bioinfo_6th_20070720

1,264 views
1,220 views

Published on

Published in: Technology
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
1,264
On SlideShare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
0
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

bioinfo_6th_20070720

  1. 1. • • • • •
  2. 2. • • GCATGCAT A C G T T C G T
  3. 3. • • • • • • • •
  4. 4. • • • BLASTN 2.2.16 [Mar-25-2007] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), quot;Gapped BLAST and PSI-BLAST: a new generation of protein database search programsquot;, Nucleic Acids Res. 25:3389-3402. Query= ORFN:12 Multiple, Contig c912 1285-2874 reverse complement (1590 letters) Database: yeast.nt 17 sequences; 12,155,026 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value ref|NC_001143.1| Saccharomyces cerevisiae chromosome XI, complet... 72 4e-12 ref|NC_001133.1| Saccharomyces cerevisiae chromosome I, complete... 72 4e-12
  5. 5. >ref|NC_001143.1| Saccharomyces cerevisiae chromosome XI, complete chromosome sequence Length = 666445 Score = 71.9 bits (36), Expect = 4e-12 Identities = 75/88 (85%) Strand = Plus / Plus Query: 946 attactgttacttcctgtgagtctggtgtctgctctgaaaccgcttctcccgctattgtt 1005 ||||| |||||||| ||||||||||||||||| || ||||| ||||| || ||||| ||| Sbjct: 648979 attacggttacttcttgtgagtctggtgtctgttccgaaactgcttcacctgctatcgtt 649038 Query: 1006 tccacagccacaaccaccatcaatgatg 1033 || |||||||| | ||| ||||||||| Sbjct: 649039 tcgacagccactgctaccgtcaatgatg 649066 Score = 71.9 bits (36), Expect = 4e-12 Identities = 75/88 (85%) Strand = Plus / Plus Query: 1099 attactgttacttcctgtgagtctggtgtctgctctgaaaccgcttctcccgctattgtt 1158 ||||| |||||||| ||||||||||||||||| || ||||| ||||| || ||||| ||| Sbjct: 648979 attacggttacttcttgtgagtctggtgtctgttccgaaactgcttcacctgctatcgtt 649038 Query: 1159 tccacagccacaaccaccatcaatgatg 1186 || |||||||| | ||| ||||||||| Sbjct: 649039 tcgacagccactgctaccgtcaatgatg 649066 Score = 44.1 bits (22), Expect = 0.001 Identities = 31/34 (91%) Strand = Plus / Plus Query: 1479 atctagcaccgcctctttagaaatgtcaagctac 1512 |||||| || ||||||||||| ||||||||||||
  6. 6. $ cd ~/work/blast/bayanus/ $ curl -o 12.genome.fasta quot;http://eutils.ncbi.nlm.nih.gov/entrez/eutils/ efetch.fcgi? db=genome&id=NC_001143.1&seq_start=648879&seq_stop=649166&strand=1&rettype=fastaquot; >gi|6322623:648879-649066 Saccharomyces cerevisiae chromosome XI, complete chromosome sequence CATCAATGGGATTACCACTGAATATACTACATGGTGCCCTCTTTCTGCTACGGAATTAACAACGGTAAGT AAATTAGAGTCAGAAGAAAAAACCACCCTAATTACGGTTACTTCTTGTGAGTCTGGTGTCTGTTCCGAAA CTGCTTCACCTGCTATCGTTTCGACAGCCACTGCTACCGTCAATGATG
  7. 7. • • • • • • • • • •
  8. 8. • • • • • jsmbp:~ sesejun$ sudo port -d selfupdate ( PC jsmbp:~ sesejun$ sudo port -d install ImageMagick jsmbp:~ sesejun$ sudo port -d install ghostscript
  9. 9. • • • jsmbp:~ sesejun$ mkdir bin jsmbp:~ sesejun$ cd bin jsmbp:~/bin sesejun$ lftp ftp://emboss.open-bio.org/pub/EMBOSS lftp emboss.open-bio.org:/pub/EMBOSS> mget EMBOSS-5.0.0.tar.gz ( lftp emboss.open-bio.org:/pub/EMBOSS> quit jsmbp:~/bin sesejun$ tar zxvf EMBOSS-5.0.0.tar.gz ( jsmbp:~/bin sesejun$ cd EMBOSS-5.0.0 jsmbp:~/bin sesejun$ ./configure ( jsmbp:~/bin sesejun$ make (
  10. 10. • • • • • • • • • •
  11. 11. • • $ ~/bin/EMBOSS-5.0.0/emboss/dotmatcher 12.genome.fasta 12.fasta -graph ps -threshold 35 -goutfile 12.fasta 12.fasta.ps $ convert 12.fasta.ps 12.fasta.png ImageMagick $ open 12.fasta.png 12.fasta.png
  12. 12. A T G C S W R Y K M B V H D N U A 5 -4 -4 -4 -4 1 1 -4 -4 1 -4 -1 -1 -1 -2 -4 T -4 5 -4 -4 -4 1 -4 1 1 -4 -1 -4 -1 -1 -2 5 G -4 -4 5 -4 1 -4 1 -4 1 -4 -1 -1 -4 -1 -2 -4 C -4 -4 -4 5 1 -4 -4 1 -4 1 -1 -1 -1 -4 -2 -4 S -4 -4 1 1 -1 -4 -2 -2 -2 -2 -1 -1 -3 -3 -1 -4 W 1 1 -4 -4 -4 -1 -2 -2 -2 -2 -3 -3 -1 -1 -1 1 R 1 -4 1 -4 -2 -2 -1 -4 -2 -2 -3 -1 -3 -1 -1 -4 Y -4 1 -4 1 -2 -2 -4 -1 -2 -2 -1 -3 -1 -3 -1 1 K -4 1 1 -4 -2 -2 -2 -2 -1 -4 -1 -3 -3 -1 -1 1 M 1 -4 -4 1 -2 -2 -2 -2 -4 -1 -3 -1 -1 -3 -1 -4 B -4 -1 -1 -1 -1 -3 -3 -1 -1 -3 -1 -2 -2 -2 -1 -1 V -1 -4 -1 -1 -1 -3 -1 -3 -3 -1 -2 -1 -2 -2 -1 -4 H -1 -1 -4 -1 -3 -1 -3 -1 -3 -1 -2 -2 -1 -2 -1 -1 D -1 -1 -1 -4 -3 -1 -1 -3 -1 -3 -2 -2 -2 -1 -1 -1 N -2 -2 -2 -2 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -2 U -4 5 -4 -4 -4 1 -4 1 1 -4 -1 -4 -1 -1 -2 5
  13. 13. • • • • • • • • • • •
  14. 14. #!/bin/bash for i in *.fasta.result;do n=`echo $i | sed 's/..*//'` echo $n url=`ruby blastparse.rb $n.fasta.result` case $url in http*) echo $url curl -s -o $n.genome.fasta $url ~/bin/EMBOSS-5.0.0/emboss/dotmatcher $n.genome.fasta $n.fasta -graph ps -threshold 35 -goutfile $n.fasta convert $n.fasta.ps $n.fasta.png ;; esac done 10 http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi? db=genome&id=NC_001142.1&seq_start=722530&seq_stop=723085&strand =2&rettype=fasta Displays a thresholded dotplot of two sequences Created 10.fasta.ps 101 http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi? db=genome&id=NC_001146.1&seq_start=57506&seq_stop=57900&strand=1 &rettype=fasta Displays a thresholded dotplot of two sequences Created 101.fasta.ps
  15. 15. • • • 1. 2. 3. 4. • •

×