Pichon riviere y lacan
Upcoming SlideShare
Loading in...5
×
 

Pichon riviere y lacan

on

  • 636 views

PSICOLOGÍA SOCIAL Y PSICOANÁLISIS: PICHÓN CON LACAN

PSICOLOGÍA SOCIAL Y PSICOANÁLISIS: PICHÓN CON LACAN
Los grupos operativos a la luz de los cuatro discursos

Statistics

Views

Total Views
636
Views on SlideShare
636
Embed Views
0

Actions

Likes
1
Downloads
12
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Pichon riviere y lacan Pichon riviere y lacan Document Transcript

  • PPSSIICCOOLLOOGGÍÍAA SSOOCCIIAALL YY PPSSIICCOOAANNÁÁLLIISSIISS:: PPIICCHHÓÓNN CCOONN LLAACCAANN Los grupos operativos a la luz de los cuatro discursos AGRADECIMIENTOSAGRADECIMIENTOSAGRADECIMIENTOSAGRADECIMIENTOS El proyecto de investigación cuyo fruto es esta publicación no hubiera sido posible sin el apoyo decidido de la Licenciada Gladys Adamson, discípula de Enrique Pichón Rivière, que ha sido la pionera en la transmisión del grupo operativo en el contexto universitario Colombiano. Nuestra primera manifestación de gratitud a ella por sus aportes como asesora de la investigación y por su generosa amistad. Manifestamos también nuestro sentimiento de gratitud a los estudiantes Isabel Sepúlveda, Leonardo Colorado y Milena Montoya por su participación en este proyecto como asistentes de investigación, y de una manera muy especial al Padre Fray Marino Martínez Pérez; y, en su nombre, al equipo humano de la Fundación Universitaria Luis Amigó, por crear un espacio académico para el desarrollo y la investigación de la psicología social. Muchas gracias, de todo corazón.
  • 1 PPSSIICCOOLLOOGGÍÍAA SSOOCCIIAALL YY PPSSIICCOOAANNÁÁLLIISSIISS:: PPIICCHHÓÓNN CCOONN LLAACCAANN Los grupos operativos a la luz de los cuatro discursos ÍÍNNDDIICCEE Cap. Pág. Prólogo 2 Introducción 8 1. ¿Qué es el grupo operativo? 11 2. Teoría del vínculo social de Jacques Lacan. 20 2.1. El discurso del Amo 32 2.2. El discurso Universitario 34 2.3. El discurso de la Histérica 38 2.4. El discurso Psicoanalítico 43 3. La tarea como agente en los cuatro discursos 48 3.1. La tarea en el lugar del agente del discurso del Amo 48 3.2. La tarea en el lugar del agente del discurso del Universitario 66 3.3. La tarea en el lugar del agente en el discurso de la Histérica 76 3.4. La tarea en el lugar del agente del discurso Analítico 90 4. El coordinador como agente en los cuatro discursos 103 4.1. El coordinador y el discurso del Amo 103 4.2. El coordinador desde el discurso Universitario 107 4.3 El coordinador y el discurso Histérico 113 4.4. El coordinador en el lugar del agente del discurso Analítico 120 5. El grupo como agente en los cuatro discursos 127 5.1. El grupo en el lugar del agente en el discurso del Amo 127 5.2. El grupo en el lugar del agente en el discurso Universitario 133 5.3. El grupo en el lugar del agente en el discurso Histérico 139 5.4. El grupo en el lugar del agente en el discurso Analítico 146 6. Conclusiones de la investigación «Pichón con Lacan: el vínculo social» 152 6.1. Primera conclusión 152 6.2. Segunda conclusión 153 6.3. Tercera conclusión 154 6.4. Cuarta conclusión 155 6.5. Quinta conclusión 156 6.6. Sexta conclusión 157
  • 2 PPSSIICCOOLLOOGGÍÍAA SSOOCCIIAALL YY PPSSIICCOOAANNÁÁLLIISSIISS:: PPIICCHHÓÓNN CCOONN LLAACCAANN Los grupos operativos a la luz de los cuatro discursos PRÓLOGOPRÓLOGOPRÓLOGOPRÓLOGO Por: Lic. Gladis AdamsonPor: Lic. Gladis AdamsonPor: Lic. Gladis AdamsonPor: Lic. Gladis Adamson “Los Justos” Un hombre que cultiva un jardín, como quería Voltaire. El que agradece que en la Tierra haya música El que descubre con placer una etimología Dos empleados que en un café del sur juegan un silencioso ajedrez El ceramista que premedita un color y una forma Un tipógrafo que compone bien esta página, que tal vez no le agrada Una mujer y un hombre que leen los tercetos finales de cierto canto El que acaricia un animal dormido El que justifica o quiere justificar un mal que le han hecho El que agradece que en la Tierra haya Stevenson El que prefiere que los otros tengan razón Esas personas, que se ignoran, están salvando al mundo Jorge Luis Borges El marco que contextúa esta Investigación, es una feliz intersección producida en Latinoamérica entre dos países, Colombia y Argentina; dos Instituciones, FUNLAM y la Escuela de Psicología Social del Sur; dos cuerpos teóricos, la Psicología Social de Enrique Pichón Rivière y el Psicoanálisis de Jacques Lacan; numerosos encuentros profesionales que devinieron amistosos entre los docentes de ambas instituciones, comprometidos en la formación de Psicólogos Sociales. Enrique Pichón Rivière (1907-1977) es un pensador latinoamericano con un típico destino argentino. Nacido en Ginebra, Suiza y emigrado a la Argentina a los tres años con su familia francesa. Vivió en selvas tropicales y a la vera de uno de los más grandes ríos del mundo: el Paraná. Ello no le impidió ser uno de los pocos genios que habitó el suelo argentino. O tal vez fue justamente su destino de niño de una familia de vasta cultura europea inserto en un medio primitivo, lo que le dio esa amplitud de perspectiva y esa posibilidad de articular lo diverso, y lo que le permitió ver dimensiones que tal vez contextos de crianza mas tradicionales hubieran opacado. Perteneció a la vanguardia intelectual de las primeras décadas del siglo XX en la Argentina. Es de la misma generación que Roberto Arlt, Jorge Luis Borges, Xul Solar, Victoria Ocampo, Emilio Petorutti etc. Además de ser un crítico de arte muy reconocido en la Argentina, introdujo en el país la Psiquiatría Dinámica, el Psicoanálisis (fundó la Asociación Psicoanalítica Argentina en 1942), la Psicoterapia de Grupo, el Psicoanálisis de Niños, el Psicoanálisis de la Psicosis, la
  • 3 Investigación Social, el Análisis Institucional, el trabajo Comunitario y la Psicología Social. En lo que respecta al tema de este libro, Enrique Pichón Rivière nos interesa como Psicólogo Social. En este sentido su posicionamiento teórico es único. El denomina a su teoría ECRO. Encierra en este significante toda su obra y su singular perspectiva psicosocial. ECRO significa Esquema Conceptual, Referencial y Operativo. Designa un corpus teórico, conceptual, referido a un sector de lo real -lo intersubjetivo, lo vincular- y tal vez lo más importante: que sea de carácter Operativo. Incluye en su misma definición de teoría el destino de la misma, su exterior, podríamos decir, lo que ella produce: una transformación de la realidad. Lo Operativo marca y designa la direccionalidad radical de su teoría: la incidencia en lo real. Recién recibido de médico psiquiatra en la Universidad de Buenos Aires, gana el concurso como Psiquiatra en el Hospicio de Las Mercedes. Cuando se hace cargo de su rol no se encierra en un consultorio para abordar la problemática de la psicosis en un dispositivo del uno a uno. Observa, a través de la práctica social cotidiana en el Hospicio, que existe una fractura en el vínculo entre la familia del psicótico y el equipo de profesionales de la Institución, ello lleva progresivamente al abandono y segregación del paciente por parte de la familia. Observa una fractura en los vínculos del equipo de profesionales y entre los pacientes que viven aislados deambulando por los jardines y corredores del Hospicio. Frente a este diagnostico de múltiples fracturas vinculares elabora una estrategia de re- articulación vincular a través del trabajo en grupo con los enfermeros. La estrategia de intervención: podríamos definirla como operación de re- articulación simbólica. Allí donde hay “agujeros” (silencios, vacíos, fracturas) institucionales, donde hay repetición sin reflexión (estereotipias), donde hay sufrimiento, introduce un dispositivo grupal orientado a producir procesos de simbolización y comprueba que sus efectos de articulación son poderosos (los pacientes “comenzaron a sentirse bien cuidados”, “estos internos mejoraban ostensiblemente su salud mental”, “cuando en los servicios no había mas de uno o dos médicos, yo llegué a tener en el mío veinticinco”, etc.). Aquí es donde aparece esa estructura que constituirá su dispositivo privilegiado: el grupo operativo. La red vincular grupal aparece como la estructura óptima para acceder a un saber colectivo, un saber que está en acto en la institución, pero que no se sabe o, mas precisamente, no se sabe que se sabe (“El aprendizaje de los enfermeros fue sorprendente. Ellos tenían acumulada gran experiencia... Su dificultad era que no podían conceptualizar, entonces esa experiencia no les servía de nada”). Así, a partir de definir una tarea (“discutía con los enfermeros los diferentes casos”), los direccionaba a pensar acerca de su práctica, su acción. Su intervención apunta a lograr una estructura simbólica subjetiva e institucional más compleja y, a partir de una praxis (la práctica hospitalaria y la reflexión acerca de la misma), interrogar esos mecanismos repetitivos y ciegos con el fin de recuperar su direccionalidad en la Tarea hospitalaria, en función de la salud. Sus efectos eróticos no se hacen
  • 4 esperar, se dan en términos de creación, vitalidad, entusiasmo en los vínculos, en la participación. Su condición de genio le hace incluir ya en 1946 determinaciones histórico- sociales, políticas, además de las culturales, familiares y edípicas en la constitución de la subjetividad. Al analizar las fantasías siniestras presentes en la obra revulsiva del Conde de Lautréamont (1846-1870),1 un rioplatense nacido en Montevideo (República Oriental del Uruguay), considerado el precursor del surrealismo, dice: “Durante sus cinco primeros años habrá oído relatos de degollinas, descuartizamientos, cuyas víctimas eran muchas veces amigos de su padre”. “Habrá (…) oído contar muchas veces el martirio sufrido por franceses en manos de las fuerzas de los sitiadores”. Se está refiriendo a relatos producidos en el ámbito doméstico, en el ambiente familiar, a raíz del sitio que sufrió la ciudad de Montevideo por parte del ejército argentino. (1843-1851). E. Pichón Rivière, adolescente, era un admirador de los poetas malditos: Baudelaire, Mallarmé, Rimbaud, de quienes Alain Badiou dijo que en ausencia de filósofos, mostraban “lo real de esta época que fue mas bien la inconsistencia y la desorientación”. “La poesía mas concentrada, la mas tensa intelectualmente, la mas oscura también, designó y articuló, sola, esta esencial desorientación”. Y mas adelante, “Cuando Rimbaud colma de sarcasmos la “poesía subjetiva”, o cuando Mallarmé establece que el poema solo se da cuando su autor como sujeto se ha ausentado, ambos entienden que la verdad del poema adviene en tanto que lo que enuncia no da testimono, ni de la objetividad ni de la subjetividad”. “Al contrario (…) de lo que la poesía tiene una conciencia aguda es del vínculo”.2 Los poetas producen verdades, no necesariamente saber. Pichón Rivière arribó muy tempranamente a la inconsistencia y la desorientación de la modernidad a través de la verdad enunciada por los poetas malditos. Muy tempranamente percibe que el uno del individuo no existe, que todo sujeto es un anudamiento singular de una compleja trama vincular, porción compleja de tejido social que denomina situación. Lo nodular del ECRO de Enrique Pichón Rivière tiene que ver con la teoría del vínculo, este espacio intersubjetivo que designa al ser. El sujeto es donde no está, deviene cuando se descentra. El sujeto descentrado en el vínculo se encuentra aislado, excluido socialmente, se pierde. El Diccionario de equívocos define entre como vacío donde somos.3 Es en este sentido que Pichón Rivière piensa al ser. La noción de vínculo de Pichón Rivière corresponde a la huella, al rasgo permanente que va dejando la convergencia de prácticas sociales. Primero es la acción. Primero son las prácticas sociales, las cuales confluyen en determinado 1 “Los Cantos de Maldoror” 2 Alain Badiou. Manifiesto por la filosofía. Madrid: Ediciones Cátedra, 1990. Págs. 50 y 51. 3 Patricia Mercado/Walter Vargas. Diccionario de equívocos (una poética del desvío). Buenos Aires: Alción Editora, 2004.
  • 5 momento en estructuraciones vinculares. No serán meras huellas mnémicas dispersas, porque la estructuración subjetiva del vínculo contiene modalidades de pensamiento y de interpretación del mundo, modos de sentir (afectos modelizados) y modelos de acción. Pierre Bourdieu señala que la sociedad existe dos veces: como realidad objetiva externa y como estructura subjetiva. Esta estructura subjetiva de Pierre Bourdieu, el hábitus, equivale a la estructura vincular subjetiva que para Pichón Rivière es el ser mismo. El ser humano se define por su historia de prácticas sociales sedimentadas en su esquema referencial (modelos cognitivos, afectivos y de acción inconscientes). Otros autores habían remarcado previamente la importancia de la acción. Desde Giambattista Vico (1688-1744), que propuso reemplazar el cogito ergo sum cartesiano por la aseveración verum est factum ipsum: “lo verdadero es el hecho mismo”; seguido fundamentalmente por C. Marx, para quien la filosofía era sinónimo de acción: “hasta ahora los filósofos se han limitado a interpretar el mundo de diversas maneras, pero lo que debe hacerse es cambiarlo”. También está su famosa frase respecto de la alienación: “lo hacen pero no saben que lo hacen”. En 1895 Freud escribe su Proyecto de una Psicología para neurólogos. En esta obra singular y portentosa rastrea el origen de la representación psíquica. Ubica el inicio del primer significante psíquico a partir del acto de mamar, que denomina “experiencia de satisfacción”. Por la repetición del acto de mamar se efectúa, a nivel neuronal, una facilitación, una asociación por simultaneidad, entre tres elementos: 1) el registro sensible de la satisfacción, que implica que el hambre dolorosa vaya cediendo en su hiperestimulación. Ello indica un registro de lo placentero de la experiencia 2) la percepción de un objeto, el pecho y 3) la imagen motriz de la acción específica, llevada a cabo con el pecho. Estos tres elementos asociados darían lugar a la primera representación o significante psíquico: el pecho. O sea que S. Freud incluye en la misma constitución del objeto psíquico una dimensión de la acción. Paradójicamente, esta imagen motriz, esta dimensión de la acción en la relación con el objeto, fue el aspecto menos desarrollado en el psicoanálisis. Fue mucho más relevante la fundamentación teórica en relación a la idea del objeto, los significantes psíquicos y a la dimensión afectiva en relación al otro, que la dimensión de la acción. Ludwig Wittgenstein, filosofo de la Viena de principios de siglo XX, señala con énfasis: “el mundo es la totalidad de los hechos, no de las cosas”. Le interesa el lenguaje en acto, ya que, según él, tendemos a olvidarnos de la aplicación de la palabra. Para este autor, el conocimiento está íntimamente relacionado con la acción. El lenguaje puede ejercer en el ser humano un efecto hipnótico. Dice: “El lenguaje es un veneno que nos puede seducir, confundir y hechizar”. La naturaleza del lenguaje es ambigua”. “La filosofía es una batalla librada con el lenguaje contra el hechizo de nuestra inteligencia”. Para combatir este efecto de hipnotismo, él propone describir la lógica del mundo como juegos del lenguaje, la cual, en su opinión, “resulta provechosa, ya que se centra en la acción”.
