2 - Estrutura E Função do Cromossomo Eucarioto

37,982 views
37,067 views

Published on

2ª APresentação de aula

0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
37,982
On SlideShare
0
From Embeds
0
Number of Embeds
133
Actions
Shares
0
Downloads
481
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide

2 - Estrutura E Função do Cromossomo Eucarioto

  1. 1. Estrutura e função do cromossomo eucarioto Edgar Bione
  2. 2. Introdução:
  3. 3. 20 Å 110 Å 300 Å 3.000 Å 7.000 Å 14.000 Å
  4. 4. Núcleo: Núcleo Eucromatina Heterocromatina Constitutiva Facultatitutiva Barra 300nm
  5. 5. Cromossomo Eucariótico: Constrição Secundária Centrômero (Constrição primária) Cinetócoro Braço longo q Telômeros Braço curto p Cromátides
  6. 6. Classificação: Quanto ao tamanho Grande Médio Pequeno Onde: r = razão entre braços ic = índice centromérico l = braço longo c = braço curto Quanto a posição do centrômero
  7. 7. Centrômero: Centromere satellite on Macropus rufogriseus metaphase chromosomes (K. Bulazel)
  8. 8. Telêmero: do grego : Telos = final Meros = parte Manter a estabilidade estrutural dos cromossomos Ancorar o cromossomo no envoltório nuclear Iniciar o pareamento dos cromossomos homólogos Principais funções
  9. 9. Constrição secundária: Sítios de rDNA DNA moderadamente repetitivo Marcador cromossômico Região Organizadora de nucléolos RON ou NOR
  10. 10. Cromatina:
  11. 11. Características da Cromatina <ul><li>70% proteína </li></ul><ul><ul><li>Histonas (proteínas básicas) </li></ul></ul><ul><ul><li>não Histonas (proteínas ácidas) </li></ul></ul><ul><li>DNA e RNA (~25% e 5% respectivamente) </li></ul><ul><li>DNA altamente repetitivo (10% do genoma) </li></ul><ul><ul><li>DNA satélite </li></ul></ul><ul><ul><li>contém mais proporção de pb AT ou GC </li></ul></ul><ul><ul><li>encontra-se, geralmente, em blocos no cromossomo </li></ul></ul><ul><ul><li>apresenta seqüências em tandem </li></ul></ul><ul><li>Moderadamente repetitivo </li></ul><ul><ul><li>genes que codificam as histonas </li></ul></ul><ul><ul><li>genes que codificam os RNAr e RNAt </li></ul></ul><ul><li>DNA de seqüências únicas </li></ul><ul><ul><li>contém todos os demais genes estruturais </li></ul></ul>
  12. 12. Hetrocromatina: <ul><li>Características gerais </li></ul><ul><ul><ul><li>Ausência de atividade gênica </li></ul></ul></ul><ul><ul><ul><li>Replicação tardia </li></ul></ul></ul><ul><ul><li>Constitutiva </li></ul></ul><ul><ul><ul><li>permanece condensada durante todo o ciclo celular </li></ul></ul></ul><ul><ul><ul><li>concentra-se em blocos </li></ul></ul></ul><ul><ul><ul><li>encontra-se em ambos homólogos (= tamanho e local) </li></ul></ul></ul><ul><ul><ul><li>geralmente não apresenta genes estruturais </li></ul></ul></ul><ul><ul><ul><li>detém a maior parte do DNA satélite </li></ul></ul></ul><ul><ul><li>Facultativa </li></ul></ul><ul><ul><ul><li>aparece em apenas um cromossomo do par homólogo </li></ul></ul></ul><ul><ul><ul><li>envolve todo o cromossomo ou set cromossômico </li></ul></ul></ul><ul><ul><ul><li>não apresenta particularidades quanto à composição de DNA </li></ul></ul></ul>
  13. 13. Exemplos de Het. Facultativa: Inativação de um dos cromossomos X em fêmeas de humanos
  14. 14. O X de gafanhotos:
  15. 15. Bandamento cromossômico: <ul><li>Bandamento C </li></ul><ul><li>Bandamento G, Q e R </li></ul><ul><li>Coloração com Fluorocromos base-específicos: CMA 3 , DAPI, Quinacrina </li></ul><ul><li>Hibridação in situ fluorescente </li></ul>Pareamento cromossômico Localizar regiões específicas da cromatina Verificar alterações numéricas e estruturais Permite estudos evolutivos em grupos afins
  16. 16. Referências Bibliográficas: <ul><li>Introdução à Genética. Suzuki, et al., 4 ª ed. Guanabara Koogan. 1992, Cap. 14. </li></ul><ul><li>Introdução à Citogenética Geral. Marcelo Guerra. Guanabara Koogan. 1988. </li></ul><ul><li>Genes VI. Lewin, B. Oxford Univ. Press. 1997. Cap. 26. </li></ul><ul><li>Genética Médica. Thompson & Thompson. 6 ª ed. Guanabara Koogan. 2002. Cap. 9. </li></ul><ul><li>http://www.ogm-info.com/adn.html </li></ul>
  17. 17. Cromossomo r ic Metacêntrico 1,00 – 1,49 50,0 – 40,1 Submetacêntrico 1,50 – 2,99 40,0 – 25,1 Acrocêntrico 3,00 - ∞ 25,0 – 0,01
  18. 18. TGTGGGTGTGGTG ou G(2-3)(TG)(1-6)T GGGGTCTGGGTGCTG GGTGTACGGATGTCTAACTTCTT GGTGTA[C/A]GGATGTCACGATCATT GGTGTACGGATGCAGACTCGCTT GGTGTAC GGTGTACGGATTTGATTAGTTATGT GGTGTACGGATTTGATTAGGTATGT Saccharomyces cerevisiae Candida glabrata Candida albicans Candida tropicalis Candida maltosa Candida guillermondii Candida pseudotropicalis Kluyveromyces lactis Leveduras TTAGGC Ascaris lumbricoides Nemátodos TTAGG Bombyx mori Insetos TTTTAGGG Chlamydomonas Clorófitos TTTAGGG Arabidopsis thaliana Plantas superiores TTAGGG(T/C) Plasmodium Protozoários (Apicomplexa) TTGGGG TTGGG(T/G) TTTTGGGG Tetrahymena Paramecium Oxytricha, Stylonychia, Euplotes Protozoários ciliados TTAGGG Trypanosoma, Crithidia Protozoários (Kinetoplastea) TTAGGG AG(1-8) Physarum, Didymium Dictyostelium Micetozoários TTAGGG Neurospora crassa Fungos filamentos TTAGGG Humano, Rato, Xenopus Vertebrados Repetição (5' > 3') Organismo Grupo Algumas seqüências de telômeros conhecidas:
  19. 20. Quanto ao centrômero:
  20. 21. Bandamento C
  21. 22. Bandamento G
  22. 23. Quinacrina mostarda
  23. 24. Bandamento R
  24. 25. Fluorocromos base-específicos:
  25. 26. FISH:

×