bioinfolec_20070706 4th

762 views

Published on

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
762
On SlideShare
0
From Embeds
0
Number of Embeds
35
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

bioinfolec_20070706 4th

  1. 1. • • • •
  2. 2. • • • • • • • • • •
  3. 3. • • • • • • • • • • • • •
  4. 4. • • • • • •
  5. 5. • • • • • • • •
  6. 6. • • • • • • • • • <QUERY> <HTML> <VALUE len=5>HELLO</VALUE> <BODY>Hello World!</BODY> </QUERY> </HTML>
  7. 7. • element( ) • element( ) • attribute( ) 1 • element attribute • element, attribute ) DTD <shop> shop <item name=”Apple”> <price>150</price> <piece>1</piece> </item> item item <item name=”Orange” /> </shop> name=”Orange” name=”Apple” price piece 150 1
  8. 8. • • • • • •
  9. 9. http://eutils.ncbi.nlm.nih.gov/entrez/query/static/eutils_help.html#UserSystemRequirements
  10. 10. • • • • • $ curl ”http://example.org/start.html” http://example.org/start.html $ curl -o index.html ”http://example.org/start.html” http://example.org/start.html index.html -o $ curl -O ”http://example.org/start.html” http://example.org/start.html start.html (-O ( ) URL
  11. 11. http://www.ncbi.nlm.nih.gov/entrez/query/static/eutils_help.html • • • • • • • • •
  12. 12. $ curl -o search_ptk2.xml ”http://eutils.ncbi.nlm.nih.gov/entrez/ eutils/esearch.fcgi?db=gene&term=ptk2quot; search_ptk2.xml <?xml version=quot;1.0quot;?> <!DOCTYPE eSearchResult PUBLIC quot;-//NLM//DTD eSearchResult, 11 May 2002//ENquot; quot;http://www.ncbi.nlm.nih.gov/entrez/query/DTD/ eSearch_020511.dtdquot;> <eSearchResult> <Count>316</Count> <RetMax>20</RetMax> <RetStart>0</RetStart> <IdList> <Id>14083</Id> <Id>5747</Id> () <Id>515604</Id> </IdList> <TranslationSet> </TranslationSet> <TranslationStack> <TermSet> <Term>ptk2[All Fields]</Term> <Field>All Fields</Field> <Count>316</Count> <Explode>Y</Explode> </TermSet>
  13. 13. $ curl -o gene_14083.xml ”http://eutils.ncbi.nlm.nih.gov/entrez/eutils/ esummary.fcgi?db=gene&id=14083&retmode=xmlquot; gene_14083.xml <?xml version=quot;1.0quot;?> <!DOCTYPE eSummaryResult PUBLIC quot;-//NLM//DTD eSummaryResult, 29 October 2004//ENquot; quot;http://www.ncbi.nlm.nih.gov/entrez/query/DTD/ eSummary_041029.dtdquot;> <eSummaryResult> <DocSum> <Id>14083</Id> <Item Name=quot;Namequot; Type=quot;Stringquot;>Ptk2</Item> <Item Name=quot;Descriptionquot; Type=quot;Stringquot;>PTK2 protein tyrosine kinase 2</Item> <Item Name=quot;Orgnamequot; Type=quot;Stringquot;>Mus musculus</Item> <Item Name=quot;Statusquot; Type=quot;Integerquot;>0</Item> <Item Name=quot;CurrentIDquot; Type=quot;Integerquot;>0</Item> <Item Name=quot;Chromosomequot; Type=quot;Stringquot;>15</Item> <Item Name=quot;GeneticSourcequot; Type=quot;Stringquot;>genomic</Item> <Item Name=quot;MapLocationquot; Type=quot;Stringquot;>15 42.0 cM</Item> <Item Name=quot;OtherAliasesquot; Type=quot;Stringquot;>FAK, FRNK, Fadk, KIAA4203, mKIAA4203</Item> <Item Name=quot;OtherDesignationsquot; Type=quot;Stringquot;>focal adhesion kinase</Item> <Item Name=quot;NomenclatureSymbolquot; Type=quot;Stringquot;>Ptk2</Item> <Item Name=quot;NomenclatureNamequot; Type=quot;Stringquot;>PTK2 protein tyrosine kinase 2</Item>