  • 6 Nuestro mundo contemporáneo se caracteriza por grandes desplazamientos de poblaciones, ya sea por hambre o por guerras. Ello provoca por un lado fenómenos de transculturación y por otro, la existencia de comunidades interculturales. También vivimos tiempos de marginación, de xenofobia y de exclusión social. Todas estas problemáticas son de naturaleza vincular. De ningún modo pueden ser diagnosticadas como psicopatológicas. El contexto de cambios turbulentos en el que vivimos promueve la ruptura de las tramas vinculares que han sostenido la identidad y el proyecto de vida individual y familiar, creando condiciones de permanente incertidumbre. Estas problemáticas no pueden ser abordadas a través de la internación de los sujetos, como si se tratara de padecimientos psicopatológicos; ni tampoco a través de una medicación masiva, ni siquiera un proceso terapéutico, solución, por otra parte, impracticable. El sujeto de la era globalizada y como producto de esas rupturas vinculares, es un sujeto en crisis. Necesita, por lo tanto, reconstruir su esquema referencial (sus modelos de pensar, sentir y hacer en el mundo) y encontrar-producir nuevos tejidos sociales que lo alberguen, sostengan y posibiliten reencontrar un proyecto de vida y una razón para vivir. Para enfrentar este tipo de problemáticas es que Pichón Rivière proyectó la formación de Operadores psicosociales, profesionales formados en un marco referencial teórico, metodológico y técnico que visibilice y opere en las tramas y redes vinculares, y que sean capaces de reconstituir el tejido social sosteniendo la lógica de la cultura y las vicisitudes subjetivas frente al cambio. Este profesional es el Psicólogo Social y la disciplina que lo sustenta es la Psicología Social, un campo de saber especializado en las tramas vinculares humanas. Su tarea específica consiste en dar cuenta de aquello que acontece cuando los seres humanos interactúan o tienen prácticas sociales cotidianas conjuntas. Por ello el Psicólogo Social centra su intervención en grupos, organizaciones y comunidades. La investigación que hizo posible este texto, encarada por el equipo de docentes de la FUNLAM, articulando el concepto de discurso de Lacan y la noción de vínculo de Enrique Pichón Rivière, tiene como escenario el Grupo Operativo. La noción de discurso de J. Lacan permite analizar el aspecto más estructural del vínculo, lo que hace el posicionamiento de cada integrante del vínculo en la estructura, su producción y su verdad. Esta investigación “pone a dialogar” a Pichón Rivière con su antiguo amigo y colega francés Lacan, a quien conoce desde 1938. Ambos son psicoanalistas, psiquiatras apasionados por el abordaje de la psicosis, comparten su afinidad con el surrealismo. Los dos cuando piensan la constitución de la subjetividad, piensan en determinaciones que van más allá de la estructura edípica. “El inconsciente es el discurso del Otro” dice Lacan. “La Psicología Social debe dar cuenta de cómo la macroestructura social deviene fantasía inconsciente” plantea Pichón. Pichón Rivière arriba a la Psicología Social con una mirada psicoanalítica, por ello le resulta tan natural incluir la dimensión inconsciente en los vínculos humanos. El ECRO de Pichón Rivière es producto de una transdisciplina, una convergencia de
  • 7 saberes que él denominó epistemología convergente. Las distintas fuentes teóricas operaron como “cajas de herramientas”. Tomó de ellas “conceptos instrumentales” que operaron como herramientas para fundamentar y dar cuenta de una práctica específica de la Psicología Social: la práctica e intervención en las tramas vinculares complejas de los grupos, las organizaciones y las comunidades. Las fundamentales fuentes teóricas fueron la Psicología Social norteamericana (George Mead, Kurt Lewin), el Psicoanálisis (S. Freud, M. Klein, Fairbairn), y diversas disciplinas de las Ciencias Sociales como el materialismo dialéctico (Marx, Sartre, Lefevre), la antropología (Malinowski), epistemólogos como Bachelard, etc. Esta investigación pone a trabajar conceptos instrumentales del psicoanálisis en el interior de la Psicología Social. Para los discípulos de Enrique Pichón Rivière implica también situarnos frente al desafío de repensar los conceptos psicosociales del ECRO. Bienvenidos sean ambos: la investigación y el desafío.
  • 8 IIIIIIIINNNNNNNNTTTTTTTTRRRRRRRROOOOOOOODDDDDDDDUUUUUUUUCCCCCCCCCCCCCCCCIIIIIIIIÓÓÓÓÓÓÓÓNNNNNNNN PPPPPPPPoooooooorrrrrrrr:::::::: JJJJJJJJaaaaaaaaiiiiiiiimmmmmmmmeeeeeeee CCCCCCCCaaaaaaaarrrrrrrrmmmmmmmmoooooooonnnnnnnnaaaaaaaa Freud, Pichón y Lacan empezaron sus obras preguntándose por el malestar en el individuo y terminaron interrogándose por el malestar que proviene de los vínculos sociales. Los tres fueron primero psiquiatras, después psicoanalistas; y, en el momento de mayor madurez de su producción teórica, cada uno produjo una reflexión sobre el vínculo social y dejó, expresas o tácitas, herramientas de intervención de los síntomas sociales. 1. Freud1. Freud1. Freud1. Freud La subversión que produce la obra de Freud en el campo de los discursos y las prácticas que se ocupan del sujeto, tiene una dimensión teórica y una práctica. La dimensión teórica consiste en el descubrimiento del inconsciente, la dimensión práctica consiste en la creación de una nueva clase de vínculo social que no existía hasta entonces: el vínculo del analista con el analizante en el dispositivo analítico. El descubrimiento freudiano del inconsciente no solamente tendrá efectos para la explicación de la psicología individual, sino que será una herramienta útil para construir una teoría de la cultura y arrojar una luz lateral, que permite iluminar las verdades psicológicas cifradas en algunas producciones culturales como la religión, el mito, el chiste, la producción artística etc. Freud también mostrará que el psicoanálisis es un potente instrumento para contribuir a la reflexión de los vínculos sociales y algunos de sus síntomas, como la guerra, la enajenación en los fenómenos de masas, las neurosis colectivas y la infelicidad en la civilización. 2. Pichón2. Pichón2. Pichón2. Pichón Fundador y presidente de la Asociación Psicoanalítica Argentina, formaliza una “teoría del vínculo social” basada en el descubrimiento del inconsciente y crea un dispositivo de trabajo grupal, inspirado en el dispositivo analítico, que se denomina “El grupo operativo”, el cual define como un grupo centrado en la tarea. La diferencia fundamental con otros grupos de trabajo tradicionales radica en la función del coordinador. Se espera que el coordinador de un grupo operativo, escape a las tentaciones de gobernar como un amo, educar como un maestro, o colocarse en el lugar del ideal del grupo como el líder de una masa artificial. En eso asemeja al analista. Podría decirse que la coincidencia entre un coordinador de un grupo operativo y un analista no radica tanto en lo que hacen, sino en lo que no hacen. El grupo operativo de Pichón no es un psicoanálisis de grupo ni un psicoanálisis en grupo. En un grupo operativo no se trata de analizar el “inconsciente colectivo” de un grupo, ni analizar en grupo los “inconscientes individuales” de los participantes; en otras palabras, no pretende ser una réplica grupal del dispositivo freudiano
  • 9 individual. Aunque el grupo operativo se apoya en los conceptos freudianos y la función del coordinador guarda algunas semejanzas estructurales con el analista, el campo específico en el que se legitima el dispositivo del grupo operativo no es el psicoanálisis sino la psicología social. 3. Lacan3. Lacan3. Lacan3. Lacan Bajo la consigna de un retorno al espíritu de la investigación freudiana, Jacques Lacan acomete una segunda fundación del psicoanálisis. En 1968, el mismo año en que los estudiantes y los obreros Franceses se tomaron las calles de París, para protestar y denunciar que algo estaba haciendo síntoma en el lazo social, Lacan estaba impartiendo un seminario con un título un poco extraño para algunos: “el revés del psicoanálisis”. Pero más extraño era, para muchos, el problema del que se ocupaba el psicoanalista en aquel momento: “El vínculo social”. En este seminario, Lacan sorprende una vez más a su auditorio con una producción inédita en la que articula todos sus rendimientos teóricos anteriores. En ella introduce el término “discurso”, como una nueva noción en su edificio conceptual, al cual define como “modo de hacer lazo social”. El autor propone allí que todos los vínculos sociales se pueden explicar a partir de cuatro estructuras o matrices básicas. Tres de ellas ya existían antes del psicoanálisis: el discurso del amo, el discurso universitario, y el discurso de la histérica. El discurso psicoanalítico, según Lacan, es una nueva manera de hacer lazo social, que se introduce en el mundo a partir de Freud. 4. Pichón con Lacan4. Pichón con Lacan4. Pichón con Lacan4. Pichón con Lacan El camino que invitamos a recorrer a los lectores, en las páginas siguientes, se puede definir como una lectura de Pichón con Lacan. No se trata ciertamente de una relación entre la producción global de los dos autores sino de una articulación muy precisa: se trata de leer la propuesta del grupo operativo de Pichón a la luz de la propuesta de los cuatro discursos de Lacan. Para ello, elegimos tres nociones fundamentales para pensar cualquier grupo centrado en la tarea, que son a la vez ejes de la conceptualización del grupo operativo: “tarea”, “grupo” y “coordinador”. Trataremos de pensar cada una de ellas operando como “agente” de cada uno de los cuatro discursos de Lacan. Esta decisión definió la estructura del texto de la siguiente manera: Un primer capítulo en el que tratamos de responder a la pregunta ¿Qué es el grupo operativo?, un segundo capítulo en el que introducimos al lector en la “teoría del vínculo social de Jaques Lacan”. En el tercer capítulo tratamos de pensar qué ocurre en un grupo cuando “la tarea” ocupa el lugar dominante en cada uno de los cuatro discursos que propone Lacan; en el cuarto capítulo en el que intentamos pensar lo que ocurre en un grupo cuando es “el coordinador” quien está en el lugar dominante de
  • 10 cada uno de los cuatro discursos; y en el quinto examinamos lo que ocurre cuando “el grupo” mismo ocupa el lugar dominante. El motivo que nos llevó a emprender este camino fue la sospecha de que la reflexión lacaniana del vínculo social podría aportar importantes elementos para pensar los síntomas y los fenómenos latentes de los grupos en general y de los grupos operativos en particular. Este proyecto se inscribe en la propuesta de “epistemología convergente” de Enrique Pichón Rivière, entendida, en el mejor sentido, como un diálogo de saberes. Por ello, esta reflexión −así como la psicología social de Pichón−, aunque utiliza herramientas teóricas tomadas de diversas fuentes, entre ellas la psicoanalítica, no pretende inscribirse en el campo del psicoanálisis, sino en el de la psicología social. Una vez concluida esta investigación, creemos que el producto resultará de interés, no solamente para los interesados en la metodología de los grupos operativos, sino para todos aquellos profesionales y estudiantes del campo de las ciencias humanas que trabajan con grupos y que se interesan por aprender a leer los fenómenos latentes de la vida grupal.
  • 11 11111111........ ¿¿¿¿¿¿¿¿QQQQQQQQUUUUUUUUÉÉÉÉÉÉÉÉ EEEEEEEESSSSSSSS EEEEEEEELLLLLLLL GGGGGGGGRRRRRRRRUUUUUUUUPPPPPPPPOOOOOOOO OOOOOOOOPPPPPPPPEEEEEEEERRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIVVVVVVVVOOOOOOOO???????? Por: Hernando BernalPor: Hernando BernalPor: Hernando BernalPor: Hernando Bernal y Jaime Carmonay Jaime Carmonay Jaime Carmonay Jaime Carmona.... Es una técnica de intervención grupal de la psicología social, inspirada en el psicoanálisis. Se aplica en los escenarios clínico, educativo, organizacional y comunitario; en la prevención e intervención de diversas problemáticas psicosociales, como la drogodependencia, problemas de aprendizaje, procesos de cambio y resolución de conflictos. Además de sus aplicaciones terapéuticas y preventivas, puede ser empleada en estos mismos escenarios como dispositivo para la realización de tareas específicas que requieran una coordinación de grupos interdisciplinarios. También es una técnica privilegiada en la formación de psicólogos sociales y profesionales de otras áreas de las ciencias sociales4 , que aspiran a intervenir grupalmente en los niveles terapéutico, preventivo y de promoción de la salud mental, o en la resolución colectiva de problemáticas vinculares y apoyo de procesos comunitarios. Esta técnica fue creada a principios de los años 40 del siglo XX por el psicoanalista y psicólogo social de origen suizo, Enrique Pichón Rivière, fundador de la Asociación Psicoanalítica Argentina y de la primera escuela de psicología social en América Latina. Una definición condensada del grupo operativo que nos aporta su creador es la siguiente: “¿En qué consiste nuestra técnica? Se puede decir que en dos aspectos fundamentales: el aspecto manifiesto, explícito y el aspecto implícito o latente. En este sentido nos acercamos a la técnica analítica que es en realidad hacer consciente lo inconsciente, o sea hacer explícito lo implícito”5 . Esta referencia no agota ciertamente la definición de la técnica, pero tiene la virtud de subrayar lo específico del grupo operativo -que lo diferencia de otras técnicas de trabajo grupal-, a saber, que cuenta con la existencia de una dimensión latente de la vida grupal e interviene sobre ella, develándola. Una buena vía para acercarse a esta técnica puede ser examinar lo que podríamos llamar su mito de origen. El grupo operativo nació en una situación crítica, casi podríamos decir, extrema. Pichón trabajaba en el Hospicio de las Mercedes, un importante hospital psiquiátrico de Buenos Aires. Un día cualquiera, de manera súbita, la Dirección del Hospital retira el personal de enfermeros que atendía los pacientes a su cargo y estos quedan en estado de abandono. “Gracias a esa medida un poco absurda en ese momento, nació esta técnica, el grupo operativo como una técnica social, donde se hacía posible el tratamiento de los enfermos mentales por sus “colegas”…tomamos como punto de partida su visión como enfermos: primero hacía grupos con ellos y a través de esos grupos aprendían lo que era el insight, lo que era la alienación, y todo eso con algunos conceptos de 4 Algunas de las instituciones en los que se transmite esta metodología en programas de educación superior son: la Escuela de Trabajo Social de Universidad Complutense de Madrid, la Facultad de Psicología de la Fundación Universitaria Luis Amigó de Colombia, y múltiples escuelas de psicología social de Argentina, Uruguay y otros países de Suramérica. 5 Pichón, Enrique: “Historia de los grupos operativos”. En: El Proceso Grupal, del psicoanálisis a la psicología social (1). Buenos Aires: Editorial Nueva Visión, 1985. pág. 235. (Las cursivas son del autor)
  • 12 enfermería…se completó en muy poco tiempo la formación de los mejores enfermeros que he visto en mi vida profesional”6 . En ese primer grupo operativo del mito fundador estaban presentes varias aplicaciones al mismo tiempo, era un grupo de aprendizaje, pero también de apoyo a un equipo que realizaba tareas terapéuticas; y, por la definición misma de los integrantes, cumplía una función terapéutica muy importante, que podemos constatar en los resultados mencionados por el autor. Esta referencia tiene interés para los psicólogos sociales en Latinoamérica, porque con frecuencia debemos enfrentar situaciones de extrema precariedad de recursos. Este relato del nacimiento del grupo operativo es paradigmático también en cuanto a las posibilidades que ofrecen los grupos para autogestionar la resolución de sus propias necesidades; y es quizás más valioso por tratarse de un caso radical: enfermos mentales haciéndose cargo del apoyo al tratamiento de otros enfermos mentales. A raíz de la misma crisis en esta institución, Pichón descubrió la aplicación del grupo operativo con familias de pacientes psicóticos, como apoyo al trabajo terapéutico: “Al poco tiempo entonces, una semana o un poco más, dentro del Servicio se había extendido una actitud social de unos a otros, se organizaban salidas, altas (especie de prueba), la inclusión dentro del tratamiento de los grupos familiares, que completaron nuestra concepción social de la enfermedad mental, ya que a través de los grupos familiares detectábamos los factores que determinaban la enfermedad, el diagnóstico, el pronóstico y el tratamiento. La profilaxis podía ser dada en otros miembros de la familia”7 . Los grupos operativos que nacieron en el Hospicio de las Mercedes se pueden definir como grupos centrados en la tarea, y en este caso, la tarea podemos entenderla, de acuerdo con lo dicho, como el tratamiento grupal de trastornos psicológicos o el apoyo a dicho tratamiento (por parte de los grupos familiares). Quizá en este punto sea importante hacer una primera aclaración: no se trata de un psicoanálisis grupal, sino de una psicoterapia grupal, que tiene en cuenta los descubrimientos del psicoanálisis y utiliza algunas de sus herramientas teóricas, pero cuya fundamentación epistemológica es la psicología social. Estos grupos operativos pueden estar integrados por un grupo de enfermos, un grupo de terapeutas, o la familia de un psicótico. De acuerdo con Pichón, la tarea del coordinador en estos grupos se puede definir fundamentalmente como “promover un cambio (en un sentido grupal) operativo8 (cambio de una situación a otra), en el que lo explícito que tomamos como manifiesto se interpreta hasta que aparezca algo nuevo, un nuevo descubrimiento o un nuevo aspecto de la enfermedad”9 . 6 Ibíd. p. 240 7 Ibíd. p. 241 8 Las Itálicas son del autor 9 Op. cit. p, 235
  • 13 El mito fundador de esta técnica -como todo mito- tiene más de una versión. Hay una segunda historia de la creación de los grupos operativos, que ofrece el mismo Enrique Pichón Rivière. Ésta tiene que ver con una experiencia comunitaria de laboratorio social, realizada en la ciudad de Rosario, Argentina. Veamos lo que dice el autor al respecto: “El punto de vista de los grupos operativos, tal como hoy los concebimos, arranca de lo que denominamos la Experiencia Rosario (realizada en 1958). Dicha experiencia estuvo a cargo del Instituto Argentino de estudios sociales (IADES)”10 . En esta experiencia participaron aproximadamente 400 personas que fueron convocadas por medio de afiches fijados en algunos sitios concurridos de la ciudad. Cada grupo contaba con un número aproximado de nueve integrantes, un coordinador y uno o dos observadores que hacían sesiones de control con un coordinador general. El tema en torno al cual se articuló la tarea de los grupos operativos en aquella ocasión fue la didáctica interdisciplinaria. El propósito de este modelo del grupo operativo lo resume el autor de la siguiente manera: “su actividad está centrada en la movilización de estructuras estereotipadas a causa del monto de ansiedad que despierta todo cambio (ansiedad depresiva por abandono del vínculo anterior y ansiedad paranoide creada por el vínculo nuevo y la inseguridad consiguiente). En el grupo operativo, el esclarecimiento, la comunicación, el aprendizaje y la resolución de tareas coinciden con la curación, creándose así un nuevo esquema referencial”11 . Vale la pena subrayar que, aunque esta definición de la tarea ya no se plantea específicamente en términos clínicos, siempre subsiste una dimensión terapéutica de la misma. Este segundo paradigma del grupo operativo nace en el escenario comunitario, en función de tareas de aprendizaje, producción colectiva y comunicación de diversos saberes en grupos heterogéneos. En función de ello se definen las funciones: “La función del coordinador o copensor consiste especialmente en crear, mantener y fomentar la comunicación, llegando ésta, a través del desarrollo progresivo, a tomar la forma de una espiral, en la cual coinciden didáctica, aprendizaje, comunicación y operatividad”12 . El grupo operativo se define, pues, como un grupo centrado en la tarea; si se privilegia la versión del mito fundacional del Hospicio de las Mercedes, ésta tendrá un carácter más terapéutico; si se privilegia la versión de la “Experiencia Rosario”, tendrá un carácter más inclinado hacia la intervención en el escenario comunitario, los grupos interdisciplinarios, o los grupos de formación. Las dos versiones tienen un elemento en común, a saber, que en ambos casos el coordinador se destituye del lugar del amo y del maestro – en eso coincide con la posición del analista en el análisis-, y le confiere el protagonismo fundamental al grupo mismo en el 10 Pichón, Enrique: “Técnica de los grupos operativos” . Op cit. p, 108. 11 Op. cit. p, 120 12 Op cit. p, 112
  • 14 desarrollo de la tarea, incluida la definición de la misma, colocándose en la posición de un facilitador que, mediante la escucha y observación permanente del acontecer grupal, ayuda a superar los las dificultades que surgen en el grupo, mediante intervenciones que apuntan a develar los obstáculos latentes que interfieren en su realización. Una intervención del coordinador es pertinente en la medida en que ayuda al grupo a superar sus obstáculos. Gladys Adamson expresa esto con una fórmula breve y precisa: “La verdad de una interpretación (del coordinador) reside en su operatividad”. Este cambio de posición fundamental del coordinador respecto del grupo o la comunidad en que interviene, inscribe al grupo operativo en una tradición crítica en el campo de las ciencias humanas en América Latina, que ha tenido manifestaciones en otras disciplinas. En el campo de la pedagogía Paulo Freire opone a la concepción tradicional de la educación que él llama “bancaria”13 una propuesta que denomina “educación liberadora”. La educación bancaria se caracteriza fundamentalmente por la posición pasiva del educando, que es concebido como una especie recipiente vacío en el que el docente – agente activo del proceso-, deposita su saber como en un banco. En la educación liberadora de Freire el educando es concebido como un agente activo que posee unos saberes y unos intereses previos, y el pedagogo se desplaza a la posición de un facilitador, le da un lugar a los intereses y saberes del educando y le confiere el lugar protagónico en el proceso de aprendizaje14 . Un cambio semejante se puede observar en otras disciplinas. Es conocido que la antropología nació en Europa en el siglo XVIII al servicio del imperialismo Británico. Esta disciplina estuvo marcada durante el siglo XIX por el proyecto colonialista que le dio origen y por la visión etnocentrista de los autores europeos. De esta manera servía de dos maneras al discurso del amo, como una ideología racista que deificaba un grupo étnico y con ello justificaba las prácticas coloniales; y como una fuente de saber al servicio del poder. Durante el siglo XX, especialmente después de la segunda mitad, surgen movimientos como la antropología crítica de inspiración dialéctica, que se caracterizan por interrogar y replantear radicalmente la relación del antropólogo, como científico social, con las comunidades en las que realizan sus investigaciones y por proponer el compromiso del científico social con las causas de las comunidades en las que realiza su trabajo de investigación. Pero hay, aún, otro caso digno de un comentario en este sentido: es el trabajo de investigación y la producción escrita del antropólogo Carlos Castaneda. El lector que se acerca a sus textos sobre las prácticas de los chamanes puede constatar que Castaneda no intenta reducirlas a la cosmovisión occidental, sino que se destituye de sus conocimientos científicos, le confiere el lugar del saber al chamán y desde esa posición de “aprendiz de chamán” hace una producción que, por la posición del investigador, es radicalmente diferente a la tradición de las producciones de los científicos sociales. 13 Freire, Paulo: Educación Liberadora. K. p, 41. Bilbao: Editorial Zero. 1969. 14 Cf. Freire, Paulo: La Educación como práctica de la libertad. Barcelona: Ed. Siglo XXI, 1998.
