Novel mutations in epithelial sodium channel (ENaC) subunit ...
Upcoming SlideShare
Loading in...5
×

Like this? Share it with your network

Share

Novel mutations in epithelial sodium channel (ENaC) subunit ...

  • 576 views
Uploaded on

 

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
576
On Slideshare
576
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
1
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Clinical Endocrinology (2005) 62, 547– 553 doi: 10.1111/j.1365-2265.2005.02255.x ORIGINAL ARTICLE Novel mutations in epithelial sodium channel (ENaC) subunit Blackwell Publishing, Ltd. genes and phenotypic expression of multisystem pseudohypoaldosteronism Oded Edelheit*†, Israel Hanukoglu*, Maria Gizewska‡, Nurgun Kandemir§, Yardena Tenenbaum- Rakover¶, Murat Yurdakök**, Stanislaw Zajaczek†† and Aaron Hanukoglu†‡‡ *Department of Molecular Biology, College of Judea and Samaria, Ariel, Israel, †Tel Aviv University, Sackler School of Medicine, Tel Aviv, Israel, ‡Second Department of Children’s Diseases, Pomeranian Medical University, Szczecin, Poland, §Division of Paediatric Endocrinology, Hacettepe University Faculty of Medicine, Ankara, Turkey, ¶Paediatric Endocrine Unit, Ha-Emek Medical Centre, Afula, Israel, **Division of Neonatology, Hacettepe University Faculty of Medicine, Ankara, Turkey, ††Departments of Genetics and Pathology, Pomeranian Medical University, Szczecin, Poland and ‡‡Department of Paediatrics, E. Wolfson Medical Centre, Holon, Israel has been found to be associated with a missense mutation in αENaC. Summary The predominance of PHA-causing mutations in the αENaC gene may be related to the function of this subunit. Objectives Multisystem pseudohypoaldosteronism (PHA) is a rare autosomal recessive aldosterone unresponsiveness syndrome that (Received 11 November 2004; returned for revision 27 December results from mutations in the genes encoding epithelial sodium 2004; finally revised 7 January 2005; accepted 14 February 2005) channel (ENaC) subunits α, β and γ. In this study we examined three PHA patients to identify mutations responsible for PHA with different clinical presentations. Patients All three patients presented uniformly with symptoms of Introduction severe salt-loss during the first week of life and were hospitalized for Pseudohypoaldosteronism type I (PHA) is a syndrome of unrespons- up to a year. Beyond infancy, one of the patients showed mild renal iveness to aldosterone that is expressed in two distinct forms: renal salt loss and had no lower respiratory tract infections until 8 years PHA and multisystem PHA.1 While the renal form generally results of age, while the other patients continue with a severe course. from autosomal dominant mutations in the mineralocorticoid Results We sequenced the complete coding regions and intron– receptor,2,3 multisystem PHA results from autosomal recessive exon junctions of the genes encoding α, β and γ subunits of ENaC mutations in the genes encoding epithelial sodium channel (ENaC) for all patients. The results revealed that the mild case represents subunits.4 –11 a novel compound heterozygote including a missense (Gly327Cys) ENaC is composed of three related subunits (α, β and γ) encoded mutation in the αENaC gene. Sequences of relatives over three by three genes located on chromosomes 12 and 16.4,6,12–14 ENaC generations confirmed that the missense mutation co-segregates subunits are expressed in epithelial cells lining the renal tubule, with PHA. This mutation was not found in 60 control subjects. The respiratory airways, the distal colon and the ducts of several exocrine other patients with severe PHA had two homozygous mutations, glands, such as salivary and sweat glands. ENaC plays an important a novel deletion mutation in exon 8 of the αENaC gene and a splice role in electrolyte homeostasis and the control of blood volume and site mutation in intron 12 of the βENaC