Your SlideShare is downloading. ×
Sequenciamento
Upcoming SlideShare
Loading in...5
×

Thanks for flagging this SlideShare!

Oops! An error has occurred.

×
Saving this for later? Get the SlideShare app to save on your phone or tablet. Read anywhere, anytime – even offline.
Text the download link to your phone
Standard text messaging rates apply

Sequenciamento

2,326
views

Published on

Published in: Technology

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
2,326
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
63
Comments
0
Likes
0
Embeds 0
No embeds

Report content
Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
No notes for slide

Transcript

  • 1. Seqüenciamento Prof. Rodrigo Niskier biomedrodrigo.page.tl [email_address]
  • 2. Seqüenciamento
      • Técnica pela qual a ordem exata dos nucleotídeos em um segmento de DNA pode ser determinada.
  • 3. Método de Sanger-Coulson: nucleotídeos terminadores de cadeia
    • Necessita de DNA fita simples
    • Utiliza apenas um dos primers
    • Utiliza dNTPs marcados radioativamente ( 32 P ou 35 S-dNTP)
    • Utiliza didesoxinucleotídeos (ddNTPs)
  • 4.  
  • 5.  
  • 6. Seqüenciamento automático de DNA
    • Utilização de marcadores fluorescentes ligados a cada um dos ddNTPs
    • Ocorre apenas uma reação de seqüenciamento como os 4 ddNTPs
    • Moléculas terminadas com ddNTPs diferentes podem ser identificadas por meio de seus sinais fluorescentes distintos
  • 7.  
  • 8. Seqüenciamento automático de DNA
    • A amostra pós-PCR é aplicada num gel ou em um capilar de poliacrilamida e então passado por um detector de fluorescência
    • O detector identifica o sinal fluorescente emitido pelas bandas e transmite os dados para o computador
    • O computador converte a informação na seqüência de DNA apropriada.
    • A seqüência pode ser impressa para análise ou enviada para um arquivo para ser analisada por softwares específicos
  • 9. Seqüenciamento automático de DNA
  • 10.  
  • 11. Análise do seqüenciamento
    • TAAAGTCCAGAGCCACCATCCTGGCCGCAGGTAGCCGCTGGTCTCCGGGGTCATCTAGCGTCCGACCTCGGAGCGTGCATCCCAGGACGGTGACACCCTCCCCTGAGCTTCGGCGGCCACACAACCTTCCAGGGAGCTACAATGGAAGAATCACAGGCAGAACTCAATGTGGAGCCCCCTCTGAGTCAGGAGACATTTTCCGACTTGTGGAACCTACTTCCTGAAAATAACCTTCTGTCCTCCGAGCTCTCCGCACCCGTGGATGACCTGCTCCCGTACACAGATGTTGCCACCTGGCTGGATGAATGTCCGAATGAAGCGCCCCAAATGCCAGAGCCTTCTGCCCCAGCTGCCCCGCCACCAGCCACCCCAGCACCAGCCACCTCCTGGCCCCTGTCGTCCTTTGTCCCCTCCCAGAAGACCTACCCTGGCAATTACGGTTTCCGTCTAGGGTTCCTGCAATCCGGAACAGCCAAGTCCGTGACCTGCACGTATTCCCCTTCCCTTAACAAGCTGTTCTGCCAGCTGGCCAAGACCTGCCCAGTGCAGCTGTGGGTCGACTCGCCACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGAAGTTGGAGCACATGACGGAGGTTGTGAGGCGTTGTCCCCACCATGAGCGCTCCTCTGACTATAGCGATGGTCTGGCCCCTCCTCAGCACCTTATCCGGGTGGAAGGGAATTTACGCGCGGAGTATTTGGACGACCGGAACACCTTTAGACACAGTGTGGTGGTGCCCTATGAGTCCCCCGAGATCGACTCTGAGTGCACCACCATCCACTACAATTTCATGTGTAACAGCTCCTGCATGGGGGGCATGAACCGGCGGCCCATCCTCACCATCATCACACTGGAAGACTCTTGTGGTAACCTGCTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTCCTGGGAGAGACCGCCGCACTGAGGAAGAAAATCTTCGCAAGAAGGGGCAGTCTTGCCCCGAGCCACCCCCTAGGAGCACTAAGCGAGCACTGCCTACCAACACCAGCTCCTCTCCACAGCCAAAGAAGAAACCACTGGATGGAGAGTACTTCACTCTTCAGATCCGTGGGTTTAAACGCTATGAGATGTTCCGAGAGCTGAATGATGCCTTGGAGCTGAAGGATGCTCTGGATGGAAGGGAACCAGGGGAAAGCAGGGCTCACTCTAGCCACCTGAAGTCTAAGAAGAGGCCTTCTCCCTCCTGCCATAAAAAACCAATGCTCAAGAGAGAGGGACCTGACTCAGACTGATGTCTTCTGCTTCCTGTCACCTGTTGACATCCCCACCCATATCCCCTGCTCCTTCCCTGGCATTTTTTAAGACTCAGGTGCTTAGACCTCTGCTTGGTGCAGGTGCGCCTTAGAAACCCCCTGGGAGTCTTCATCTGCTCAGCCTGTGGCTGTGCTAAAGAGGCAGACCTGCGCTCGTGGTTTCTGGGGATTTGGGGGGTGCTGGCGCTTTCCAGCTTAGCTTTCAAGGTTTTTACTGTGAGCCGTGTTCGGGAGAGGTCAGAATGTGTTCCTGCATGTGAGGAACATCTTATAACCAGCCATACACTGGGTTGGAAAACTCAGTCCTCTGCCATACTAGCCAGGGAAGCTATCTTAAGTTGTTCGATTTTCTCCTGACTTCATTGTTCACATCTATAAAAAACTGATAATCATACCTACCTCACGGGGGGTTTGTTGTGAGGGTTAATGAAATAATGTATGTCTGGCCCCAAAACCATTATTTGATTACATAATGTCTGGGACTTAGTGCCTTTTGTGGGTGCTGGTTCTTTGTCCCCCTGGGTGGATGATTTGACAGTTTCTGACTGAATGGCTGGTTAAAGGGAAGAAGTCTCCAAGTCCCTTCTCTCCTGGCCCTGCCAGATCATAACCCCTTGGTGAACCTCAGTGCCAAAGGGGAAAGCTCACCTTATCCTGGATCCCAGTGGCTTCCACCCCTGCTGTATCTGCCAGTACCTGTCTTATTTCCCCCAAATGCTTCCGCAGATTTCTTCTGTACTTTGCAAGGCACACCATGTCACCCACACCCCTCCTCTTCCCTTTTTATATCCCATTTTTTATATCAATTTCTTATTTTACAATAAAACTTTGCTACCAAAAAAAAAAAAAAAA
  • 12. Análise do seqüenciamento
    • Pesquisar cadeias abertas de leitura (ORF – open reading frames) = ATG
    • Existem 6 possíveis ORFs
    • ATTHECATATETHERAT
    • 5´ ATATGATATGATCGACTAGCATC 3´
    • 3´ TATACTATACTAGCTGATCGTAG 5´
  • 13.  
  • 14.  
  • 15.  
  • 16.