  • 15 Podemos decir que en el campo de las prácticas clínicas el psicoanálisis fue el primero que interrogó de una manera radical el vínculo del agente de salud mental y el paciente; en virtud de esto desplazó el saber del terapeuta al paciente y, en consecuencia, el papel activo en el trabajo terapéutico. El grupo operativo de Pichón, la Educación liberadora de Paulo Freire y la Investigación Antropológica de Castaneda, coinciden en ese desplazamiento del lugar del saber y del papel activo, del lugar del profesional a las comunidades, los educandos o los grupos en los que se investiga o interviene. En otros campos como la sociología y los grupos que trabajan e investigan en la perspectiva de género, también existen desarrollos teóricos y metodológicos que, desde sus propias construcciones, apuntan en esta misma dirección. Pero hay un elemento que diferencia al psicoanálisis y al grupo operativo de las demás prácticas que hemos mencionado y es la concepción del ser humano en la que se fundamenta cada práctica. El dispositivo analítico y el grupo operativo cuentan con la existencia de lo inconsciente. En sendos dispositivos, el sujeto y el grupo, respectivamente, no son concebidos como realidades unitarias, consistentes y capaces de autoconocerse y “autoayudarse”, sino que son realidades divididas, contradictorias y conflictivas, en las que existe una dimensión a la que solamente es posible acceder por medio de un tercero, formado para ello. Este presupuesto tiene consecuencias metodológicas y prácticas, especialmente en lo que se refiere a la función del analista en la terapia analítica y del coordinador en el grupo operativo. Es necesario precisar lo que hemos dicho anteriormente, para que esto último se entienda. Cuando decimos que en el trabajo analítico el saber y la función activa se desplazan al lugar del paciente, no nos estamos refiriendo a éste en el sentido de su “yo” y su voluntad consciente, sino al sujeto del inconsciente que emerge en sus síntomas, sus yerros y sus sueños. Lo que tiene de subversivo el dispositivo analítico es que crea un escenario en el que no solamente se silencia el analista, sino también el yo del paciente y sus funciones psíquicas superiores, para que pueda emerger la verdad del sujeto del inconsciente. Esto es fundamental para entender que el mismo “yo” sufriente, que llega a pedir ayuda, se puede convertir luego en un obstáculo fundamental para el desarrollo del tratamiento. El analista debe estar en condiciones de observar las distintas resistencias de las que se vale el yo del analizante para obstaculizar el trabajo terapéutico. El desarrollo de la investigación psicoanalítica le mostró a Freud que estas mismas resistencias, que aparecen como obstáculo a la curación, son las que garantizan el mantenimiento del síntoma, de manera que el vencimiento de las resistencias en el trabajo terapéutico es fundamental porque es, a la vez, la liquidación de la fortaleza en la que se atrinchera la enfermedad. Así, de acuerdo con Freud, el vencimiento de las resistencias a la cura y la eliminación del síntoma, son una y la misma operación. De una manera análoga la psicología social de Enrique Pichón Rivière, no concibe al grupo como una realidad unitaria y transparente para sí misma, sino como una realidad compleja, contradictoria y conflictiva, que exige un marco conceptual para poder observarla y una técnica particular para intervenir sobre ella. Pichón concibe
  • 16 el grupo –todo grupo- como una realidad viva en permanente transformación, en la que, simultáneamente, están operando siempre fuerzas opuestas: las que se orientan en la vía de la salud mental, hacia el logro de las tareas y el proceso de transformación permanente del grupo; y, aquellas que, por el contrario, boicotean el quehacer grupal y tienden a impedir su evolución. Uno de los signos inequívocos de que en un grupo hay un fenómeno sintomático es la estereotipia que se puede manifestar, por ejemplo, en la ritualización vacía e improductiva de la dinámica grupal o en los roles rígidos de uno o varios de sus integrantes. La resistencia al cambio en los grupos opera de una manera análoga, a la resistencia del analizante; por esta razón una de las tareas fundamentales del coordinador es ayudarle al grupo a observar, analizar y elaborar la resistencia al cambio y, con ella, las estereotipias. Dicho de otra manera, una dimensión fundamental de la intervención terapéutica del coordinador es ayudarle al grupo a vencer los obstáculos que se oponen a la realización de la tarea. Estos obstáculos suelen manifestarse bajo la forma de la resistencia al cambio. La tarea en todos los grupos tiene dos dimensiones, que el autor llama tarea manifiesta y tarea latente. La tarea manifiesta es la más fácil de definir, porque coincide con los propósitos expresos del grupo; la dimensión latente de la tarea no es algo que se pueda definir de manera universal, sino que en cada caso es menester interpretarla y está relacionada con el proceso de transformación subjetiva de los integrantes del grupo en el proceso grupal, con la transformación de sus esquemas referenciales, la construcción de una mutua representación interna de los integrantes y la construcción de un esquema referencial colectivo. En esta dimensión latente de la tarea, presente en todo grupo, se activan los procesos afectivos y se ponen en juego los goces y los síntomas individuales de los integrantes; es el campo de las rivalidades imaginarias, de los juegos de seducción, de los odios secretos y también de las pasiones inconfesables; y, en general, de todos aquellos procesos que hacen parte del vínculo entre los seres humanos, pero que por razones de la definición misma de la tarea manifiesta, quedan por fuera del propósito expreso del grupo. Las relaciones entre la dimensión manifiesta y la dimensión latente de la tarea son complejas y cambiantes. En algunos casos coinciden y en otros pueden llegar a oponerse. Es importante aclarar que el propósito de la técnica del grupo operativo no es eliminar la tarea latente, ni combatirla o subordinarla a la tarea manifiesta, sino contribuir a su observación y análisis permanente para contribuir a que el quehacer grupal sea más productivo y saludable y que los integrantes del grupo aprendan a reconocerla y a hacerse cargo de ella sin que derive en formas sintomáticas. La diferencia entre un grupo operativo y otros grupos centrados en la tarea, que no se fundamentan en el psicoanálisis, no es que el dispositivo pichoniano tiene tarea latente y los demás no la tienen, sino que en éste se cuenta con un instrumento para su observación y análisis.
  • 17 Es importante no confundir la tarea latente en los grupos con lo que algunos autores llaman la “agenda oculta”, ya que esta última por su definición misma, es conocida en el grupo, al menos por parte de algunos integrantes, que la ocultan deliberadamente a otros. La tarea latente, en el sentido más fuerte de la definición, puede ser desconocida por todo el grupo; y, desde esa condición, sin embargo, puede operar como una voluntad secreta y firme que lleva al grupo en una dirección determinada, -que puede ser ajena a la definición de la tarea manifiesta, incluso contraria-, sin que nadie comprenda la razón. La dimensión latente de la vida grupal puede manifestarse como un síntoma, por ejemplo una ansiedad que se manifiesta de una manera más o menos pareja en los integrantes del grupo, pero lo más frecuente es que emerja a través de alguno de los integrantes que, por su lugar en el grupo o por sus características personales está conectado de una manera más directa con esta dimensión de la vida grupal. Al integrante del grupo que cumple esta función Pichón lo llama “el portavoz” y al contenido de lo que denuncia se le denomina “lo emergente”. El portavoz logra ponerle palabras a lo que otros también han percibido. Lo emergente puede tomar formas diversas, incluso opuestas entre sí. Puede ocurrir, también, que los integrantes de un grupo no reconocen lo emergente como propio y se lo endilgan a un chivo emisario que se hace cargo de la patología grupal. En los grupos numerosos y en las instituciones las funciones de portavoz y chivo emisario, pueden ser agenciadas por un individuo o un sector del grupo, integrado por varias personas. Desde su nacimiento mismo, en el Hospicio de las Mercedes, el grupo operativo se le reveló a Pichón Rivière, no solamente como un dispositivo de intervención, sino también como un método de investigación del vínculo sujeto-grupo, que es el objeto mismo de la psicología social. Los rendimientos teóricos que el autor cosechó de la investigación psicosocial en los grupos operativos, lo sistematizó en lo que llamó su ECRO: esquema conceptual referencial y operativo. Una parte fundamental del ECRO de Pichón Rivière es la teoría del vínculo social que publica en un texto que se titula precisamente Teoría del Vínculo. No vamos a pretender hacer una síntesis de la misma, ya que amerita, cuando menos un capítulo de esta misma extensión; pero si mencionaremos uno de los hallazgos fundamentales que arrojó la investigación de Pichón con la metodología de grupos operativos. Este descubrimiento podemos definirlo como la potencia patológica y terapéutica, a la vez, de los grupos humanos. En efecto, los primeros grupos con las familias de los psicóticos en el Hospicio, según el autor, “completaron nuestra concepción social de la enfermedad mental”15 . Es decir el poder que tiene una familia o un grupo social de enfermar a uno o a alguno de sus integrantes. Esta concepción social de la enfermedad mental permite, no solamente entender de qué manera influye el grupo familiar y 15 Pichón, Enrique: “Historia de los grupos operativos”. En: El Proceso Grupal, del psicoanálisis a la psicología social (1). p, 241. Buenos Aires: Editorial Nueva Visión, 1985.
  • 18 social en la etiología de una psicosis o una neurosis en un individuo, sino que, por contrapartida, permite arrojar luz sobre los fenómenos sociales, abordando al enfermo mental como portavoz de un síntoma colectivo. Pero el hallazgo fundamental de la investigación Pichoniana es el poder terapéutico de los grupos: “la profilaxis podía ser dada en otros miembros de la familia”16 y, no solamente en aquellos casos en los que se definen como grupos terapéuticos, sino también aquellos en los que la tarea se define en función de una obra comunitaria, un proyecto empresarial, o la resolución de un problema en una institución educativa. La condición para activar esta potencia terapéutica es disponer de un marco teórico –el ECRO- que permita leer la vida latente de los grupos y que el grupo cuente con un coordinador que conozca la técnica adecuada para intervenir sobre ella. El dispositivo del grupo operativo crea unas condiciones favorables para aprovechar la potencia terapéutica de los grupos. No se trata entonces de una psicoterapia en grupo entendida en el sentido convencional, es decir, de un terapeuta que interviene grupalmente; en el grupo operativo es el grupo en tarea el que produce los efectos terapéuticos, no el terapeuta, que opera como copensor y facilitador. Como el lector habrá podido apreciar, los grupos operativos son una herramienta para leer fenómenos e intervenir en grupos de múltiples clases, en diversos escenarios; esta herramienta se puede combinar con otras técnicas que provienen de contextos teóricos y metodológicos afines, sin que sea menester la aplicación del dispositivo del grupo operativo en su versión más pura. Leonardo Schvarstein, un discípulo de Pichón, que es actualmente uno de los autores más reconocidos en América Latina en el campo de la psicología organizacional, reconoce que en su práctica nunca usa el grupo operativo en su forma pura, pero que en todas sus intervenciones está trabajando con la didáctica de emergentes y otras herramientas de la técnica de los grupos operativos y que en general se vale del ECRO de Pichón para leer los fenómenos latentes de la actividad grupal. Este comentario pretende adelantarse a la inquietud que, con toda razón, se hacen muchos sobre las posibilidades prácticas de exportar el modelo del grupo operativo, en su versión más genuina, a todos los escenarios de intervención del psicólogo social. Donde tiene toda su pertinencia la aplicación de la versión más pura del grupo operativo es en la formación de los futuros psicólogos sociales. En este punto encontramos nuevamente una coincidencia con el psicoanálisis. Un analista se forma fundamentalmente en el diván de otro analista, es decir en su propio análisis. Los cursos, carteles y otros dispositivos de estudio, son un factor muy importante en su formación, pero no sustituyen la travesía que constituye el análisis personal, sin el cual no hay analista posible. De una manera análoga, la formación de un coordinador en grupos operativos, requiere un conocimiento teórico de la psicología social de Pichón Rivière, y exige como condición indispensable la experiencia y la vivencia como participante de grupos operativos 16 Ibíd.
  • 19 de formación, sin los cuales no es posible, o en todo caso, no es legítimo, autorizarse como coordinador. Como el lector habrá podido notar el grupo operativo es una técnica que descansa en una concepción particular de la enfermedad mental como síntoma social y de los grupos como tramas vinculares en los que el saber y el poder se pueden poner en función de lo patológico o lo terapéutico. Se trata de una técnica que cuenta con la existencia de una dimensión latente de la vida grupal regida por formas individuales y colectivas del goce que es necesario develar y darles una forma de expresión para evitar el empobrecimiento de la vida grupal o la emergencia de síntomas que tienen un alto costo psíquico para los integrantes del grupo y que pueden boicotear los propósitos grupales. Es por este motivo que hemos considerado pertinente examinar el grupo operativo a la luz del dispositivo teórico llamado “los cuatro discursos” de Lacan, que gira en torno a cuatro significantes: El significante amo (S1), que es el emblema de las diversas formas del poder; el saber (S2), que tiene distintas facetas; el síntoma ($), en distintas posiciones; y el goce (a) que también tiene valores diferentes según sea un producto, una verdad reprimida, un lugar vacío, o la causa del deseo. En virtud de este objetivo el próximo capítulo intentará introducir al lector en la teoría del vínculo social de Jacques Lacan y los siguientes capítulos abordarán, a la luz de esta teoría, tres ejes fundamentales del grupo operativo: “la tarea”, “el coordinador” y “el grupo”.