  14. 14. <Item Name=quot;NomenclatureStatusquot; Type=quot;Stringquot;>Official</Item> <Item Name=quot;TaxIDquot; Type=quot;Integerquot;>10090</Item> <Item Name=quot;Mimquot; Type=quot;Listquot;></Item> <Item Name=quot;GenomicInfoquot; Type=quot;Listquot;> <Item Name=quot;GenomicInfoTypequot; Type=quot;Structurequot;> <Item Name=quot;ChrLocquot; Type=quot;Stringquot;>1</Item> <Item Name=quot;ChrAccVerquot; Type=quot;Stringquot;>NC_000081.5</Item> <Item Name=quot;ChrStartquot; Type=quot;Integerquot;>73225153</ Item> <Item Name=quot;ChrStopquot; Type=quot;Integerquot;>73035535</ Item> </Item> </Item> </DocSum> </eSummaryResult>
  15. 15. $ curl ”http://eutils.ncbi.nlm.nih.gov/entrez/eutils/esummary.fcgi? db=gene&id=14083,5747&retmode=xmlquot; <?xml version=quot;1.0quot;?> <!DOCTYPE eSummaryResult PUBLIC quot;-//NLM//DTD eSummaryResult, 29 October 2004//EN quot; quot;http://www.ncbi.nlm.nih.gov/entrez/query/DTD/eSummary_041029.dtdquot;> <eSummaryResult> <DocSum> <Id>14083</Id> <Item Name=quot;Namequot; Type=quot;Stringquot;>Ptk2</Item> <Item Name=quot;Descriptionquot; Type=quot;Stringquot;>PTK2 protein tyrosine kinase 2</Item> <Item Name=quot;Orgnamequot; Type=quot;Stringquot;>Mus musculus</Item> () </DocSum> <DocSum> <Id>5747</Id> <Item Name=quot;Namequot; Type=quot;Stringquot;>PTK2</Item> <Item Name=quot;Descriptionquot; Type=quot;Stringquot;>PTK2 protein tyrosine kinase 2</Item> <Item Name=quot;Orgnamequot; Type=quot;Stringquot;>Homo sapiens</Item> () </DocSum> </eSummaryResult>
  16. 16. • • • http://www.ncbi.nlm.nih.gov/entrez/query/static/eutils_help.html#PrimaryIDs Entrez Database Primary ID E-Utility Database Name 3D Domains 3D SDI domains Domains PSSM-ID cdd Genome Genome ID genome EntrezGene Gene ID gene Nucleotide GI number nucleotide OMIM MIM number omim PopSet Popset ID popset Protein GI number protein ProbeSet GEO ID geo PubMed PMID pubmed Structure MMDB ID structure SNP SNP ID snp Taxonomy TAXID taxonomy UniSTS UniSTS ID unists
  17. 17. NC_000081.5 73035535 73225153 73226153 $ curl ”http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi? db=genome&id=NC_000081.5&seq_start=73226153&seq_stop=73225154&strand=2& rettype=fastaquot; >ref|NC_000081.5|NC_000081:c73226153-73225154 Mus musculus chromosome 15, reference assembly (C57BL/6J) TCACATCCTTGTGATGAACTCAGGACTTCTTAGGGAAGCTTTAAGTATATATGCTTTGCATCAGGATATT TTGTATGGCCTTTTGTCAGGGAGTTCTGTGTTGGTGTCTTTAGTTTTACCTGTTAGGCTAACAGTTTCCT GCAGGGAAAAGATATGATGCCAGATTCTGGTACTTGATTGCCTTGTGTTGTGGGAGCTGGAGTTGTTGAC TTACCATTCCTCTGTGTGAAAGCTACTCAGCTTTTTCCAGAGACTGGCTCTTGGTCTGCTCTCAGGTGGG TAGAGGGGACCAGATGGAGGCAGGCTACTAGGGCTGGCACTGTAACACTCTGTCACCTCACTCAGTGCCG CTGCTTCTGAGACTTTTTTTACTCTGCCATGAAAATGGAATTGGTACTTCAACTTTTCAGTTCCTGGCCT AAAGTCTGCTAAATCATTGGCTGTGCTTCCTTCCCATTTTAAATTTGTCTCTCTTCTGTCCAGAATATTG TCCCTCCTTCAGTATATCTATTTGTTTTGATGTTTATCTTAGCCTTTTCAGTTCCCCAGTTCCCACTCCT
  18. 18. $ curl ”http://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi? dbfrom=gene&db=protein&id=14083&retmode=xmlquot; <?xml version=quot;1.0quot;?> <!DOCTYPE eLinkResult PUBLIC quot;-//NLM//DTD eLinkResult, 11 May 2002//ENquot; quot;http://www.ncbi.nlm.nih.gov/entrez/query/DTD/eLink_020511.dtdquot;> <eLinkResult> <LinkSet> <DbFrom>gene</DbFrom> <IdList> <Id>14083</Id> </IdList> <LinkSetDb> <DbTo>protein</DbTo> <LinkName>gene_protein</LinkName> <Link> <Id>123779806</Id> </Link> <Link> <Id>94958313</Id> </Link> <Link> <Id>94958311</Id> </Link> </LinkSetDb> </LinkSet> </eLinkResult>
  19. 19. $ curl -o search_ptk2.xml ”http://eutils.ncbi.nlm.nih.gov/entrez/ eutils/esearch.fcgi?db=gene&term=ptk2quot;
  20. 20. $ curl -o gene_14083.xml ”http://eutils.ncbi.nlm.nih.gov/entrez/eutils/ esummary.fcgi?db=gene&id=14083&retmode=xmlquot;

×