gene. Most of the PHA-causing blood pressure.14,15 mutations appear in the αENaC gene located on chromosome 12 In the absence of a fully functional ENaC, multisystem PHA patients rather than in the β and γENaC genes located tandemly on chromo- lose salt from all aldosterone-dependent epithelial cells. The clinical some 16. However, the frequency of sequence variants in patients and laboratory characteristics of multisystem PHA include severe and and control subjects showed no difference between genes. life-threatening episodes of salt wasting with extreme hyperkalaemia, Conclusions Severe PHA cases are associated with mutations hyponatraemia, dehydration, failure to thrive and markedly elevated leading to absence of normal-length α, β or γENaC, while a mild case levels of aldosterone and plasma renin activity (PRA).1,7 –11,16 Disease symptoms manifest during the first week of life and require prolonged hospitalizations. Salt-wasting episodes recur frequently and the Correspondence: Aaron Hanukoglu, Department of Paediatrics, E. Wolfson patients need life-long high-salt therapy (iv or dietary salt supple- Medical Centre, Holon, 58100 Israel. Tel.: 972-3-5028420; Mobile: 972-52- mentation up to 45 g/day). The mortality rate is high, especially during 8366628; Fax: 972-3-5028164; E-mail: aaronh@science.co.il the neonatal period. © 2005 Blackwell Publishing Ltd 547
  • 2. 548 O. Edelheit et al. Besides the usual symptoms of salt wasting, we have reported that terminators (ABI). Dye terminators were removed using DyeEx Spin the multisystem PHA patients also frequently exhibit respiratory kit (Qiagen) and the DNA sequences were analysed in our laboratory tract disease, especially up to the age of 5–6 years.17 The cause of these using an ABI automated DNA sequencer. pulmonary manifestations was shown to be excess liquid in the air- ways due to inadequate absorption of Na and water because of defect- Results ive ENaC function.7 These phenotypic features exist uniformly in all affected patients. The question of possible phenotype–genotype rela- Clinical course of PHA patients tionships in PHA has not been addressed in previous studies. This is probably because of the rarity of the syndrome and lack of long- All three PHA cases described below followed a severe course of term follow-up evaluation of PHA patients. multisystem PHA during the neonatal period with increased con- In this study, we have examined three independent patients with centrations of sodium and chloride in sweat and saliva (Table 2). multisystem PHA who share the basic common characteristics of Patient 44 followed a clinical course that differed significantly beyond the disorder. Beyond the neonatal period, long-term (up to 8·3 years) this period. He was born at full term to healthy nonconsanguineous prospective evaluation of two of the patients showed significant Polish parents (birthweight 4·1 kg). He presented at the age of 3 days differences in the severity and the course of disease. Our findings with severe electrolyte disturbances, poor feeding, vomiting and revealed different types of mutations that help to explain the different weight loss. His younger brother aged 2 years 8 months is healthy. phenotypic expression of multisystem PHA. We examine and classify all Laboratory examinations showed marked hyponatraemia, hyper- previously reported cases in the light of the phenotypic and genotypic kalaemia and metabolic acidosis (pH 7·3; HCO3, 13·7 mmol / l). Episodes differences we observed in our new patients. of hypovolaemic shock and severe electrolyte imbalance persisted for 2 weeks despite therapy with iv fluids, bicarbonate and NaCl. Laboratory evaluation revealed persistent hyperaldosteronism and Subjects and methods hyper-reninaemia with urinary salt wasting and increased Na/K ratios (Table 2). Other renal and adrenal functions were normal. He gradu- Subjects ally improved with iv NaCl