  • 20 22.. TTEEOORRÍÍAA DDEELL VVÍÍNNCCUULLOO SSOOCCIIAALL DDEE JJAACCQQUUEESS LLAACCAANN Por: Jaime Carmona El discurso es la unidad mínima de análisis que Lacan propone para pensar los vínculos sociales. Es una estructura básica de la que se pueden encontrar múltiples variaciones. Lacan define el discurso como: “Una estructura necesaria que excede con mucho a la palabra (...) que en realidad puede subsistir muy bien sin palabras. Subsiste en ciertas relaciones fundamentales. Mediante el instrumento del lenguaje se instaura un cierto número de relaciones estables en las que puede ciertamente inscribirse algo mucho más amplio, algo que va mucho más lejos que las comunicaciones efectivas. Estas no son necesarias para que nuestra conducta o eventualmente nuestros actos se inscriban en ciertos enunciados primordiales”.17 Un vínculo social, en principio, implica la existencia de al menos dos términos, pero el que existan dos términos no garantiza que exista un vínculo entre ellos. Es necesario que uno de ellos interpele al otro, que uno de ellos se dirija al otro e incida sobre él, de alguna manera. Este hecho ya define una posición de cada uno de los dos términos que entran en relación. Uno de ellos, el que toma la iniciativa, vamos a decirlo así, está en posición de “agente”, en la medida en que ha asumido un papel que puede considerarse como “dominante”, al menos en el sentido de incidir sobre el otro18 . El otro término... ¿qué podemos decir del otro? Por ahora digamos sólo eso, que es un “otro”. Según Lacan, habría cuatro modalidades posibles de colocarse en el lugar del agente. Es decir, cuatro formas de interpelar a un “otro” en el campo social, las cuales tendrían que ver con las tres tareas imposibles de las que habla Freud: gobernar (S1), educar (S2), analizar (“a”) y con una tarea, acaso no menos imposible, que Lacan define como “hacer desear” ($) y que también podríamos leer como: “hacer producir saber”19 . Más adelante nos referiremos en detalle a cada una de ellas. Resumamos: Un vínculo implica, al menos, dos términos: uno de ellos, el “agente”, está en una posición “dominante” respecto del “otro”; y, habría cuatro versiones del agente. Quizá podríamos agregar que, en un sentido estricto, todo vínculo 17 Lacan, Jacques. El Seminario, Libro XVII. El reverso del psicoanálisis. Barcelona: Paidós, 1992. p. 10. 18 Llamo dominante a lo que me sirve para nombrar estos discursos (...). Esta palabra dominante no implica predominio, en el sentido de que este predominio especifique lo que no es seguro al discurso del amo. Digamos que se puede atribuir, por ejemplo, según los discursos, substancias distintas a esta dominante”. Ibíd., p. 45. 19 “Gobernar, educar, analizar también y, por qué no, hacer desear, para completar la definición de lo que será el discurso de la histérica, son operaciones, propiamente hablando, imposibles”. Ibíd., p. 187.
  • 21 social está determinado por una imposibilidad estructural, en el sentido que se dice que es imposible gobernar, analizar, educar y hacer desear. Agente → otro Pero un vínculo no se agota en la constatación que acabamos de mencionar. En otras palabras, un vínculo no es igual a la sumatoria de sus componentes. Una vez que dos términos entran en relación en un vínculo, se produce un algo más, una resultante de ese encuentro de los dos términos que entraron en relación. A esa resultante le vamos a dar el nombre de “producción”. Esa producción es el efecto de la incidencia del “agente” sobre el “otro”. Así pues, la colocaremos del lado del “otro”. Tenemos, entonces, tres términos: Agente → ____otro________ Producción Ahora bien, si del lado del “otro” tenemos una “producción” -efecto de la incidencia del “agente” sobre él-, podemos preguntarnos qué hay del lado del “agente”. En otras palabras, podemos preguntar qué lleva a un “agente” cualquiera en el escenario social a interpelar a un “otro”. Esto es algo que en toda relación requiere ser aclarado: ¿Por qué alguien se dirige a otro y lo increpa o lo interpela? La respuesta a esta pregunta generalmente no tiene nada de evidente, ni siquiera para el agente mismo. En los vínculos sociales este hecho fundante suele ser lo más opaco y no gratuitamente suele estar justificado con toda clase de racionalizaciones que en general operan como coartadas. El político, al ser interrogado por las razones que lo llevan a increpar al “otro”, responderá que quiere su bienestar; el religioso dirá que quiere su salvación; el revolucionario dirá que quiere su liberación; el capitalista dirá que quiere satisfacer sus necesidades, prestarle el mejor servicio, hacerlo feliz (...). Cuando un “agente” interpela a un “otro”, debemos hacernos la pregunta por aquello que suscita este gesto y desconfiar de las respuestas que aporta este mismo agente sobre su “intencionalidad”. Es decir, que ante todo vínculo siempre debemos suponer la existencia de una “verdad” que no necesariamente coincide con las razones a las que apela el agente para interpelar al otro. Dicha verdad está del lado del agente y la mayoría de las veces es una verdad oculta hasta para él mismo, que puede estar convencido de sus buenas intenciones, de lo necesario que es para el “otro”, o de su condición de instrumento de una elevada causa. Esta verdad la escribimos debajo del agente, separada del mismo por una barra que nos sugiere que no es algo a lo cual el agente tenga un acceso directo, así como la producción, a pesar de que está del lado del otro, no es necesariamente algo que el otro se pueda apropiar, ni siquiera algo de lo que pueda dar cuenta por más que haya resultado de la incidencia de un agente sobre él.
  • 22 Así tenemos, entonces, que el vínculo mínimo, una relación entre dos términos en el campo de lo social, siempre implica otros dos, lo cual nos arroja una estructura de cuatro términos: Es importante señalar que, en los vínculos sociales, lo más difícil de develar siempre es la relación entre la verdad y la producción. “En la segunda línea no hay flecha alguna (...), no sólo no hay comunicación sino que hay algo que obtura (∆)”20 . Esa es la razón de existir de las ciencias sociales. Si la verdad de toda producción en el campo de lo social fuese evidente por sí misma, las ciencias sociales no serían necesarias. Lacan dice que la relación entre la verdad y la producción está marcada por la impotencia (que indicamos con el triángulo) mientras que la relación entre el agente y el otro por la imposibilidad que ya mencionamos (y que indicamos con la flecha). La relación entre la verdad y la producción siempre exige un proceso de construcción o mejor de reconstrucción. En el sentido que tiene este término en la arqueología y en el psicoanálisis, es esencial edificar una armazón significante, una construcción conceptual, para demostrar la relación estructural existente entre ambas: “Si planteamos la formalización del discurso y, en el interior de esta formalización, nos damos ciertas reglas destinadas a ponerla a prueba, encontramos un elemento de imposibilidad. Esto se halla en la base, en la raíz de lo que es un hecho de estructura”21 . Ya tenemos la matriz básica mínima de todo vínculo en el campo social: se requiere al menos de dos términos para que haya un vínculo; y, necesariamente, la relación entre ambos da lugar a un producto nuevo y, por otro lado, produce una zona de sombra que llama a ser iluminada: la verdad. Ahora, es importante que nos preguntemos por la naturaleza de lo que hemos llamado “los términos” que entran en relación en un vínculo social. Vamos a decirlo con una redundancia: ¿qué se vincula con qué en un vínculo social? Para poder abordar el tema de la naturaleza de lo que hemos llamado hasta el momento “los términos” que entran en relación en el vínculo social, es conveniente hacer una reflexión sobre la condición humana. Los seres humanos vivimos en un universo de símbolos, en un mundo de representaciones. El psicoanálisis comparte con Heidegger la idea según la cual “El lenguaje es la casa del ser”22 . Este hecho tiene una implicación decisiva para la relación del ser humano con el mundo y, por supuesto, con los demás seres humanos, a saber, que toda relación humana va a estar mediada por representaciones. Un ser humano no se relaciona 20 Ibíd.., p. 188. 21 Ibíd.., p. 48. 22 Heidegger, Martín. Carta sobre el humanismo. Madrid: Ed. Alianza. 2003. p, 7. Agente otro Verdad ∆ Producto
  • 23 directamente con otro ser humano ni con el mundo; sus relaciones con sus semejantes y su contexto acontecen mediatizadas por el sistema de representaciones que habita. Incluso podemos ser más radicales y decir que el ser humano, en tanto que sujeto, no “es”, sino en la medida en que es representado. En el mundo de los humanos no hay otra posibilidad de “ser”, ni otra posibilidad de vincularse con los otros que no pase por un sistema de representaciones. Esto se puede constatar de la manera más simple en un hecho tan cotidiano y elemental como presentarse ante otro. Se supone que quien se presenta trata de decir quien “es”. Lo primero que se dice en una presentación es el nombre. El nombre es una representación. Freud la llamaría representación de palabra, que representa a alguien para otro alguien. Casi todos los nombres llevan implícito el género, al menos en nuestra cultura. No es lo mismo llamarse Fulano que Fulana. Así, cuando alguien dice o escribe su nombre, casi siempre está diciendo simultáneamente su género. Si además incluye los apellidos, y dice “Fulano de Tal”, está aportando otras representaciones que sitúan al que se presenta en un linaje y como miembro de ese linaje en un conjunto social al que pertenece. Cada apellido sitúa a los sujetos que representa en un lugar muy diferente del escenario social. Ese hecho elemental de presentarse, utilizando una representación de palabra como es el nombre, ya nos pone sobre la pista de un hecho fundamental en lo que se refiere a las representaciones, que siempre remiten a otras representaciones, y más aún, cobran su valor por lo que las diferencia de las otras. Fulano cobra su valor de nombre masculino por lo que lo diferencia de los nombres femeninos. El apellido cobra su valor particular por lo que lo diferencia de los demás apellidos en su contexto social. En otras palabras, las representaciones, o mejor digamos los significantes, no existen aisladamente, sino que siempre se encuentran en redes o baterías, las cuales están en relaciones con otros significantes y con respecto a los cuales adquieren un valor por lo que los diferencia de los demás. Por ello, cuando alguien enuncia el significante mínimo que lo representa, como es el nombre propio, esto lo pone en relación con otros significantes y le asigna un lugar. Si continúa la presentación y se enuncia la profesión, sucede lo mismo. En primer lugar, la palabra profesional, expresa o tácita, ya marca una diferencia con la de estudiante y con la de analfabeta, etc. Lacan define al sujeto como “representado por un significante para otro significante”23 . Esto implica que el advenimiento del humano como sujeto pasa por su inclusión en un orden significante. Esta definición del sujeto la podemos escribir así: Un significante (S1)___ → otro significante (S2) S1 → S2 Sujeto representado ($) $ 23 Cf. Lacan, Jacques. El Seminario, Libro XVII. El revés del psicoanálisis. Op. cit., p. 11.
  • 24 Ahora, el significante no es solamente aquello que nos representa y sin lo cual no “somos” humanos, ni simplemente aquello que nos da un lugar en el mundo y una cierta ilusión de unidad necesaria para operar en él, si no que es, además, la materia de la cual está hecho el vínculo social. El orden social es un orden significante y sin el significante no hay ordenamiento social posible. La operación significante, gracias a la cual un trozo de carne, pelos y tejidos deviene un ser humano, tiene varias implicaciones de las cuales aquí solamente vamos a tratar de desarrollar dos. La primera de ellas es que el sujeto que allí se constituye es, desde su origen, un sujeto dividido entre la representación y lo representado S1/$; en otras palabras, entre el significante (S) y el significado (s): S/s. La segunda consecuencia que vamos a desarrollar consiste en que la constitución de la subjetividad humana en el orden significante no es una operación exacta, sino que deja un residuo que va a funcionar como un referente fundamental para el deseo del sujeto. Para abordar la primera de estas dos consecuencias de la condición lenguajera de los seres humanos, es necesario que nos remitamos brevemente a la lingüística. Recordemos que la noción de significante es acuñada por Ferdinand de Saussure en el Curso de Lingüística General. En este texto, establecido póstumamente por sus discípulos, el autor propone que el signo lingüístico se puede descomponer en dos dimensiones que serían como las dos caras de una moneda: el significante y el significado. El significado sería el contenido ideativo y el significante sería la dimensión material, la imagen acústica; en una palabra, el sonido. Es notoria la coincidencia entre la noción de significante en Saussure y la noción de “representación de palabra” en Freud. Para elaborar su formulación sobre el sujeto, Lacan invierte el algoritmo de Saussure y propone que la barra que separa al significante del significado es la barra de la represión. Si nos atenemos a esta formulación debemos decir entonces que el sujeto que se funda como representado por un significante para otro significante es, por definición, un sujeto del inconsciente, en la medida en que queda debajo de la barra de la represión. Ya sabemos, desde Freud, que todo lo reprimido, por definición, es inconsciente (aunque no todo lo inconsciente sea reprimido). La constitución del hablante como sujeto del inconsciente es producto de una particularidad del lenguaje en el que viene a constituirse el neonato como sujeto, teniendo en cuenta que este lenguaje no existe en el mundo como una batería de significantes neutros, sino que siempre se lo encuentra atravesado por unas leyes (como la ley de prohibición del incesto y, en general, la moral sexual de la cultura) y organizado bajo la forma de un saber, verbigracia el saber mínimo acerca de las estructuras de parentesco de la respectiva cultura, que hasta los analfabetas conocen. Es decir, que el lenguaje en el que viene a fundarse cada nuevo ser está estructurado como un cuerpo vivo de saber, como una estructura significante organizada que posee una historia, una cultura, unas tradiciones, unas técnicas y unas artes, incluso unas tramas que van a determinar los caminos por los que
  • 25 discurrirá el destino de cada uno de los seres que allí devienen sujetos. Esas leyes que mencionamos operan a nivel inconsciente y producen el efecto, ya referido, de dividir la subjetividad en dos escenarios. Esto se puede mostrar de una manera simple. Ser representado para otros por el significante Fulano en un complejo cultural determinado, implica ser inscrito en un ordenamiento de la sexualidad propio de los Fulanos, que es diferente al de las Fulanas. Y si el proceso de enculturación cumple cabalmente su cometido, logrará que Fulano se comporte como los Fulanos y no como las Fulanas. Así mismo, si es “Fulano de Tal”, implica que pertenece al linaje de los “Tales” y se espera que busque su pareja por fuera del clan familiar. De manera que ser incluido en el lenguaje como “Fulano de Tal”, supone, en primer lugar, reprimir los deseos que serían propios de las Fulanas y, en segundo lugar, reprimir los deseos hacia los “Tales”. Fulano de Tal sería un sujeto en el sentido que tiene el término en la gramática, incluso en el sentido que tiene este término para el Derecho, pero para el psicoanálisis el sujeto sería aquello que es objeto de la represión para que Fulano de Tal pueda cumplir socialmente con lo que se espera de un Fulano y de un “de Tal”. Se trata entonces de una dimensión fundamental de su ser que todo Fulano ignora, es decir, el sujeto del inconsciente. Esto podemos escribirlo de la siguiente manera: Significante del nombre propio S1 Sujeto del inconsciente $ Ese sujeto del inconsciente seguirá operando como una verdad no sabida que, sin embargo, determina el destino de Fulano. Esto nos conduce a una paradoja: el significante que representa a un sujeto para sí mismo y para los demás significantes puede decir lo opuesto a su deseo inconsciente. Lacan dice, por ello, que “el yo es un lugar de desconocimiento”. Se refiere, por supuesto, al desconocimiento de la verdad del sujeto del inconsciente.24 Como se puede ver, llamarse Fulano o Fulana tiene sus consecuencias. El nombre propio opera como un primer significante que asigna un lugar a un sujeto en el mundo y, a la vez, lo somete a la ley de la cultura en la que lo inscribe; es un significante amo que contribuye a ese proceso de unificación imaginaria y localización en un universo simbólico, que convierte en un ser humano a un organismo habitado por un conjunto de pulsiones que en su origen operan más o menos anárquicamente. Es un significante que, mediante una operación de violencia simbólica, introduce un principio de organización que desemboca en la humanización. 24 A propósito del yo y su relación con el saber, dice Lacan: “El yo trascendental es el S1, el yo del amo, aquel que de algún modo encierra en sí como verdad cualquiera que enuncia un saber”. Lacan, El Seminario, Libro 17. El reverso del psicoanálisis, Op. cit., p. 66.
