 16. • • • • • -a: • -F: • -l: sesembp:~ sesejun$ ls Desktop Music test Documents Pictures ?????????????????? Library Public Movies Sites sesembp:~ sesejun$ ls -F Desktop/ Music/ test/ Documents/ Pictures/ ??????????????????@ Library/ Public/ Movies/ Sites/
  17. 17. • • mkdir [options] directory ... • MaKe DIRectory • test $ mkdir test • • rmdir [options] directory ... • • test $ rmdir test
  18. 18. • cp [options] source-file ... directory • cp [options] source-file new-file • • -i: • -r: • text1.txt text2.txt jsmbp:~ sesejun$ cp text1.txt text2.txt • text1.txt text2.txt tmp jsmbp:~ sesejun$ mkdir tmp jsmbp:~ sesejun$ ls tmp jsmbp:~ sesejun$ cp text1.txt text2.txt tmp/ jsmbp:~ sesejun$ ls tmp text1.txt text2.txt
  19. 19. • mv [options] source-file ... directory • mv [options] old-path new-path • text1.txt text2.txt jsmbp:~ sesejun$ mv text1.txt text2.txt • text1.txt text2.txt tmp jsmbp:~/test sesejun$ ls text1.txt text2.txt jsmbp:~/test sesejun$ mkdir tmp jsmbp:~/test sesejun$ mv text1.txt text2.txt tmp/ jsmbp:~/test sesejun$ ls tmp jsmbp:~/test sesejun$ ls tmp/ text1.txt text2.txt
  20. 20. • rm [options] file ... • • -r: • -i: • text1.txt text2.txt jsmbp:~ sesejun$ rm text1.txt text2.txt • tmp jsmbp:~/test sesejun$ ls tmp jsmbp:~/test sesejun$ ls tmp/ text1.txt text2.txt jsmbp:~/test sesejun$ rm -r tmp/ jsmbp:~/test sesejun$ ls jsmbp:~/test sesejun$ •
  21. 21. • • • /Users/yourname • Terminal • mkdir work • ls • mkdir work/blast • cd work/blast • • • • •
  22. 22. • • • • •
  23. 23. • • • • • •
  24. 24. • • • • jsmbp:~ sesejun$ sudo port -d install lftp ( ( jsmbp:~ sesejun$ which lftp /opt/local/bin/lftp • • • •
  25. 25. • • • • • • jsmbp:~ sesejun$ cd work/blast jsmbp:~/work/blast sesejun$ lftp ftp.ncbi.nih.gov lftp> cd blast/executables/release/2.2.16 lftp> mget blast-2.2.16-universal-macosx.tar.gz ( ) lftp> quit jsmbp:~/work/blast sesejun$ tar zxvf blast-2.2.16-universal- macosx.tar.gz ( )
  26. 26. jsmbp:~/work/blast sesejun$ lftp ftp.ncbi.nih.gov lftp> cd blast/db/FASTA lftp> ls ( lftp> mget yeast.nt.gz ( ) lftp> quit jsmbp:~/work/blast sesejun$ gzip -d yeast.nt.gz • • • • • • •
  27. 27. • • • • • • jsmbp:~/work/blast sesejun$ mv ~/Desktop/myseq.fasta .
  28. 28. • • • • • jsmbp:~/work/blast sesejun$ ls ( ) jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/formatdb -i yeast.nt -p F -o T jsmbp:~/work/blast sesejun$ ls (8 )
  29. 29. jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/formatdb -i yeast.nt -p F -o T ( ) jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/formatdb -i yeast.nt -p T -o T ( ) jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/formatdb --help ( )
  30. 30. • • • • • jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/blastall -p blastn -d yeast.nt -i myseq.fasta (blastn ) jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/blastall -p blastn -d yeast.nt -i myseq.fasta -o myseq.out (blastn myseq.out ) jsmbp:~/work/blast sesejun$ ./blast-2.2.16/bin/blastall -p tblastx - d yeast.nt -i myseq.fasta (tblastx )
  31. 31. BLASTN 2.2.16 [Mar-25-2007] Score E Sequences producing significant alignments: (bits) Value 1 ref|NC_001142.1| Saccharomyces cerevisiae chromosome X, complete... 698 0.0 ref|NC_001145.1| Saccharomyces cerevisiae chromosome XIII, compl... 34 0.32 2 ref|NC_001136.2| Saccharomyces cerevisiae chromosome IV, complet... 32 1.3 >ref|NC_001142.1| Saccharomyces cerevisiae chromosome X, complete chromosome sequence 1 Length = 745440 Score = 698 bits (352), Expect = 0.0 Identities = 361/364 (99%) Strand = Plus / Plus Query: 177 tactcatcacgcgggcttaccgcaatggtctaatagcatggctagtcaccattttcccaa 236 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 545951 tactcatcacgcgggcttaccgcaaaggtctaatagcatggctagtcaccattttcccaa 546010 >ref|NC_001145.1| Saccharomyces cerevisiae chromosome XIII, complete chromosome sequence Length = 924430 2 = 34.2 bits (17), Expect = 0.32 Score Identities = 17/17 (100%) Strand = Plus / Minus

×