therapy (11 g /day) and cation exchange resin The backgrounds of the PHA patients are presented together with (1 g /kg /day). He was discharged at the age of 4·5 months. their clinical description. The control population for examination After discharge he remained free of salt-wasting episodes and of the frequency of the novel missense mutation included 60 normal lower respiratory tract infections and did not require hospitaliza- subjects from Szczecin and Katowice regions in North and South tion throughout the entire follow-up period. Laboratory data were Poland, respectively. Patients and control individuals whose entire consistent with milder salt wasting. During follow-up visits every coding regions of α, β and γ ENaC genes were sequenced represent 1–6 months (Table 3), electrolyte levels were within the normal the following ethnic groups: Israeli-Arab, Belgian, Canadian, Jewish range except for an isolated episode of mild hyponatraemia and (Sephardic), Polish and Turkish. hyperkalaemia at 5 months of age (Na, 133 mmol / l; K, 6·4 mmol/l). His urinary sodium/potassium ratio remained significantly lower than the ratio observed in the other two patients (Table 2). Sweat and Genomic DNA isolation, PCR and sequencing saliva electrolytes (N = 8) remained persistently elevated (Table 2). Genomic DNA of the patients and their relatives was extracted from Cation exchange resin was discontinued at the age of 15 months. white blood cells as described previously.13 The DNA samples of the Currently, at 8·3 years of age he is still on a high-salt diet (8 g NaCl/ control subjects were isolated from the umbilical blood of a contiguous day) and is growing normally. series of neonates. Patient 66 was born after a normal pregnancy (birthweight Segments of α, β and γ ENaC genes were amplified using previously 3·2 kg). His parents are Israeli Arabs whose grandparents were first described primer sets13 and additional primer sets shown in Table 1. cousins. The parents and two brothers aged 8 and 4 are healthy. A Polymerase chain reaction (PCR) was carried out using a Taq poly- younger sister died at the age of 3 months after a short illness. The merase kit (Takara, Japan). PCR products were run on 2% agarose patient was hospitalized at 6 days of age because of a shock-like gel, extracted and purified using QIAquick Gel Extraction kit episode and severe dehydration. Laboratory findings showed marked (Qiagen, Germany). Sequencing reactions were carried out using dye hyperkalaemia, hyponatraemia, acidosis (pH 7·2) and increased urinary Table 1. New primer sets used to amplify and sequence Primer Exon Forward Reverse Temperature (°C) exons and introns of the human α, β and γ ENaC genes A5F–A5RO 4 cctctgactctagtctctgtgtc agagcaaggagccaggcagga 65 A5aR 5 taggaggtgagctcaaggta 60 A6aF 6 tcttcctgaacttgcttctc 55 B10FO–B10RO 10 cgcagagagagacctgcatt agacttgtccccagccaaag 64 G2FO–G2·1RO 2 aagggcggatggactggtgt gcgtttccctgctcatgcct 65 G11F–G12R 13 ttgatggtgtggcttggcctg gatctgtcttctcaaccctgc 60 © 2005 Blackwell Publishing Ltd, Clinical Endocrinology, 62, 547–553
  • 3. ENaC mutations in pseudohypoaldosteronism 549 136 –146 Table 3. Principal differences between mild (patient 44) and severe Normal 55– 388 The numbers in parentheses are the range of values. *Normal aldosterone and PRA in infants younger than 3 months: aldosterone < 3051 pmol/ l; PRA < 10 ng/ l s. †Renin level in patient TR2 is expressed in 3·5– 5 phenotypes of multisystem PHA beyond 5 months of age < 50 < 50 < 50 < 40 ca. 2 <3 Phenotype 25 days − 5 months Mild Severe TR2 Out-patient 136 (135 –139) 4·7 (4·1–5·2) Salt wasting Mild Severe Hospitalization None Frequent Respiratory illness No Yes 88 56 41 82 – – – Growth failure No Yes Therapy NaCl, Kayexalate NaCl, sodium bicarbonate Kayexalate, gastrostomy TR2 In-patient 8 days−25 days 128 (113 –144) 101 (76 –126) 6·8 (3·2–9·5) Mortality No High risk 26 (14– 33) Mutations Compound