  • 26 La asunción de una identidad unitaria mediante un significante amo como el nombre propio y la identificación con algunos de los emblemas fundamentales, propios de ese significante en el complejo cultural respectivo, es un paso necesario del proceso de enculturación de todo sujeto, lo cual tiene el correlato que ya mencionamos: la constitución de una subjetividad en dos escenarios, uno que corresponde con ese significante que es el nombre propio y otro escenario que sería el sujeto del inconsciente. El sujeto del inconsciente ($) es, pues, un efecto de la inclusión del humano en el lenguaje, y tenemos noticia de él a partir de unas formaciones como el síntoma, el lapsus y el sueño, es decir, a partir de producciones que son marginales respecto del yo, que es el que se instala en la dimensión subjetiva correspondiente al nombre y a los apellidos. El yo es el que puede decir “yo me llamo Fulano”, no así el sujeto del inconsciente. El sujeto del inconsciente, al contrario, se manifestaría en aquellos lapsus que contradicen lo que cualquier Fulano quiso decir, o en una conducta como la ferocidad sintomática de algunos Fulanos contra los homosexuales, con la cual intentan desmentir su propia homosexualidad inconsciente, o en los sueños que derivan en pesadillas en el momento en que se acercan a la realización de una fantasía incestuosa. Decíamos que la operación mediante la cual un significante representa a un sujeto para otro significante, tenía otra consecuencia, además de fundar este sujeto como un sujeto dividido y como un sujeto del inconsciente. Esta otra consecuencia, que se refiere al residuo de la operación, tiene que ver con lo que diferencia un atardecer de un poema sobre el atardecer. En otras palabras, con lo que diferencia la palabra de la cosa. En todo poema sobre el atardecer se captura algo del atardecer y algo se escapa. Ningún poema sobre el atardecer podrá capturar totalmente el atardecer. Es así como siempre se podrán seguir escribiendo nuevos poemas sobre el atardecer. Algo semejante ocurre con la operación por la cual un significante, como el nombre propio, captura a un viviente y le da un lugar en el mundo. Efectivamente, la inclusión del sujeto en un orden simbólico mediante el nombre, captura parcialmente a ese viviente, pero esta captura no se logra de una manera plena, algo queda por fuera. En este caso no se trata de lo reprimido, porque lo reprimido, en la medida en que tiene una materialidad significante, de alguna manera está incluido en la operación, así sea en otro escenario; y es por ello que, gracias a un dispositivo como el analítico, se puede lograr que eso reprimido se enuncie. En este caso se trata de una exclusión más radical, la cual tiene que ver con algo que es indecible, en la medida en que quedó por fuera en la operación de simbolización. Es aquello del viviente que no es susceptible de ser atrapado por el lenguaje. A esa dimensión Lacan la llama “objeto a” o simplemente “a”, minúscula. Esta dimensión del viviente, que no ingresa en el mundo significante en el que habitamos los humanos, tiene múltiples versiones. Todas, en alguna medida,
  • 27 aluden a ella, pero ninguna logra nombrarla, ni siquiera de una manera aproximada, por su misma condición insimbolizable. Cada versión del “objeto a” es una suerte de nuevo poema sobre el atardecer de lo real de la condición humana que, a la vez que logra bordearlo con la palabra, hace más inminente el hecho inexorable de la imposibilidad para llegar a atraparlo en las redes del lenguaje. Vamos a ver algunas de estas versiones del “objeto a”. Uno de los nombres que Lacan le da al “objeto a” es el de resto: el residuo de la operación de constitución del sujeto. Se trata de un desecho, un desecho precioso, ya que de una u otra manera el sujeto sigue añorando siempre eso que queda por fuera de la dimensión significante en la que habita. La relación del niño con sus heces puede ser un referente de un desecho preciado. Las heces son un paradigma de aquello que nuestra cultura excluye de su orden, por ello se inventaron los excusados. Las heces son una de las expresiones paradigmáticas del “objeto a”. Desde otro punto de vista, al “objeto a” lo podemos pensar como un excedente, el rédito de la operación de la humanización. El excedente es un plus, aquello que se puede usufructuar como ganancia una vez concluida una operación comercial; incluso se puede asimilar a la plusvalía, que es ese excedente que el capitalista le escamotea al proletario gracias al fetichismo de la mercancía, producto de la división del trabajo que introduce el capitalismo. En esta perspectiva podríamos pensar ese excedente o plus como un producto. Otro nombre que Lacan le da a esa dimensión excluida, que constituye el objeto “a”, es el de “falta”. Esta falta se puede pensar como la cicatriz que deja aquello que se pierde en el ingreso al universo simbólico. También se puede entender como la pérdida de goce, producto de la inserción de la criatura humana en el lenguaje y, paradójicamente, eso que queda por fuera de la operación también se puede llamar goce25 , cuando de alguna manera logra ser capturado, así sea en medida escasa. Nuevamente la plusvalía sirve de referente. Según Lacan, la plusvalía nace en aquel momento de la historia en el que el capitalismo descubre un dispositivo que permite capturar el goce y acumularlo26 . Es por esta referencia a la plusvalía que Lacan también llama “plus de goce” a esa dimensión excedente de la operación simbólica mediante la cual se funda el sujeto. Esta dimensión, excluida del orden significante, opera como aquello que causa el deseo y que le sirve de horizonte hacia el cual apunta. Se trata de un caso muy interesante de una causalidad negativa, en la medida en que aquello que opera como causa es precisamente una ausencia. Este es otro nombre del objeto “a”, “objeto causa del deseo”. Se trata de un objeto muy particular, ya lo dijimos, un 25 “Debajo del otro (significante del saber en el discurso del amo) está el sitio donde se produce la pérdida, la pérdida de goce de la que extraemos el plus de goce”. Lacan, Jacques. El Seminario, Libro XVII. El reverso del psicoanálisis, Op. cit., p. 98. 26 “A partir de cierto día el plus de goce se cuenta, se contabiliza, se totaliza. Aquí empieza lo que se llama la acumulación de capital”. Lacan, Jacques. El Seminario, Libro XVII. El reverso del psicoanálisis, Op. cit., p. 191.
  • 28 objeto que falta, lo cual se puede enunciar de un modo más directo como una “falta de objeto”. El concepto de “objeto a” es una construcción muy compleja y difícil de asir por la naturaleza misma de la dimensión de lo humano a la que se refiere. Ya que se trata de una noción fundamental, para este trabajo de investigación haremos un recuento histórico de este término que tratará de justificar la diversidad de acepciones que posee, de acuerdo con el costado que se trate de iluminar de la dimensión de lo humano que nombra. La prehistoria de esta noción se remite, por supuesto, a la obra de Freud. La noción de “objeto perdido” -que en Freud no es desarrollada como un concepto fuerte-, de alguna manera prefigura este hecho constitutivo: que se ingresa al mundo de los humanos por la vía de una pérdida fundamental. Los goces pulsionales parciales también prefiguran en la obra de Freud, lo que va a ser la noción de “objeto a” en Lacan, por varios motivos: en primer lugar, por su condición, digámoslo así, silvestre, y por su carácter compulsivo e impersonal que no tiene reparos por la autoconservación, ni por la conservación del otro; en segundo lugar, porque son legítimos representantes del goce que se pierde en el proceso de inserción en la cultura. A continuación presentaremos, en una síntesis muy condensada, el recorrido que hace Dylan Evans, en el “Diccionario introductorio de psicoanálisis lacaniano”, sobre la evolución de la noción de “objeto a” en la obra de Lacan, lo cual nos permite entenderla en su historicidad y, a la vez, corroborar la exactitud de las diversas definiciones que hemos aportado de la misma. “La a minúscula aparece por primera vez en el texto de Lacan, en 1955, en relación con el esquema L. En este momento se usa para designar al semejante, la imagen especular en el orden imaginario. Es en 1957 cuando Lacan introduce el matema del fantasma ($ <> a), “a comienza a ser concebido como el objeto del deseo (...). En 1960-1 Lacan articula la a con el término agalma que toma del banquete de Platón (...). El agalma es un objeto precioso oculto en una caja relativamente carente de valor” 27 . El objeto a, ya lo vimos, es algo precioso que puede estar revestido de la condición de algo desechable. “Desde 1963, en adelante, a adquiere cada vez más las connotaciones de lo real (...); a partir de este momento, a designa el objeto que nunca puede alcanzarse, que es realmente la CAUSA del deseo (...). En los seminarios de 1962, 63 y 64, el objeto a es definido como el resto (en francés reste), el remanente que deja detrás de él la introducción de lo simbólico en lo real (...); esta idea recibe un desarrollo adicional en el seminario de los cuatro discursos. En el discurso del amo, un significante trata de representar al sujeto para todos los otros significantes, pero siempre se produce inevitablemente un excedente. Ese excedente es el objeto a, un sentido excedente, un goce excedente (en francés, plus-de jouir, “plus de gozar”). Este concepto se inspira en la idea marxista de la plusvalía. a es el exceso de goce que no tiene valor de uso, pero resiste a la pura justificación del goce” 28 . 27 Evans, Dylan. Diccionario introductorio de psicoanálisis lacaniano. Buenos Aires: Paidós, p. 141 (las comillas y las cursivas son del autor). 28 Ibíd. p. 141 (las cursivas, las mayúsculas y las comillas son del autor).
  • 29 Vemos pues que este concepto, de acuerdo al costado que tratemos de iluminar, puede ser leído como: “residuo”, “resto”, “plus”, “plus de goce”, pero también “falta de goce”, “objeto causa del deseo” o “falta de objeto”. Se trata de una dimensión de la condición humana que, como dijimos, es más radical aún que el mismo inconsciente. Ésta, a diferencia del inconsciente, no es una dimensión palabrera, ya lo dijimos, aunque algo de ella logra ser capturada por la palabra y allí donde ello ocurre se le encuentra más frecuentemente asociada con las formaciones del inconsciente que con la otra dimensión de la subjetividad, en la cual el yo identifica al significante amo que constituye el nombre propio: “El yo idéntico a sí mismo, eso es precisamente lo que constituye el S1 del imperativo puro”29 . El goce opera como un principio desorganizador, por oposición al efecto de ordenamiento que implica la fundación del sujeto en el universo significante. Se manifiesta en aquellos procesos mortíferos de disolución de las unidades alcanzadas y de los principios de organización que mantienen la vida. En ese orden de ideas, opera en el mismo sentido que la pulsión de muerte. El goce, por definición, es mortífero y se hace más palpable en aquellos cuadros clínicos en los cuales asistimos a un proceso autodestructivo en el que las posibilidades de simbolización son especialmente limitadas, como las toxicomanías, los cuadros psicosomáticos y algunas formas de la anorexia y la bulimia. Las manifestaciones del goce en el campo de lo social se pueden encontrar en las guerras, los procesos de destrucción del tejido social, la devastación de los recursos que garantiza la vida en el planeta, etc. La referencia a lo social no es, en absoluto, forzada si tenemos en cuenta que la antropología muestra que el medio más eficaz de destrucción de un sujeto es eliminar todo lazo que lo ate a los otros, dejarlo sin lugar en el universo simbólico de su comunidad. Más aún, esta concepción lacaniana del sujeto como representado por un significante para otro significante, no admite una definición metafísica de sujeto, ni siquiera una definición con un estatuto irreductible al orden social, sino todo lo contrario, sólo admite pensar al sujeto en función de su relación con el otro, gracias al universo significante. En este sentido, la formulación lacaniana de los cuatro discursos sigue el espíritu de la posición de Freud en el texto Psicología de las masas, donde declara categóricamente que la oposición entre psicología individual y psicología social es una falsa oposición y agrega que “desde el comienzo mismo, la psicología individual es simultáneamente psicología social”30 . Con el abordaje de esta dimensión del goce completamos el cuarto de los términos que se requieren para pensar la especificidad de la condición humana de acuerdo con Lacan. agente → otro S1(Significante Amo) → S2 (El saber)__ verdad ∆ producto $(El sujeto dividido) ∆ “a” (el objeto a) 29 Lacan, Jacques. El Seminario, Libro XVII. El reverso del psicoanálisis, Op. cit., p. 66. 30[15] Cf. Freud, Sigmund. Obras completas. v. XVIII. Buenos Aires: Amorrortu, 1979. p. 67.
  • 30 Recapitulemos. “S1” es el significante amo: es el que violenta la materia orgánica e introduce un principio organizador que confiere la ilusión de unidad que es necesaria al ser humano para relacionarse con el mundo por medio del universo significante. El funcionamiento de este significante se puede pensar tomando como referente al amo de la antigüedad, y en cierto sentido, obrando en consecuencia; el yo, identificado con este significante, opera en la subjetividad con una vocación de soberano absoluto, aunque nunca lo logre plenamente. Así mismo, lo que nos muestra a diario la vida social no es otra cosa que la vocación de tirano que se revela en todo ser humano cuando el interjuego vincular le coloca en una posición de poder respecto a los otros. “S2” es el significante del saber: el otro significante al cual se remite el S1. Recordemos que los significantes (o las representaciones) no se encuentran en el mundo de manera aislada, sino que siempre están en relación con otros significantes. El “S2” es el significante que representa a la batería de los demás significantes sobre la cual incide el “S1”, que representa al sujeto. Recordemos también, que esa batería no es una caja de herramientas en la que los significantes están dispuestos, por decirlo así, en una condición neutra. Se trata más bien de una red significante en la cual los significantes están organizados conforme a leyes. Cada uno tiene un lugar que está definido por su relación con los demás significantes. Más aún, se trata, como ya lo dijimos, de un universo significante con una historia, una tradición, unas técnicas, unas artes y unos saberes que pueden estar articulados bajo la forma de mitos o ficciones científicas. “$” es el significante del sujeto dividido: recordemos que no lo debemos confundir con el yo. Se trata del sujeto del inconsciente que opera como verdad reprimida que constituye un determinismo fundamental en el destino de todo ser humano. El sujeto no aparece allí donde el yo gobierna como un soberano la vida psíquica, sino justamente donde no es el amo de su propia casa, donde aparece la anomalía, donde la cosa no marcha, en el yerro, en el tropiezo, en el síntoma mediante el cual se deja ver este otro escenario de la vida psíquica. “a” es el objeto causa del deseo: es aquello insimbolizable del viviente que queda por fuera del orden significante, en la operación mediante la cual se funda el sujeto. O, dicho más precisamente, es lo que no alcanza a ser capturado por ese orden simbólico. Este resto de real tendrá esa doble condición del desperdicio y de lo precioso, y allí donde se haga inminente su presencia será objeto de horror y fascinación. Así, la fórmula completa de la constitución de la subjetividad queda así: Un significante (S1) → ante otro significante (S2) S1→ S2 Representa un ($) ∆ Producto o residuo (a) $ ∆ a
  • 31 Si complementamos esta ecuación, haciendo explícitos los lugares predefinidos en la estructura que mencionamos al principio de este capítulo, se podría leer de la siguiente manera: un significante amo en el lugar del agente del discurso, representa a un sujeto del inconsciente que opera como verdad reprimida del mismo, ante otro significante: el significante del saber que es la batería en la cual están organizados los demás significantes. El producto de esta operación es un objeto que, justamente por faltar, causa el deseo: el “objeto a”. Este es el primero de los cuatro discursos propuestos por Lacan para pensar los vínculos sociales, y, según el autor, el más arcaico. Acaso no sea gratuito que la fórmula de constitución del sujeto coincida con el primero de los cuatro discursos que propone Lacan para pensar los vínculos sociales. Es decir, que la organización psíquica en el ser humano está articulada, en su origen, como un discurso de amo. Como el amo feroz que difiere radicalmente del ideal humanista y que Freud describe en su Malestar en la cultura, así: “El Ser humano no es un ser manso, amable, a lo sumo capaz de defenderse si lo atacan, sino que es lícito atribuir a su dotación pulsional una buena cuota de agresividad. En consecuencia, el prójimo no es solamente un auxiliar y objeto sexual, sino una tentación para satisfacer en él la agresión, explotar su fuerza de trabajo sin resarcirlo, usarlo sexualmente sin su consentimiento, desposeerlo de su patrimonio, humillarlo, infligirle dolores, martirizarlo y asesinarlo” 31 . En síntesis: primero, no hay sujeto sin otro. Segundo, el sujeto no tiene una relación directa con sus otros en el campo social; esa relación está mediatizada por un universo significante. Tercero, para dar cuenta de la subjetividad humana se requieren por lo menos cuatro significantes: el S1 o significante amo, el S2 o el saber, el $ o el sujeto, y el “a” o el objeto causa del deseo. Cuarto, todo vínculo social supone por lo menos la existencia de cuatro lugares: el del agente, el otro, la verdad y la producción; y, quinto, la primera articulación de la subjetividad humana toma la forma de un discurso de amo, en el cual el significante amo (S1) está en el lugar del agente, el saber (S2) en el lugar del otro, el sujeto ($) en el lugar de la verdad y el objeto “a” en el lugar de la producción. agente (S1) → otro (S2)_____ verdad ($) ∆ producción (“a”) Lacan propone tres discursos más para pensar los vínculos sociales, los cuales se obtienen a partir del discurso del amo, rotando los cuatro significantes en juego en el sentido inverso a las manecillas del reloj. Estos son: El discurso universitario, el discurso de la histérica y el discurso del psicoanálisis. Sus cuatro discursos, dice el autor, que serían cuatro formas posibles del vínculo social, cuatro “estructuras” posibles de la relación de un significante con otro significante32 . 31 Freud, Sigmund. Obras Completas. v. XXI. Buenos Aires: Amorrortu, 1979. 32 Lacan, Jacques. El Seminario, Libro XVII. El reverso del psicoanálisis, Op. cit., p. 11.
  • 32 Antes de hablar de estas cuatro estructuras, es importante señalar que Lacan piensa el mundo social como un universo significante y advierte que “es en el derecho donde se palpa de qué modo el discurso organiza el mundo real”33 . Efectivamente la constitución política de un país y, por supuesto, las leyes y los decretos que las reglamentan, constituyen el texto que define los lugares que puede ocupar un ser humano en ese entramado social y las relaciones entre esos lugares. Cada lugar está definido por un significante particular. En toda constitución está definido qué es un ciudadano, un gobernante, un padre, una madre, un hijo, un hombre, una mujer, un esposo, un amante, etc. Es cierto que hay otras leyes que gobiernan lo social que no siempre coinciden con su jurisprudencia, como la moral y los hábitus −como llama Bourdieu a esos imperativos sociales no expresos que todos acatamos− de cada uno de los campos que configuran el escenario social. Es notorio que también se trata de sistemas significantes que determinan lugares y definen las relaciones entre ellos. Los cuatro discursos propuestos por Lacan se relacionan con tareas y funciones imposibles, como ya lo mencionamos; tres de ellas, recordémoslo, habían sido mencionadas por Freud: gobernar, educar y analizar. La cuarta, que agrega Lacan, es “hacer desear”. Los agentes de estos discursos, es decir, los significantes dominantes en el vínculo que fundan – no en el sentido de ejercer un dominio sino en el sentido de imprimirle al vínculo su estilo propio- son, en su orden, el significante amo (S1), para la tarea de gobernar; el saber (S2) para la función de educar; el semblante del objeto causa del deseo (“a”), para el vínculo analítico; y el significante de la división subjetiva ($), para el vínculo que tiene como tarea imposible hacer desear. Vamos a hacer un comentario sobre cada uno de los cuatro discursos, partiendo de los significantes mencionados: 2.1. EL DISCURSO DEL AMO El vínculo social que Lacan llama el “discurso del amo” (S1), lo podemos pensar a partir del seminario La dialéctica del amo y el esclavo de Alexandre Kojève, como el amo de la antigüedad. Es cierto que en el mundo moderno ya no existen vínculos sociales que respondan a esa lógica, pero eso no quiere decir que algunos de sus rasgos no se reencuentren, incluso exacerbados, en muchos vínculos privados y que, aún hoy en alguna medida, la humanidad no haya podido prescindir de la función de amo para mantener su orden, el “orden mundial”. 2.1.1. “S1” en el lugar del agente Algunos de los significantes amo que aún sobreviven en el planeta son: el padre, el gobernante, el patrón, el general. Los sujetos que socialmente son investidos 33 Lacan, Jacques. El seminario, Libro XVII, el Reverso del Psicoanálisis, Op. cit. p, 16.
  • 33 por estos significantes amo, no llegan a ser siquiera un remedo de los amos de la antigüedad, pero en alguna medida cumplen su función, al menos en calidad de semblante; y, en situaciones límite, pueden llegar a exhibir algunos de sus rasgos. El amo antiguo es un “Amo” -con mayúscula-, al menos esa es su apuesta. El amo moderno, a lo sumo, opera como un representante del otro, que en últimas, en nuestros estados modernos es, por excelencia, el derecho. Sin embargo, hay que decir que en cada ser humano hay un amo antiguo feroz, que no pierde ocasión para mostrarse en toda su voluntad de goce. Basta que las circunstancias sean propicias y, tanto en la esfera pública como en la privada, se encuentran vínculos en los que se reproduce en más de un aspecto la lógica amo- siervo. Las relaciones de pareja son un espacio privilegiado para ello. La lógica propia del vínculo que se organiza a partir de este agente que es el significante amo, es la del que ordena, tanto en el sentido de dar órdenes, como en el sentido de establecer un orden. Esta lógica de relación, aunque ha sido bombardeada por todos los flancos por los discursos contra el poder, no es prescindible totalmente. Toda organización humana requiere un mínimo de función de amo. 2.1.2. “S2” en el lugar del otro El “otro” del amo, su partenaire –por así decirlo-, es el siervo, que no es un “Otro” con mayúscula, en el sentido que pretende serlo un amo antiguo; pero, estrictamente hablando, el siervo tampoco es otro con minúscula, en el sentido de un semejante. El siervo no es un semejante del amo, el amo no lo reconoce como a un igual. El siervo es “otro” que está en una condición de instrumento al servicio de la voluntad de goce del amo. Un buen siervo se define por su saber sobre aquello que hace gozar al amo. Por ello el significante que utiliza Lacan para nombrar al siervo es el “S2”, que es el significante del saber. Agente → otro S1 → S2 El amo, en su versión más auténtica, no desea el saber en el sentido del filósofo, que se define por su amor al saber. El amo somete el saber del “otro” que es el siervo y lo pone al servicio de su voluntad de goce. 2.1.3. “a” en el lugar del producto El goce sería, pues, el producto del vínculo en el cual un amo ocupa el lugar “dominante” de la operación, en el sentido más literal de la palabra, es decir, mediante la sumisión del otro. El goce, en este caso, tendría varias versiones. La más evidente de ellas es la plusvalía. Pero hay otras que Freud menciona en El Malestar en la cultura, y que se relacionan con colocar al otro en condición de objeto de goce, verbigracia, “usarlo como objeto sexual sin su consentimiento,
  • 34 infligirle dolores, humillarlo, mortificarlo y asesinarlo”. El goce, en este caso estaría asociado con el reducir al otro a la condición de un desecho y, finalmente, desecharlo. Agente → otro____ S1 → S2 producto “a” 2.1.4. “$” en el lugar de la verdad La verdad del amo es su propia castración. Es decir, allí donde se exhibe un exceso de plenitud, certeza y poderío, merced a su capacidad para someter al otro, lo que está operando como verdad es todo lo contrario: una inconsistencia fundamental, una incertidumbre y una impotencia que son recubiertas de fuerza. Esto se puede ver, en un plano general, en el despotismo y las dictaduras, tanto las abiertas como las encubiertas. Agente → otro____ S1→ S2 verdad ∆ producto $ ∆ “a” Todos los reyes están desnudos –nos dice un cuento oriental-. Todo el mundo lo sabe, pero nadie se los dice. Hasta que aparece un sujeto sintomático: un niño, un loco, un marginal o un terrorista y pone al desnudo lo que todo el mundo sabía. Que el rey está desnudo ($)... y que además es un imbécil. La verdad del vínculo social que hemos denominado “discurso del amo”, es que se trata de una propuesta insostenible. En otras palabras que todos los imperios tienen su ocaso, que los reyes también mueren, que no hay poder infalible. 2.2. EL DISCURSO UNIVERSITARIO Hay un cierto momento en la historia de occidente en el que el mundo deja de ser regido por amos encarnados en monarcas y empieza a ser regido por textos. Este es un paso decisivo, en el proceso cultural: que en lugar de un soberano haya una carta magna; en lugar de un amo un libro. Es el momento en el que el saber se coloca en el lugar del agente y se inaugura lo que Lacan llama el Discurso Universitario. 2.2.1. “S2” en el lugar del agente El significante del saber (S2), como agente del vínculo, tiene múltiples versiones. Una de ellas es el estado de derecho. Ya lo dijimos, el estado de derecho es un amo moderno. Lacan dice que el discurso universitario no es otra cosa que una versión moderna del discurso del amo. Es decir, los amos no desaparecen con el nacimiento del estado de derecho, simplemente se modernizan. Más adelante
  • 35 veremos que esta modernización del amo tiene que ver con una suerte de ocultamiento. Otras versiones del saber (S2), como agente del vínculo social son, por excelencia, la ciencia y las instituciones educativas; y, por supuesto, la tecnología que produce aplicaciones industriales del saber de la ciencia. Una versión reciente del S2 son, por ejemplo, los desarrollos sobre inteligencia artificial y las nuevas tecnologías de la información. Lacan dice que la filosofía es la responsable de esta expropiación gracias a la cual el saber pasa del lugar del esclavo al lugar del amo. Según el autor, la filosofía es la primera forma de saber amo que se conoce. El amo antiguo apelaba a su fuerza y a la divinidad. El amo moderno apela al saber y a la racionalidad. Siempre tiene su ejército, o su banda de mercenarios, por si acaso. Pero un amo moderno eficaz debe poder arreglárselas sin el uso de la fuerza, aunque la tenga. Otra versión del paso del discurso del amo al discurso universitario tiene que ver con el proceso que Heidegger ha denominado “el desencantamiento del mundo”, el cual está vinculado con el nacimiento de la modernidad y de una cosmovisión laica organizada en torno a la filosofía racionalista y a las ciencias naturales; esto implicó pérdida de hegemonía de la cosmovisión escolástica, en la que se apoyaban algunas monarquías premodernas. El estado moderno es un estado laico. Entonces, el nacimiento del discurso universitario tiene que ver con tres revoluciones: una revolución epistémica que funda una nueva forma de saber como la ciencia moderna, sería la revolución copernicana; una revolución política, cuyo emblema es la revolución francesa, que da lugar al nacimiento del estado de derecho democrático liberal; y una revolución económica, que riñe con las relaciones amo-siervo y da lugar al nacimiento de un nuevo modo de producción que es el capitalismo. Según Lacan, el movimiento que da lugar a estas tres revoluciones nace hace cinco mil años en Grecia, con la filosofía. Este paso decisivo del discurso del amo al discurso universitario, no es localizable en un momento preciso de la historia, sino que es un proceso que se inicia en la Grecia del siglo IV antes de Cristo y que se consolida de manera definitiva a comienzos del siglo XIX. Volvamos al planteamiento inicial. El agente de esta versión moderna del discurso del amo es el saber (S2). En otras palabras, el saber es la moderna estrategia de sometimiento. Michel Foucault lo dice a propósito de la subjetividad moderna: “una manera de someter los cuerpos, de dominar las multiplicidades humanas y de manipular sus fuerzas se ha desarrollado en el curso de los siglos clásicos, en los hospitales, en el ejército, en las escuelas, los colegios o los talleres: la disciplina. El siglo XIX inventó, sin duda, las libertades, pero les dio un subsuelo profundo y sólido –la sociedad disciplinaria de la que seguimos dependiendo”. Las ciencias humanas son uno de los emblemas fundamentales del discurso universitario y el
  • 36 DSM−IV es una de sus más acabadas producciones. Digamos de paso que la lucha que libra la medicina occidental contra todas las prácticas clínicas tradicionales, tiene que ver con ese movimiento de consolidación de los saberes de amo en contra de los saberes de los siervos. En el campo de los vínculos cotidianos, los emblemas del discurso universitario serían los intelectuales, en el sentido que Antonio Gramsci le da a este término, es decir, todos aquellos sujetos sociales cuyo trabajo tiene que ver con funciones de dirección, información, educación, etc., es decir todos los profesionales, los funcionarios públicos, los docentes de todos los niveles, los periodistas, los religiosos... etc. 2.2.2. “a” en el lugar del otro Vamos a examinar la estructura de esta nueva modalidad del vínculo social que inaugura el discurso universitario. Si el saber es el agente, el “otro”, lo que hemos llamado su partenaire, por definición está bajo el signo de la ignorancia; o, en todo caso, en una posición de falta con respecto al saber. Pero también puede estar en la posición de un recurso sobre el que ese saber opera transformaciones, como una suerte de material o de materia prima, en el sentido que se dice que alguien tiene pasta o tiene madera; también, por supuesto, en el sentido en que se habla modernamente de recursos humanos. Los otros que son interpelados por el saber, en el discurso universitario, son por excelencia el a-lumno, definido como un sujeto en falta (falta de luz) y el obrero, definido como fuerza de trabajo, es decir una mercancía. Lacan utiliza la “a” minúscula para referirse al otro que es interpelado por el saber (S2), en el discurso universitario. Agente → otro S2 → “a” Podemos notar que este “a” es un “otro” que tampoco tiene un estatus propiamente humano. En realidad está en una posición semejante a la del siervo, pero el siervo al menos tenía un saber que le era propio. El estudiante y el obrero son siervos a los que les ha sido sustraído el saber. La “a” en este caso se puede leer en su literalidad como un lugar vacío. O, en otras palabras, como el lugar de un vacío. Todos los saberes están articulados como universos simbólicos: la magia, la religión y la ciencia. En la medida en que un saber organiza un grupo social, de él se derivan, tanto la definición de los lugares sociales y los vínculos entre ellos, como un conjunto de prescripciones que debe cumplir cada sujeto social de acuerdo con el lugar que ocupe en el entramado que define. Estas prescripciones pueden organizarse bajo la forma de una moral y su trasgresión puede ser objeto de sanción social. El ejemplo más simple de esto son los sistemas de parentesco. En todas las culturas existe un sistema de parentesco. Cada sistema de parentesco define qué es un padre, una madre, un hijo, un hermano... y los deberes y derechos de cada integrante del grupo social. La violación de estos preceptos suele ser objeto de culpa y sanción social.
  • 37 Pero el saber que organiza cada conjunto social, sea mágico religioso o racional, va mucho más allá de definir los sistemas de parentesco y penetra en las minucias más insólitas del la vida de sus integrantes: regula las relaciones con el cuerpo, la sexualidad, el amor, el trabajo, etc. En el caso de nuestra cultura penetra hasta los lugares más recónditos de la vida privada de los individuos y prescribe el número de calorías que debe consumir, el peso que debe tener de acuerdo a su estatura, el tipo de sentimientos que puede exteriorizar y la medida de dicha exteriorización, etc. 2.2.3. “$” en el lugar del producto Esta operación mediante la cual un saber organiza un grupo social inevitablemente produce un malestar, o muchas formas de malestar. Podemos decir que lo que diferencia a unas culturas de otras no es que unas produzcan malestar y otras no, sino el tratamiento que le da cada cultura al malestar que produce. Freud dedica una de sus grandes obras El malestar en la cultura, a tratar este problema. Este malestar lo podemos escribir en el lugar de la producción del discurso universitario, debajo del lugar del otro y lo vamos a representar con el significante de la división subjetiva. Agente → otro____ S2 → “a” producto $ La política es una de las vías privilegiadas para tratar con este malestar, en la medida en que le permite una expresión y, en el mejor de los casos, una acción transformadora del universo simbólico que lo produce. Esta acción de la política es la que mantiene el universo simbólico de lo social en permanente transformación. Esta transformación no garantiza la desaparición del malestar, ya que este es irreductible, pero sí le da cada vez formas cualitativamente distintas y en algunos casos más elaboradas. Los sujetos sociales que encarnan el malestar, es decir el producto sintomático de la operación social ($) son los locos, neuróticos, los delincuentes, los marginales (prostitutas, trasvestis, indigentes, desplazados, delincuentes, etc.). Podríamos decir que son los sujetos más vulnerables, aquellos en los que se materializa de una manera más cruda el malestar en la cultura. En alguna medida, la viabilidad de un proyecto cultural se puede medir por su capacidad de excluir el mínimo posible. Y, podríamos decir que un proyecto cultural no es viable cuando ya los segregados no son las minorías sino la mayorías. Freud lo dice muy claramente en El porvenir de una ilusión: “si una cultura no ha podido evitar que la satisfacción de un cierto número de sus miembros tenga por premisa la opresión de otros, acaso la mayoría, es comprensible que los oprimidos desarrollen una intensa hostilidad hacia esa cultura que ellos posibilitan con su trabajo, pero de cuyos bienes participan en medida sumamente escasa... Huelga decir que una cultura que deja insatisfecho a un número tan grande de sus miembros y los
  • 38 empuja a la revuelta no tiene perspectivas de conservarse de manera duradera ni lo merece”. 34 2.2.4. “S1” en el lugar de la verdad La verdad que está en la base del discurso universitario es el significante amo (S1). En otras palabras: la verdad es que el amo no ha desaparecido, solamente se ha modernizado y el aspecto fundamental de esa modernización es el ocultamiento. El amo moderno es muy distinto a los sultanes orientales, que serían versiones del amo antiguo. El amo moderno es un amo discreto, en muchos casos anónimo. Por ello uno de los emblemas de la modernidad son las sociedades anónimas; y, por supuesto, los comités en los que se diluye la responsabilidad en un colectivo sin un nombre propio. Con este significante completamos los cuatro términos de la estructura que constituye el discurso universitario. agente → otro____ S2 → “a” verdad ∆ producto S1 ∆ $ 2.3. DISCURSO DE LA HISTÉRICA En este punto es importante aclarar que el término “histérica”, en esta acepción particular que tiene en la propuesta de “los cuatro discursos” de Lacan, no tiene la connotación restringida de lo patológico sino la acepción amplia de aquello que “suscita el deseo” y pone en marcha la producción de saber. Las histéricas se pueden incluir en esta modalidad del lazo social, justamente porque su síntoma se articula de acuerdo con esta fórmula: su deseo se organiza en función de hacer desear a un “otro”, que sitúan en el lugar de un amo; y, en esa medida, lo increpan respecto de su pretendida plenitud, lo pueden hacer tambalear, incluso sucumbir; pero su estrategia no está en función de sustituirlo, sino de hacerlo desear… saber. Con respecto a la producción de saber que provoca la histérica, no hay que olvidar que gracias a las histéricas se produjo el psicoanálisis y que es porque existen analizantes, es decir, sujetos que articulan su deseo de acuerdo con el discurso de la histérica en el dispositivo analítico, que el psicoanálisis puede seguir existiendo. Recordemos, de paso, que el término síntoma en el lenguaje psicoanalítico posee cada vez menos la connotación de lo patológico y cada vez más se refiere a aquellas producciones en las que se revela una verdad que alcanza a medio decir algo del goce insistente que habita a un sujeto. En otras palabras, con el término síntoma ocurre lo que con el término histérica: que en el campo de la psicopatología puede nombrar una entidad nosológica, pero cuando se articula en una propuesta como los cuatro discursos, que se refiere al vínculo social, adquiere 34 Freud, Sigmund. El porvenir de una ilusión. Obras Completas, Vol. XXI. Buenos Aires: Amorrortu editores. 1979. p, 12.