heterozygote See Table 4 > 500† 12 259 (missense and deletion) 140 – – 4·5 months − 3·5 years sodium (47 mmol /l) and Na/K ratio (Table 2). He was treated with iv saline, and Kayexalate. Aldosterone level and PRA were markedly 5172 (55 –10 290) 66 Out-patient 138 (125 –147) 138 (129 –146) 189 (101–266) elevated. Renal, adrenal and thyroid function tests (renal ultrasound, 131 (95 –157) 4·6 (3·1– 6·8) 40 (7·4 – 84) basal and ACTH-stimulated 17-hydroxyprogesterone and cortisol, 23 (3– 43) free T4 and TSH levels) were normal. Urinary Na and Na/K ratios 220 remained high (Table 2). Frequent episodes of salt wasting and Table 2. Biochemical characteristics of multisystem PHA patients at first admission and during hospitalization and follow-up marked hyperkalaemia (up to 10 mmol /l) necessitated prolonged hospitalization. He was discharged at the age of 4·5 months. Recurrent 6 days − 4·5 months episodes of vomiting and dehydration persisted (hospitalizations 290 (38 –1780) 1110 to > 6935 135 (126 –143) 5·9 (3·2 –10·6) every 1–3 months). To prevent life-threatening salt-wasting episodes, 107 (38 –232) 66 In-patient gastrostomy was performed at 14 months of age to provide high amounts of NaCl (20 g/day) and improve his caloric intake. > 50 Additional clinical characteristics included persistent clear nasal – – – discharge, frequent lower respiratory infections associated with wheezing, and failure to thrive. Following gastrostomy, the number 10 208 (6796 –19 170) 4·5 months − 8·3 years of hospitalizations decreased significantly (1–2 per year). However, he still gets lower respiratory infections. Currently, at the age of 4 years 10·4 (3·8 –18·5) 44 Out-patient 140 (133 –146) 199 (198, 200) 108 (80 –120) 4·3 (3·8 – 4·8) 4·8 (4·4 – 6·4) he is still on a high-salt diet (15 g NaCl/day) by gastrostomy and 71 (42–110) 69 (50 – 95) Kayexalate. Patient TR2 was born at term and delivered by caesarean section. Her birthweight was 3·65 kg. Her parents are first cousins. A brother and sister died at the age of 1 week after a fulminant, undiagnosed illness characterized by vomiting. A 17-year-old sister has been followed 16 491 (14 563 –18 419) up for congenital hepatic fibrosis. The patient was transferred to a 3 days − 4·5 months neonatal intensive care unit at 8 days of age with a 1-day history of 127 (116 –141) vomiting. Physical examination revealed a mildly dehydrated infant, 7·6 (4·6– 9·5) 44 In-patient 93 (60 –143) 12·5 (7–18) 11 (6·7–16) 91 (90– 92) weighing 3·4 kg. Laboratory examination showed marked hypo- natraemia and hyperkalaemia with urinary salt wasting. PRA and aldosterone levels were extremely high (Table 2). Renal and adrenal – – functions tests were otherwise normal. She was treated with iv NaCl and Kayexalate. Because of extremely high potassium levels, peritoneal Serum aldosterone* (pmol/ l) dialysis was also performed. Currently, at 5 months of age, she is on a high-salt diet (3 g NaCl/day) and Kayexalate (4 g × 3/day) and ng/ l (normal: 2·4–21·9). Salivary Na (mmol / l) Salivary Cl (mmol / l) is developing normally. Her electrolytes are now normal (Table 2). Serum Na (mmol / l) Urine Na (mmol / l) Serum K (mmol/ l) Sweat Cl (mmol / l) Urine Na/K ratio PRA (ng/ l s)* PHA-associated mutations Patient We sequenced the complete coding regions and intron–exon junctions Age of the α, β and γ ENaC subunit genes of the PHA patients. In patient 44, © 2005 Blackwell Publishing Ltd, Clinical Endocrinology, 62, 547– 553