  • 39 un sentido que tiene un alcance que va mucho más allá de lo nosográfico y que remite a una estrategia particular para relacionarse con el otro. En la modalidad de vínculo social que Lacan denomina discurso de la histérica, el deseo que está en juego no es el exhibirse en una pretendida plenitud para someter a ese “otro” por la vía de la fuerza (como el amo) o el adoctrinamiento (como el universitario); sino todo lo contrario, el provocarlo, a partir de la propia falta ($), desde la propia inconsistencia, para hacerlo desear y poner ese deseo en función de la producción de saber. 2.3.1. “$” en el lugar del agente El agente del discurso de la histérica es el sujeto sintomático. Es decir, el producto del discurso universitario. Si decimos que se trata de un sujeto sintomático que funciona como agente de una modalidad particular de lazo social, no debemos dejar de emplear la expresión: “síntoma social”. Incluso podemos preguntarnos si habrá algún síntoma que no sea social. Es decir, en la medida en que tomamos el síntoma como un mensaje cifrado, dirigido a un otro, lo estamos definiendo desde el comienzo mismo como una producción social. Los sujetos sintomáticos, en toda organización social, siempre increpan fundamentalmente al orden social como un todo, al poder o a sus representantes, aquellos que hacen el semblante del amo. Esto lo podemos leer de dos maneras, una literal y otra metafórica. Respecto de la acepción literal diremos que los sujetos sintomáticos increpan al Otro –con mayúscula-, allí donde se sublevan, aún en un gesto suicida, contra el poderoso, contra el poder, o contra las normas. En este sentido, los ataques al poder o a sus emblemas, que se articulan como una finalidad en sí mismos y no como un medio al servicio de la instauración de otro poder, serían una de sus expresiones por excelencia. Respecto de la acepción metafórica, diremos que los movimientos sociales y artísticos que interpelan a las distintas expresiones del poder y a sus representantes, pero que no se plantean como horizonte la construcción de otra forma de poder, serían, en un sentido amplio, las expresiones colectivas del discurso de la histérica. Podemos decir que el arte, en general, opera de acuerdo con esta lógica que acabamos de mencionar. El artista no es un amo, ni un pedagogo. Su función no es gobernar ni educar. Uno de los elementos que define la obra de arte es que no puede ser impersonal, como un estado o una escuela, es decir no es pensable como algo independiente del deseo del artista, de su drama, de su rebelión creativa frente al universo simbólico en el que deja su marca. Otro elemento que define la obra de arte, o mejor, los movimientos artísticos, es que no dejan el mundo tal como estaba antes de su irrupción. Y, finalmente, el arte tiene el efecto
  • 40 de interrogar al otro de su época mediante su seducción y, con ello, desata una producción de saber que por definición es inagotable. Pero no solamente los movimientos artísticos se podrían leer de acuerdo con esta estrategia del vínculo social que hemos llamado “el discurso de la histérica”, hay otros movimientos sociales que han increpado al amo, lo han puesto a desear y a producir saber sin pretender ocupar su lugar. El movimiento llamado Mayo del 68, en Francia, operó según esta lógica; y, podríamos decir que el Movimiento Zapatista en México, y las Madres de la Plaza de Mayo, se inscriben en esta modalidad del vínculo social. Los tres han estremecido el orden social correspondiente, han despertado el deseo de saber y han puesto al Otro social a pensar. No sólo a los poderosos, a todo el conjunto social. La particularidad de los movimientos mencionados y lo que los diferencia de los movimientos guerrilleros latinoamericanos de los años 60 y 70 es que se trata de movimientos que no interpelan al amo desde otro saber articulado como una propuesta de otro ordenamiento social, ni aspiran a conquistar el poder. Notemos que los movimientos sociales que se inscriben en esta modalidad del vínculo social no tienen la estructura de una masa artificial, similar a la iglesia, el ejército, la universidad, la empresa, el partido político y todas las demás formaciones sociales que operan bajo la modalidad del discurso del amo y del discurso universitario. El agente de este discurso de la histérica ($) se caracteriza por su condición minúscula, desde la cual increpa a Otro -con mayúscula-. Hay que sospechar de este agente social cuando se oficializa, se institucionaliza, o se populariza. El agente del discurso de la histérica, en su condición de síntoma social, es por definición más o menos marginal; y, esta marginalidad hay que entenderla, en el sentido geométrico de la palabra, como aquello que está en la periferia. Ese lugar limítrofe implica que en una de sus dimensiones es íntimo respecto del orden al que pertenece, y en otra de ellas es externo. Utilizando un neologismo lacaniano, podríamos decir que lo sintomático es éxtimo respecto del orden social al que pertenece. Ya dijimos que los grupos que interpelan al poder, interrogándolo, denunciándolo, socavándolo, incluso atacándolo, sin pretender oponerle otro poder, pueden ser pensados a la luz de esta modalidad del vínculo social. Desde esta perspectiva, como ya lo señalamos, podemos interpretar algunos movimientos artísticos y sociales en el sentido fuerte de la palabra, pero también fenómenos sociales modernos como las llamadas tribus urbanas, las subculturas de consumidores y traficantes de drogas ilícitas, los grupos satánicos, ciertos movimientos contestatarios que se articulan en torno a algunos géneros musicales. 2.3.2. “S1” en el lugar del “otro” Ya dijimos que el otro, interpelado por el agente del discurso de la histeria es un significante amo: un representante, un símbolo, una institución, o el orden social
  • 41 mismo como un todo, en su poder de sujetación. Por ello es que Lacan dice, a propósito del discurso de la histérica: “eso es lo que vemos actualmente, la ley puesta en cuestión como síntoma”. Agente → otro $ → S1 El ejemplo más simple de un amo, un Otro con mayúscula que ha sido increpado históricamente por un agente situado desde el lugar del agente del discurso de la histérica, es sin duda el poder médico, en la medida en que las histéricas le señalaron su inconsistencia. Siguiendo con los ejemplos de los movimientos sociales que mencionamos más arriba, éstos pueden increpar a otras versiones abstractas del amo, como los ideales, o ciertos discursos que en el grupo social respectivo sean considerados oficiales, incluso sagrados. En ese orden de ideas, el amo puede estar representado en la religión, la moral, la legalidad, o ciertos valores que pueden operar en un grupo social como significantes amo, es decir, como ideales tiránicos: el orden, el progreso, la normalidad, el éxito social, la salud mental, la ley. Estas versiones del amo suelen ser los objetos privilegiados de ciertos movimientos contestatarios juveniles de distintas clases, verbigracia los grupos satánicos, los grupos Punk, y diversos movimientos artísticos. El amo interpelado también puede ser el Estado, un régimen gubernamental específico, o una de sus instituciones, como los casos que mencionamos del Movimiento Zapatista y las Madres de la Plaza de Mayo. Y en el caso extremo puede ser el poder mismo en todas sus manifestaciones, como en el caso del movimiento de Mayo del 68. Puede decirse que todos los movimientos sociales que interpelan al amo desde el lugar del significante de la división sintomática ($), es decir, exhibiendo la falta en primer lugar, tienen el efecto de seducirlo, en el sentido de suscitar su deseo, y en virtud de ello, su producción de saber. Todo síntoma social es un desafío de desciframiento, una especie de acertijo, con el que se pone a trabajar al amo. Históricamente, los amos han tardado mucho para descifrar los síntomas sociales que les ofrece su época; como enigma para su desciframiento, generalmente llegan un poco tarde. 2.3.3. “S2” en el lugar del producto Lacan dice claramente que el saber no es producto de ninguna pulsión epistemofílica, sino que es el producto del discurso de la histérica. Esto es bastante claro en el campo de las ciencias sociales. Lo que mueve el avance en el saber son los nuevos fenómenos que perturban el orden tradicional de las instituciones y del conjunto social, es decir, los síntomas que agujerean al amo y operan como enigmas que ponen en marcha las empresas científicas. Las nuevas empresas de investigación social en campos como la toxicomanía, la bulimia, la anorexia, la depresión, el suicidio y otros cuadros propios de los adolescentes modernos, es una manifestación de este producto del discurso de la histérica. Los nuevos desarrollos en ciencias sociales sobre las subculturas delincuenciales, las
  • 42 tribus urbanas, el satanismo y otros fenómenos grupales marginales, es otra modalidad del producto del discurso de la histérica. Agente → otro____ $ → S1 producto S2 El psicoanálisis, en tanto que producción teórica, es uno de los saberes que emerge en el contexto del pensamiento occidental como producto del discurso de la histérica, pero en otros campos como la economía, la pedagogía, la sociología, la antropología, la política, los efectos sintomáticos de las doctrinas tradicionales del discurso universitario están dando lugar a otros nuevos saberes y prácticas alternativas que, paradójicamente vienen a trabajar sobre los efectos de malestar, a veces insoportable, que produce la modalidad particular del saber de amo que opera como agente del discurso universitario. 2.3.4. “a” en el lugar de la verdad La verdad que está en la base de esta modalidad del vínculo social que Lacan denomina “el discurso de la histérica” es el goce. Los sujetos y los movimientos sintomáticos confrontan el statu quo con una modalidad del goce que pretende escamotear. Una de las lecturas posibles del malestar en la cultura, al que nos referíamos más arriba, es la división sintomática experimentada por el sujeto entre la tiranía de los ideales y las exigencias pulsionales que reclaman su lugar en la subjetividad. En otras palabras, la pregunta que Freud se hace a partir del trabajo con sus histéricas -y que aún debe ser sostenida- es: si los síntomas sociales no hablan en todos los casos de un “sobregiro” -como Freud le llama- de la cultura. Es decir que allí donde aparece un fenómeno sintomático, de la índole de los que hemos mencionado, hay que preguntar ¿cuál es el rasgo de esa cultura que se está tornando insoportable?, ¿cuál es la dimensión del orden social que ha devenido insostenible? Agente → ___otro____ $ → S1 verdad ∆ producto a ∆ S2 El goce que opera como verdad en la base del discurso histérico, no tiene la misma dimensión social que el goce cínico y mortífero del amo, que no se detiene ante su voluntad de poder. El goce en el discurso histérico es, por excelencia, un goce perdido, del que algo se recupera por la vía de la palabra. El agente del discurso de la histeria es un sujeto que asume su castración, aún pagando el precio de malestar que esto conlleva; y, su intento de recuperación del goce perdido es fundamentalmente por vía de la producción simbólica, por la vía de un llamado al otro, aunque dentro de esta estrategia, a veces desesperada, siempre estén presentes los excesos fatales. Sin embargo, hay que insistir en que el lugar del goce en el discurso de la histérica es debajo de la barra. El agente del discurso de la histérica no es un gozón como
  • 43 el amo. Todo lo contrario, su estrategia en relación con el goce se inscribe en la dimensión de lo simbólico; y, aún muchas veces a costa de sí mismo, es el sujeto social que hace avanzar la producción de saber. Incluso, hay que decir que la producción discursiva de los sujetos y los grupos que socialmente se sitúan en esta estrategia de relación con el otro, aunque no hay una pretensión de saber, sí hay una relación particular con la verdad, de tal forma que su discurso se sitúa más del lado de la denuncia, la provocación, la sátira, el chiste, el desafío y, por supuesto, la trasgresión, pero referida fundamentalmente al ordenamiento simbólico, a los valores establecidos, a los ideales sociales. En el mejor de los casos, esta producción alcanza la condición de una producción artística. Por analogía, hay que decir que uno de los objetivos de un análisis es que el analizante alcance una dimensión poética en su discurso, en el sentido correcto del “buen decir” que no es una decoración del fantasma, sino un discurso comprometido con la verdad. 2.4. EL DISCURSO PSICOANALÍTICO Según Lacan, el inédito que el psicoanálisis introduce en el mundo es una nueva modalidad de vincularse con el otro, un tipo de lazo social que no existía antes y que, por supuesto, es cualitativamente distinto de las tres estructuras que hemos expuesto hasta el momento. Quizá la mejor manera de empezar a definir este nuevo discurso, que se funda con la práctica analítica, sea señalar que un analista no es para un analizante un amo, ni un maestro, tampoco su función es seducirlo en el sentido de suscitar su deseo. 2.4.1. “a” en el lugar del agente Colocarse en el lugar del agente del discurso psicoanalítico implica renunciar a gobernar (S1) al otro y decidir por él y, por supuesto, a colocarlo en posición de un instrumento al servicio del propio goce. Colocarse en este lugar particular, también implica renunciar a pretender tener el saber (S2) que al otro le hace falta y, en consecuencia, desistir de la tentación de adoctrinarlo, concientizarlo, reeducarlo, en fin, llevarlo a “buen puerto”. Y, finalmente, para sostenerse en el lugar del agente del discurso analítico es indispensable renunciar a vincularse con él a partir de la exhibición del propio síntoma ($), para ponerlo a producir saber. Sabemos que el significante “a” remite al goce y, por tanto, a la causa del deseo. También a la falta de objeto, que es otra manera de nombrar la causa del deseo. Otro nombre de la “a” en la obra de Lacan es “el semblante del ser” en la medida en que el ser es aquello que a los humanos nos falta y la falta de ser es justamente lo que nos lanza a las redes del deseo. Dijimos que la tarea del analista no es hacer desear al analizante. El analista no está en la posición del agente del discurso de la histérica. Para que la modalidad del vínculo social que inaugura el psicoanálisis pueda ser puesta en marcha es
  • 44 necesario que preexista el sujeto deseante, que no existió desde siempre, sino que aparece en cierto momento de la historia. En otras palabras es condición temporal que exista el discurso de la histérica y, por supuesto, su agente particular ($), para que se pueda inaugurar el vínculo analítico. Esta aclaración es importante para entender una sutileza que es necesaria para situar con precisión el lugar del agente del discurso analítico: el analista –ya lo dijimos- no es el objeto que suscita el deseo del analizante, sino el que se coloca como semblante de ese objeto que ya existe para el sujeto. Colocarse en el lugar del objeto que falta, del goce perdido, o del ser que no se tiene, y desde allí interpelar a un “otro”, es ciertamente un inédito bastante insólito, porque es ponerse en la posición de lo que interroga a un sujeto y lo divide y no en la posición del imperativo que lo excusa de responderse a esa pregunta, o del nuevo profeta que la responde, o de la nueva tentación que lo distrae de la necesidad de confrontarse con ella. Hay que decir que si bien el psicoanalista en un primer momento puede estar revestido con los emblemas de lo deseable, por colocarse como el semblante de aquello que causa el deseo; en un segundo momento necesariamente va a tornarse ominoso, en la medida en que confronta al sujeto con lo horroroso de ese real que se oculta siempre tras el semblante de lo deseable; y, en un tercer momento, va a quedar en el lugar del desecho de la operación. Notemos que estos tres lugares, pese a su diversidad, corresponden fielmente a tres acepciones legítimas del objeto “a”: causa, real y resto. 2.4.2. $ en el lugar del otro Interpelar a un “otro” desde el lugar de este objeto particular (“a”), implica colocarlo en el lugar del sujeto al que este objeto divide: (“$”). El otro del analista no está en posición de siervo que sabe hacer gozar, ni en posición de recurso humano al servicio de la explotación, ni en la posición de madera en bruto a la que da forma la mano del maestro, ni en la posición de amo al que hay que interrogar, desafiar o agujerear. El otro que es interpelado por el agente del discurso psicoanalítico es el sujeto del malestar en la cultura, el sujeto que con sus síntomas denuncia que algo en la cultura no anda bien, el sujeto que puede articular su malestar bajo la forma de una pregunta. Agente → otro a → $ Sin que esto implique deslizarnos hacia humanismos ingenuos, debemos admitir que de los cuatro agentes mencionados, el que interpela al “otro” en una posición más acorde con la dignidad de lo humano es el agente del discurso psicoanalítico. El que el “otro” esté en la posición de sujeto implica que es reconocido por el agente en su particularidad irreductible y que desde allí se espera de él una producción original.
  • 45 2.4.3. “S1” en el lugar del producto La producción en todos los discursos la hace el “otro”, pero es impensable sin la incidencia del “agente” sobre él. Si el “otro” está rigurosamente en una posición de sujeto, su producción no puede ser del orden de la serie; tiene que ser, por fuerza, algo singular; es decir, justamente aquello que le confiere valor, en el sentido en que Saussure habla del valor lingüístico, aquello que lo diferencia de los otros. Lo que se espera como efecto de la operación analítica es que el sujeto produzca su propio nombre. Esta producción se puede entender, de acuerdo con la concepción tradicional del análisis, como que se logre desentrañar, vía la asociación libre el significante amo que rige su destino como escritura inconsciente. Esta producción permite al sujeto reconocerse en aquello que le es más propio, más íntimo; y, que en virtud de la enajenación defensiva, había devenido lo más ajeno. Hacer consciente lo inconsciente significa apropiarse de un saber que no se sabe, pero que es un saber propio. Producir el propio nombre se puede entender también en el sentido de articular una respuesta original y acorde con el propio deseo a la pregunta por el ser. Hay que insistir en que esta respuesta no implica una denegación de las marcas de la propia historia, todo lo contrario, es con ellas con las que se construye la propia marca. Es decir, el discurso del psicoanálisis no se espera que produzca placer, ni goce. Tampoco se espera que el psicoanálisis produzca otros síntomas. Ciertamente puede haber una transformación de los síntomas que trae el paciente, como parte del proceso terapéutico; pero no se espera que el discurso analítico sea una fábrica de síntomas, a la manera del discurso universitario. Y, finalmente, no se espera que el producto de un análisis sea un saber, en el sentido académico de la palabra, es decir un saber universalizable, que luego se pueda instrumentar al servicio del poder. El producto del discurso del psicoanálisis es un significante amo, sí, pero que tiene una particularidad; se trata de un significante amo que no viene del otro (ni del Otro) sino que es producido por el sujeto mismo y que es congruente con su propio deseo. Agente → ___otro____ a → _$__ Producto S1 Así como dijimos, a propósito del discurso del amo, que ninguna institución ni grupo social puede prescindir de un mínimo de amo, podemos decir también que en la organización subjetiva es necesaria esta función. El dispositivo analítico permite al sujeto confrontarse con sus propios significantes amo; y, articular una nueva función de amo, una nueva posición y una nueva dirección, en el sentido de rumbo −pero también en el sentido de dirigirse−, menos enajenada en las demandas de los otros (y del Otro) y de sus ideales y más congruente con el deseo del sujeto.