  • 4. 550 O. Edelheit et al. Fig. 1 Compound heterozygote mutations in the gene encoding the αENaC subunit in family 44. Left panel: Exon 5 region missense mutation: 1078 G→T, Gly327Cys. The sequences for both the mother (M) and PHA son show heterozygosity with G and T at the same location (boxed), while the father’s sequence is normal. Right panel: Exon 8 region deletion mutation: 1404delC, Phe435fr. The sequences for both the father (F) and PHA son show heterozygosity with a deletion at the same location (boxed), while the mother’s sequence is normal. we observed two heterozygous mutations in exons 5 and 8 of αENaC (Fig. 1, Table 4). The first mutation was found in the last nucleotide of exon 5 (1078 G→T), which converted GGT codon coding for glycine-327 into a TGT codon coding for cysteine. Thus, this allele encodes a protein with a missense mutation (Gly327Cys). The mutation at exon 8 (1404delC) was a deletion that would result in a frameshift mutation (Phe435fr) (Fig. 1). Sequencing the genomic DNA of both parents and maternal and paternal grandparents revealed that the mutation in exon 5 was inherited from the maternal grandfather, and the mutation in exon 8 was inherited from the paternal grandfather (Figs 1 and 2). Genomic DNA of a sibling who shows no signs of PHA showed a normal sequence without these heterozygosities, indicating that he inherited the normal alleles from both parents. Sequencing of αENaC exon 5 from 60 normal Polish control subjects Fig. 2 Pedigree of family 44 showing inheritance pattern of mutations. The did not show any mutation in this region. The mutated Gly327 mother and maternal grandfather carry a heterozygous missense mutation (black) appears in the extracellular domain of αENaC in a region that is in αENaC exon 5 (1078G→T, Gly327Cys). The father and paternal grandfather strictly conserved in all known sequences of ENaC from eight species, carry a heterozygous deletion mutation (shaded) in αENaC exon 8 (1404delC, Phe435fr). Normal alleles are shown in white. The arrow marks the propositus. including Xenopus (Fig. 3). For patient TR2 sequencing revealed a novel deletion mutation in exon 8 of the αENaC gene at Ser452 codon, which results in a frame- For patient 66, sequencing analysis revealed a homozygous shift error. Genomic DNAs of both parents showed heterozygosity mutation of G to A in the first nucleotide of intron 12 of the βENaC at this position, confirming that the patient inherited the mutated gene. This mutation changed the conserved GT pair at the 5′ end of allele from both parents (Fig. 4). the intron resulting in abnormal splicing of the βENaC mRNA, and © 2005 Blackwell Publishing Ltd, Clinical Endocrinology, 62, 547–553
  • 5. ENaC mutations in pseudohypoaldosteronism 551 Table 4. Mutations identified in coding regions of ENaC subunit genes in patients with autosomal recessive multisystem PHA Subunit Location Mutation Codon change Phenotype Ethnicity Reference Missense mutation Alpha Exon 5 1078 G→T Gly327Cys* Mild* Polish This study Alpha Exon 13 1784C→T Ser562Leu* Mild?* Swedish Schaedel et al.8 Beta Exon 2 236 G→A Gly37Ser ? Arab Chang et al.4 Non-missense mutation Alpha Exon 2 256 C→T Arg53stop ? Northern Europe Kerem et al.7 Alpha Exon 2 302delTC Ile68fr Severe Saudi Chang et al.4 Alpha Exon 3 604delAC Thr169fr Severe Hispanic Kerem et al.7 Alpha Exon 4 828delA Ser243fr Severe Swedish Schaedel et al.8 Alpha Exon 8 1404delC Phe435fr Severe Hispanic Kerem et al.7 Alpha Exon 8 1439insT Tyr447fr Severe Pakistani Saxena et al.11 Alpha Exon 8 1449delC His450fr* Mild* Polish This study Alpha Exon 8 1449delC His450fr Mild/Severe† Swedish Schaedel et al.8 Alpha Exon 8 1455delC Ser452fr NLT Turkish This study Alpha Exon 10 Arg492stop Severe Dutch? Bonny et al.10 Alpha Exon 11 1621C→T Arg508stop Severe Indian Muslim Saxena et al.11 Alpha Exon 11 1621C→T Arg508stop Severe Jewish (Iranian) Chang et al.4 Kerem et al.7 Beta Exon 3 647insA Leu174fr ? Jewish (Ashkenazi) Kerem et al.7 Beta Exon 5 915delC Ser263fr ? Jewish (Ashkenazi) Kerem et al.7 Beta Intron 12 1669 + 1G→A Abnormal splicing Severe Arab This study 11 Beta Intron 12 1669 + 1G→A Abnormal splicing Severe Scottish Saxena et al. Gamma Intron 2 318 − 1G→A Abnormal splicing NLT Indian Strautnieks et al.6 Gamma Intron 12 1570 − 1G→A Abnormal splicing Severe Japanese Adachi et al.9 Gamma Exon 13 1627delG Val543fr Severe Japanese Adachi et al.9 *Compound heterozygote including a missense mutation. †Mild phenotype in association with missense. Severe phenotype in association with another deletion mutation. NLT, no long-term clinical data. Fig. 3 Comparison of the sequences of αENaC from eight species. The arrow marks the position of the Gly327Cys mutation. Note that glycine at this position is conserved in all species. The segment of the human sequence starts at Pro-264 and ends at Pro-341. Sequences from other species were obtained from the Swiss-Prot protein database. consequently absence of normal βENaC subunit. Genomic DNAs of Table 5. Frequencies of sequence variants observed in all three ENaC subunit genes both parents showed heterozygosity at this position, confirming that whose coding regions were sequenced entirely for seven independent subjects the patient inherited the mutated allele from both parents (data not shown). αENaC βENaC γENaC SCNN1A SCNN1B SCNN1G For all three patients noted above, sequencing of all three subunit genes did not reveal additional changes that could be associated with Chromosome 12 16 16 PHA. The sequencing of the entire coding regions of all three subunit Variants 2 2 2 genes in the three patients and in four additional subjects representing Length (bp) 2007 1920 1947 altogether five different ethnic groups revealed only a few phenotypically Frequency/1000 bp 0·997 1·042 1·027 silent sequence variants different from previous sequences (Table 5). Entrez Accession codes for reference sequences: SCNN1A: X76180; SCNN1B: AJ005383; SCNN1G: AF356502. Discussion In this study we have identified four mutations responsible for The majority (19 out of 22) of the multisystem PHA-associated multisystem PHA in three new patients. Together with the findings mutations led to abnormal-length mRNA or protein as a result of presented here, world-wide there are 22 independent mutations deletion, insertion or splice site mutations (Table 4). Without excep- known in the coding regions of ENaC subunit genes (Table 4). tion, all these mutations are associated with the severe phenotype of © 2005 Blackwell Publishing Ltd, Clinical Endocrinology, 62, 547– 553
  • 6. 552 O. Edelheit et al. Fig. 4 Sequence of the αENaC gene exon 8 segment with a deletion mutation in patient TR2. The top sequence belongs to patient TR2. The arrow marks the position of the deleted nucleotide C. The bottom two sequences are of the father and mother, respectively. Both sequences show heterozygosity with a normal allele (AGCACAGTTCCTGG) and an abnormal allele with a deletion (AGCACAGTTCTGGG). Sequencing was carried out using primer A9F. PHA (Table 2) that matches the first description of multisystem The observation of a milder phenotype for missense as opposed PHA.1 to a severe phenotype for nonmissense mutations in ENaC subunit Only three out of the 22 known mutations are missense genes is understandable. While the nonmissense mutations lead to mutations. Our patient with the missense mutation represents absence of normal-length protein, missense mutations allow synthesis the first well-documented PHA patient with long-term follow- of a normal-length subunit that is more likely to support channel up (over 8 years) who had a mild form of PHA unlike other PHA activity than an absent subunit. Schaedel et al.8 suggested that lung patients (Table 3). Beyond infancy, while the clinical course of symptoms in PHA are associated with defective αENaC subunits patient 44 was characterized by mild renal salt wasting, absence rather than βENaC or γENaC. However, frequent pulmonary of lower respiratory tract symptoms and normal growth, patient diseases have been described recently in a 7-year-old Japanese child 66 exhibited recurrent salt-wasting episodes and pulmonary with compound heterozygous mutations in the γENaC subunit infections throughout follow-up. Therapeutic measures necessary gene.9 Our patient 44 with a mutation in the αENaC subunit to prevent salt wasting were also milder in patient 44 relative to the had no recurrent pulmonary infections. Thus, present data do not severe cases. The patient did not require Kayexalate after the support a specific association of only the αENaC subunit with the age of 15 months, and dietary NaCl supplementation was suffi- severe phenotype. cient to normalize electrolytes allowing normal growth. The In the absence of in vitro expression studies on the mutated patient with the αENaC Ser562Leu mutation was also reported subunit we do not know the precise effect of the mutation on the to show mild pulmonary manifestations, but the extent of renal ENaC structure and function. The Gly327Cys mutation is located in salt wasting was not reported.8 The report for the third patient the extracellular domain of αENaC (see compared sequences13). with a Gly37Ser mutation does not have sufficient clinical data Thus, our results indicate that the extracellular domain is important for classification.4 for the function of the subunit. Understanding the specific structural © 2005 Blackwell Publishing Ltd, Clinical Endocrinology, 62, 547–553
  • 7. ENaC mutations in pseudohypoaldosteronism 553 and functional consequences of the mutation awaits determination epithelial sodium channel gene in three pseudohypoaldosteronism of the structure of this domain. type 1 families. Nature Genetics, 13, 248 –250. The majority of the multisystem PHA mutations (14 out of 22) 6 Strautnieks, S.S., Thompson, R.J., Hanukoglu, A., Dillon, M.J., appear on the αENaC gene (Table 4). Within the αENaC gene the Hanukoglu, I., Kuhnle, U., Seckl, J., Gardiner, R.M. & Chung, E. (1996) Localisation of pseudohypoaldosteronism genes to chromo- mutations appear more frequently in exon 8. It still remains to be some 16p12.2–13.11 and 12p13.1-pter by homozygosity mapping. seen whether this tendency will persist as more novel mutations Human Molecular Genetics, 5, 293 –299. are discovered. The frequencies of phenotypically silent sequence 7 Kerem, E., Bistritzer, T., Hanukoglu, A., Hofmann, T., Zhou, Z., variants are low and do not show a difference among the different Bennett, W., MacLaughlin, E., Barker, P., Nash, M., Quittell, L., subunit genes located on different chromosomes (Table 4). The Boucher, R. & Knowles, M.R. (1999) Pulmonary epithelial sodium- number of single nucleotide polymorphism (cSNP) in the NCBI channel dysfunction and excess airway liquid in pseudohypoaldos- SNP database (http://www.ncbi.nlm.nih.gov/SNP/) is 7, 12 and 10 teronism. New England Journal of Medicine, 341, 156 –162. for the α, β and γ subunits, respectively. In addition to the coding 8 Schaedel, C., Marthinsen, L., Kristoffersson, A.C., Kornfalt, R., region mutations noted in Table 4, a PHA associated mutation has Nilsson, K.O., Orlenius, B. & Holmberg, L. (1999) Lung symptoms also been reported in the promoter region of the αENaC gene.18 in pseudohypoaldosteronism type 1 are associated with deficiency The deletion in exon 8 (1404delC) was previously observed in a of the alpha-subunit of the epithelial sodium channel. Journal of Pediatrics, 135, 739 –745. Swedish patient with multisystem PHA in combination with a different 9 Adachi, M., Tachibana, K., Asakura, Y., Abe, S., Nakae, J., Tajima, T. mutation.8 We do not know whether our finding of the same exon 8 & Fujieda, K. (2001) Compound heterozygous mutations in the mutation in a Polish family reflects a common origin. gamma subunit gene of ENaC (1627delG and 1570 –1G→A) in one In patient 66 of Arabic origin we identified a homozygous mutation sporadic Japanese patient with a systemic form of pseudohypoaldos- causing abnormal splicing, identical to a mutation we recently reported teronism type 1. Journal of Clinical Endocrinology and Metabolism, in a Scottish patient.11 This mutation should lead to the absence of 86, 9 –12. normal mRNA for the βENaC subunit. The mutation is located at 10 Bonny, O., Knoers, N., Monnens, L. & Rossier, B.C. (2002) A novel a CpG hotspot. Therefore, it does not necessarily indicate a common mutation of the epithelial Na+ channel causes type 1 pseudohy- genetic origin for the mutations. poaldosteronism. Pediatric Nephrology, 17, 804 – 808. The new multisystem pseudohypoaldosteronism cases and 11 Saxena, A., Hanukoglu, I., Saxena, D., Thompson, R.J., Gardiner, R.M. mutations elucidated in this report provide a better understanding & Hanukoglu, A. (2002) Novel mutations responsible for autosomal recessive multisystem pseudohypoaldosteronism and sequence of the molecular bases of this disease and their phenotypic expression. variants in epithelial sodium channel alpha-, beta-, and gamma- The mutations provide clues about functionally important regions subunit genes. Journal of Clinical Endocrinology and Metabolism, 87, of epithelial sodium channel subunits. 3344 –3350. 12 Canessa, C.M., Schild, L., Buell, G., Thorens, B., Gautschi, I., Acknowledgements Horisberger, J.D. & Rossier, B.C. (1994) Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature, 367, This research was partially supported by a grant from the Chief 463 – 467. Scientist of the Israel Ministry of Health. 13 Saxena, A., Hanukoglu, I., Strautnieks, S.S., Thompson, R.J., Gardiner, R.M. & Hanukoglu, A. (1998) Gene structure of the human amiloride-sensitive epithelial sodium channel beta subunit. References Biochemical and Biophysical Research Communications, 252, 208 –213. 1 Hanukoglu, A. (1991) Type I pseudohypoaldosteronism includes two 14 Rossier, B.C., Pradervand, S., Schild, L. & Hummler, E. (2002) clinically and genetically distinct entities with either renal or multiple Epithelial sodium channel and the control of sodium balance: inter- target organ defects. Journal of Clinical Endocrinology and Metabolism, action between genetic and environmental factors. Annual Review of 73, 936 – 944. Physiology, 64, 877– 897. 2 Zennaro, M.C. & Lombes, M. (2004) Mineralocorticoid resistance. 15 Garty, H. & Palmer, L.G. (1997) Epithelial sodium channels: function, Trends in Endocrinology and Metabolism, 15, 264 –270. structure, and regulation. Physiological Reviews, 77, 359 –396. 3 Tajima, T., Kitagawa, H., Yokoya, S., Tachibana, K., Adachi, M., 16 Oberfield, S.E., Levine, L.S., Carey, R.M., Bejar, R. & New, M.I. Nakae, J., Suwa, S., Katoh, S. & Fujieda, K. (2000) A novel missense (1979) Pseudohypoaldosteronism: multiple target organ unrespon- mutation of mineralocorticoid receptor gene in one Japanese family siveness to mineralocorticoid hormones. Journal of Clinical with a renal form of pseudohypoaldosteronism type 1. Journal of Endocrinology and Metabolism, 48, 228 –234. Clinical Endocrinology and Metabolism, 85, 4690 – 4694. 17 Hanukoglu, A., Bistritzer, T., Rakover, Y. & Mandelberg, A. (1994) 4 Chang, S.S., Grunder, S., Hanukoglu, A., Rosler, A., Mathew, P.M., Pseudohypoaldosteronism with increased sweat and saliva electro- Hanukoglu, I., Schild, L., Lu, Y., Shimkets, R.A., Nelson-Williams, C., lyte values and frequent lower respiratory tract infections mimicking Rossier, B.C. & Lifton, R.P. (1996) Mutations in subunits of the cystic fibrosis. Journal of Pediatrics, 125, 752–755. epithelial sodium channel cause salt wasting with hyperkalaemic 18 Thomas, C.P., Zhou, J., Liu, K.Z., Mick, V.E., MacLaughlin, E. & acidosis, pseudohypoaldosteronism type 1. Nature Genetics, 12, 248 – Knowles, M. (2002) Systemic pseudohypoaldosteronism from 253. deletion of the promoter region of the human beta epithelial Na(+) 5 Strautnieks, S.S., Thompson, R.J., Gardiner, R.M. & Chung, E. channel subunit. American Journal of Respiratory Cell and Molecular (1996) A novel splice-site mutation in the gamma subunit of the Biology, 27, 314 –319. © 2005 Blackwell Publishing Ltd, Clinical Endocrinology, 62, 547– 553