  • 46 2.4.4. “S2” en el lugar de la verdad Lacan dice que un saber en el lugar de la verdad no puede ser otra cosa que un mito. El mito, como sabemos, tiene la virtud de cernir la verdad bajo la forma de un medio decir. Ciertamente hay un saber que está en la base del discurso analítico, pero no se trata de un saber hacer gozar, ni un saber hacer marchar la cosa, ni un saber por qué la cosa no marcha; sino un saber de los límites y los efectos de los saberes de los discursos que mencionamos anteriormente. agente → ___otro____ a_ → $_ verdad ∆ producto S2 ∆ S1 Ciertamente el saber hacer del analista y el saber abstenerse de deslizarse hacia el lugar del amo, del pedagogo o del amado, implica para éste, saber que sobre la verdad particular de la relación de cada sujeto con la sexualidad y con la muerte no es posible saber, a priori, ni llegar a saberlo todo; y que, por lo tanto, ese saber es siempre un saber que sólo puede ser construido por el sujeto mismo en la experiencia analítica. Una pregunta legítima que se desprende de esta exposición de la estructura del lazo social que introduce el psicoanálisis es si esta modalidad del lazo social solamente se produce en los gabinetes de los psicoanalistas, o si es posible encontrar estructuras y productos análogos en otras coordenadas del escenario social, articulados a otras dimensiones de la experiencia, no necesariamente la clínica del uno por uno. En otras palabras, la pregunta sería si existirán otras coordenadas de la experiencia social en las que se pueda encontrar algo o a alguien que desde el lugar del semblante del objeto que causa el deseo (“a”) interpele a un sujeto (“$”) que es dividido por ese objeto (del cual se hace semblante) y gracias a esa interpelación este sujeto puede parir su propio amo (“S1”), es decir, confrontarse con el verdadero señor de su casa. Se trata de una pregunta tentadora que no vamos a desarrollar, pero sí dejaremos, por lo menos, insinuada la vía de tres posibles respuestas. La articulación de esta clase de lazo social implica que aquello que va a operar en el lugar del agente tenga la propiedad de poder funcionar como un semblante del objeto “a”. Hay al menos tres casos en los que esto puede ocurrir por fuera de la experiencia analítica. El primero de ellos es el efecto que produce sobre un sujeto la obra de arte que lo confronta con un rasgo del objeto que lo divide y lo causa como deseante. El segundo, es el efecto de lo femenino allí donde interpela al sujeto como ese otro goce, o mejor ese goce otro, fascinante y terrorífico. Y el tercero tiene que ver con ciertos acontecimientos excepcionales de la historia, que tienen la virtud de confrontar a un sujeto con las determinaciones fundamentales que articulan su deseo. Como el que le ocurre a Tadeo Isidoro, un personaje de un cuento de Jorge Luis Borges: “una lúcida noche fundamental: la noche en que por
  • 47 fin vio su propia cara, la noche en que por fin oyó su nombre” (S1). El cuento se llama Biografía de Tadeo Isidoro Cruz. Borges dice allí que “cualquier destino, por largo y complicado que sea, consta en realidad de un solo momento: el momento en que el hombre sabe para siempre quién es”35 . Quizá este cuento de Borges, sea una buena metáfora de lo que ocurre en el transcurso de un análisis. Queda abierta la pregunta si no habrá otras versiones del semblante del objeto del deseo en otras experiencias de la vida social, que puedan suscitar efectos análogos a los mencionados. 35 BORGES Jorge Luis, Obras Completas. Buenos Aires: Emecé Editores 1989 p, 562
  • 48 33333333........ LLLLLLLLAAAAAAAA TTTTTTTTAAAAAAAARRRRRRRREEEEEEEEAAAAAAAA CCCCCCCCOOOOOOOOMMMMMMMMOOOOOOOO AAAAAAAAGGGGGGGGEEEEEEEENNNNNNNNTTTTTTTTEEEEEEEE EEEEEEEENNNNNNNN LLLLLLLLOOOOOOOOSSSSSSSS CCCCCCCCUUUUUUUUAAAAAAAATTTTTTTTRRRRRRRROOOOOOOO DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOOSSSSSSSS Por: JaimePor: JaimePor: JaimePor: Jaime AlbertoAlbertoAlbertoAlberto CarmonaCarmonaCarmonaCarmona 33..11.. LLAA TTAARREEAA EENN EELL LLUUGGAARR DDEELL AAGGEENNTTEE DDEELL DDIISSCCUURRSSOO DDEELL AAMMOO 3.1.1. La tarea en el ECRO de Enrique Pichón Rivière Enrique Pichón Rivière define el dispositivo del grupo operativo en función de la tarea, como centro articulador y organizador del acontecer grupal. Esta definición de su dispositivo como “grupo centrado en la tarea”, lo diferencia de los “grupos centrados en el individuo”, como son, por ejemplo, “los grupos psicoanalíticos o de terapia en los que la tarea está centrada en aquel que para nosotros se llama portavoz”36 . Según Pichón, estos grupos, al centrarse en un individuo, descuidan la perspectiva de la situación grupal y dirigen el análisis e intervención hacia aquél que enuncia el problema, no incluyendo al resto del grupo. Pero Pichón también diferencia su grupo operativo de otro tipo de dispositivo como “los grupos centrados en el grupo”, en el análisis de la propia dinámica grupal, “Técnica que está inspirada en Kurt Lewin, en la que se considera al grupo como una totalidad”37 . La crítica que el autor le hace a esta propuesta es, en un sentido, opuesta a la que le hace a los grupos centrados en el individuo, que centran su análisis en el grupo como totalidad y dejan de lado el factor individual -pero en el fondo es la misma crítica-. Finalmente ambos modelos, los grupos centrados en el grupo y los grupos centrados en el individuo, dejan de lado, según Pichón, la relación sujeto−grupo. Teniendo en cuenta lo anterior, el grupo operativo no solamente se define por tener la tarea como centro, sino también por mantener como horizonte de análisis e intervención la relación grupo-sujeto, horizontalidad-verticalidad. Pichón subraya la diferencia de su dispositivo respecto de las otras dos técnicas de abordaje mencionadas y a la vez reconoce que la propuesta del grupo operativo integra algo fundamental de cada una de ellas. Los grupos operativos nacieron y tuvieron sus primeros desarrollos en el campo de la intervención de pacientes psicóticos, tanto en el escenario del trabajo grupal en el Hospicio de las Mercedes, como en los intentos de abordaje de la psicosis por medio del trabajo con grupos familiares; muy pronto los grupos operativos como técnica y como campo de investigación del desarrollo mismo de la técnica, se articularon también en función de la formación de psicólogos sociales. Por ello, casi siempre que Pichón se refiere a la tarea, toma como referente esos escenarios, pero él mismo advierte que: “el eje de la tarea hace útil este 36 Historia de los grupos operativos. Citado en: Diccionario de términos y conceptos de psicología y psicología social. Joaquín Pichón Rivière y otros, p 96. 37 Ibíd.
  • 49 instrumento para cualquier clase de trabajo”38 . Esto lo demuestra Pichón con el experimento social que constituyó la experiencia Rosario, en el que el grupo operativo es puesto al servicio de un trabajo con una comunidad donde la tarea no podría definirse, ni como terapéutica, ni como formativa. Es importante mantener presente esta doble perspectiva en torno a la concepción de la tarea en Pichón, ya que si bien, casi siempre que se refiere a ella lo hace en términos de los grupos terapéuticos o de formación. Hay que leer esto teniendo en cuenta que para el autor los procesos terapéuticos, así como los procesos de aprendizaje y cambio, más que ámbitos particulares de intervención de la psicología social, son dimensiones que están presentes en toda experiencia grupal. Más aún, Pichón sostiene que los procesos de aprendizaje y cambio en los grupos, con sus respectivas resistencias, y la aparición y tratamiento de las diversas formas del malestar y la enfermedad mental, constituyen el fundamento mismo del acontecer del grupo; en virtud de ello, los grupos terapéuticos y los de formación constituyen simplemente campos paradigmáticos en los que se puede observar e intervenir de una manera más abierta sobre dimensiones que son el fundamento mismo de la vida de los grupos. Esta concepción particular de la vida grupal, tiene efectos para la definición particular de la tarea en la obra de Pichón, ya que ésta va más allá de lo explícito: “Así es como definimos la tarea: consiste en el abordaje de conocimiento, que tiene un nivel explícito o manifiesto de abordaje. Pero en este plano explícito de la ejecución de la tarea o tratamiento del tema, surgen cierto tipo de dificultades, de lagunas, de cortes en la red de comunicación, montos de exigencia que aparecen como signos, como emergentes de obstáculos epistemológicos”39 . En el mismo texto, más adelante, el autor aborda la dimensión de la tarea que se refiere a la lucha contra la resistencia: “este obstáculo o dificultad de abordaje denuncia una actitud de resistencia al cambio, si consideramos que la enfermedad mental o las dificultades sociales de cualquier tipo van acompañadas de una resistencia al cambio”.40 Se trata ciertamente de una concepción compleja del acontecer grupal y de la tarea, que contiene en su definición el principio mismo de su negación. Es importante tener en cuenta que esta definición de la tarea implica una concepción particular del grupo que tiene profundos alcances. Pichón no concibe el grupo como una realidad transparente a sí misma, como una entidad que pueda definirse precisamente por la propiedad de tener una especie de autoconciencia, sino todo lo contrario. El grupo, tal como lo concibe el autor, es opaco para sí mismo, tiene siempre una zona de sombra, que tiene sus propias dinámicas, cuyos productos se hacen valer en el grupo sin que haya una apropiación o consenso grupal en 38 Ibíd. p,97 39 Ibíd. p, 133 40 Ibíd. p, 134.
  • 50 torno al sentido de esos productos. La contradicción y la falta de transparencia del grupo en relación con sigo mismo son dos aspectos que se articulan frecuentemente, en la medida en que justamente la contradicción se suele presentar entre una dimensión del grupo que tiene que ver con la tarea explícita, con lo que podríamos llamar los propósitos expresos del grupo y esa otra dimensión del grupo que queda en la sombra y de la que el grupo solamente sabe por sus efectos que aparecen operando justamente como resistencias al cambio. En esta perspectiva, Pichón aporta otra definición de la tarea más compleja y a la vez más abarcadora: el análisis sistemático de las contradicciones (análisis dialéctico) constituye la tarea central del grupo. Este análisis apunta básicamente a indagar la infraestructura inconsciente de las ideologías que se ponen en juego en la interacción grupal. No hay que perder de vista el suelo epistemológico del materialismo dialéctico que atraviesa siempre el pensamiento de Pichón, en virtud del cual, el autor no piensa en una tarea sin que coexista simultáneamente un contrario que se le opone y que conforma, con ella, una contradicción dialéctica; este contrario está conformado, en el caso del aprendizaje, por las resistencias epistemológicas y epistemofílicas; y, en los procesos terapéuticos, por la resistencia a la cura. En un plano más general, en la medida en que todo aprendizaje y todo proceso terapéutico en un grupo constituyen por excelencia procesos de cambios cualitativos, la “resistencia al cambio” sería una expresión grupal de la resistencia, tanto en el sentido epistemológico como en el sentido terapéutico. Esta definición del grupo, en general, y del grupo operativo en particular, como realidades que poseen una zona de sombra que es constitutiva de su realidad y una dimensión conflictiva que es parte de su naturaleza, perfilan unos caracteres básicos que debe tener en cuenta todo psicólogo social, como profesional que se ocupa de fenómenos grupales y sus malestares, y todo coordinador de grupo operativo en particular. Un coordinador de un grupo operativo ha de ser capaz de leer esos dos niveles de la actividad grupal y habrá de cumplir el rol de un facilitador al servicio de la tarea y del grupo. Una parte fundamental de esa tarea será ayudarle al grupo a explicitar lo implícito y así contribuir a la lucha contra la resistencia al cambio que se deriva de las ansiedades básicas que existen en todo grupo. A propósito del psicólogo social y su tarea, dice Pichón: “el campo de acción del psicólogo social es el de los miedos; su tarea es esclarecer su origen y el carácter irracional de los mismos, los que en última instancia pueden ser reducidos a dos: el miedo a la pérdida y el miedo al ataque”41 . Luego, en el mismo artículo, refiriéndose concretamente al grupo operativo, dirá: “hay entonces un interjuego permanente entre el miedo a la pérdida de lo ya conocido y el miedo al ataque de 41 “El Psicólogo Social”. Citado en Diccionario de términos y conceptos de psicología y psicología social. Ibíd. Pág. 120.
  • 51 lo que puede venir. El interjuego de estas dos situaciones rige todo, son los universales esenciales de la tarea en el grupo operativo”.42 Esta dimensión de la tarea del coordinador en el grupo operativo, que consiste en ayudar al grupo a explicitar lo implícito, tiene que ver con una dimensión de la tarea del grupo, como conjunto, que va en esa misma vía, a afrontar las formas particulares que adoptan los miedos básicos frente a cada momento de la tarea, para desactivar las resistencias al cambio que surgen justamente de ellos. Esta es quizás la dimensión fundamental de la tarea que el grupo no puede cumplir sin ayuda del coordinador. Justamente, porque una tramitación adecuada de estas ansiedades básicas es condición para que un grupo pueda asumir de lleno la tarea, es que Pichón dice que la tarea del coordinador está en la pretarea del grupo. 3.1.2. Tres dimensiones de la tarea: el trabajo, la obra y la representación meta El término tarea tiene tres dimensiones que se pueden constatar en la experiencia cotidiana y que también podemos localizar con claridad en la obra de Pichón Rivière. La tarea como trabajo remite a la actividad grupal, el quehacer del grupo en sus dimensiones manifiesta y latente, en su lucha con las resistencias y en el proceso de transformación grupal y de cada uno de los integrantes. La tarea como obra remite a la tarea realizada; en la terminología de Pichón esto implicaría el atravesamiento de las tres fases: pretarea, tarea y proyecto; y, la culminación del proyecto en una obra. Cuando esto ocurre, si el grupo no logra relanzar la tarea o articularse en función de otra tarea y otro proyecto, puede ocurrir que cambie el centro gravitacional del grupo, o que el grupo se disuelva. La obra no hay que pensarla necesariamente de acuerdo con los parámetros del eficientismo porductivista. Nada más lejano de la concepción de la productividad grupal de Pichón Rivière. Una de las dimensiones fundamentales de la operatividad y la productividad de un grupo, para el autor, está en función de las transformaciones que se operen en los esquemas referenciales de los integrantes y de la modificación del ECRO grupal. La obra de un grupo puede ser algo tan intangible como la reconfiguración de un grupo familiar que le permita afrontar sus ansiedades básicas, sin endilgarle esa tarea a uno de sus integrantes, o el proceso de aprender a aprender en los grupos de formación. La tercera dimensión de la tarea es su condición de representación meta −empleando la noción de Freud−, es decir, como significante que sirve de horizonte al deseo del grupo. En tal calidad opera como organizador grupal y tiene un lugar fundamental en el momento de la constitución de un grupo operativo y en las demás fases, en la medida en que sirve como una especie de brújula que oriente el trabajo del grupo. 3.1.2.1. La tarea entendida como trabajo 42 Ibíd.
  • 52 Se trata de una dimensión enormemente rica en significación. Hablar de un grupo centrado en la tarea es hablar de un grupo centrado en el trabajo. Y situar el trabajo como el centro de un grupo es colocar en el centro mismo de la actividad grupal aquello que constituye el principio mismo de la humanización. Según Hegel, es en y por el trabajo que el siervo se humaniza y alcanza el estatus de humano antes que el amo mismo43 . La cultura, en el sentido más global de la palabra, podríamos entenderla como un grupo centrado en una tarea. El humano es un ser que se define por su relación al trabajo y en ese hacer se construye como ser. Hablar de un grupo centrado en la tarea implica, por definición, que no será un grupo centrado en los amores o en los odios, y que aunque estas pasiones siempre están presentes en los grupos, la tarea constituye en sí misma un espacio para la dialectización y la elaboración de esta dimensión de lo humano. Así la tarea opera como un tercero que garantiza un elemento de estabilidad grupal. En su artículo “El empleo del trofanil en la psicoterapia individual y grupal”, Pichón lo muestra de una manera muy clara: “el campo de la tarea tiene por base una situación triangular, debiendo comprenderse e interpretarse el vínculo transferencial dentro de este contexto”. Este comentario del autor nos pone, además, sobre la pista del papel que cumple la tarea como una terceridad, que introduce un elemento de movilidad de los roles de los integrantes de un grupo; roles que se inmovilizan hasta estereotiparse si no existe esta función de terceridad de la tarea, que permite dialectizarlos. Habría que decir que cuando la tarea, entendida como trabajo, se constituye en el centro para un sujeto o un grupo, comporta una dimensión de enajenación que presenta dos costados opuestos: de un lado es una enajenación positiva y necesaria para devenir humanos, es decir humaniza, confiere la dignidad de lo humano, le permite al sujeto y al grupo hacerse a un ser en tanto que trabajadores y en ese sentido ser partícipes de la obra de la cultura. La tarea también puede tener una dimensión enajenante, en el sentido negativo de esta palabra, cuando se constituye en una actividad mecánica y repetitiva que no está en concordancia con el deseo del sujeto o del grupo y no les permite transformarse y crear. Es uno de los problemas fundamentales que introduce en el mundo la división del trabajo propia del capitalismo. 3.1.2.2 La tarea entendida como obra. Ya enunciamos que en el ECRO de Pichón Rivière, la producción grupal tiene una dimensión fundamental que está en relación con los procesos de aprendizaje y comunicación que se dan en el interior del grupo, y con las consecuentes transformaciones del esquema referencial grupal y de cada uno de los integrantes. Esta dimensión de la tarea se refiere a cambios cualitativos en la perspectiva del aprender a aprender y de la desalienación de ideologías que funcionan al servicio de la protección contra los miedos que obstaculizan el trabajo grupal. El afrontar y, 43 Cf. Kojève Alexandre, La Dialéctica del amo y el esclavo. Buenos Aires: Siglo veinte.
  • 53 a cada paso, ir venciendo la resistencia al cambio por parte del grupo, deviene en una producción grupal en la medida en que opera transformaciones en el grupo y en cada uno de los integrantes. En suma, las transformaciones subjetivas y los procesos que se operan en los integrantes del grupo pueden ser más importantes como producto que la materialización del trabajo grupal en alguna obra concreta. Recordemos que Pichón vincula íntimamente la noción de tarea con los procesos terapéuticos y de aprendizaje: “La tarea consiste en resolver las situaciones estereotipadas y dilemáticas que surgen de la intensificación de las ansiedades en la situación de aprendizaje, ya no solamente en el tratamiento con psicóticos, sino en la situación de aprendizaje que para nosotros tiene una gran analogía con la anterior ya que entendemos la dificultad de curarse o la resistencia a curarse, como perturbaciones del aprendizaje... Entonces hacemos del grupo operativo un grupo tan terapéutico como puede serlo cualquier otra técnica, por el hecho de que permite aprender”. 44 Darle toda la importancia a esta dimensión subjetiva, vincular y de construcción de tejido social del grupo operativo, no excluye, por supuesto, la otra dimensión más fáctica de la tarea: que el producto de un grupo operativo también puede materializarse en una obra que pueda separarse del grupo y perdurar independientemente de él. De acuerdo con esta perspectiva, la tarea, entendida como obra concluida −así sea parcialmente−, puede ser una actividad académica o una publicación −si se trata de un grupo operativo en función de la formación profesional−; si se trata de un grupo comunitario que trabaja en función de la resolución de una necesidad de infraestructura barrial, puede ser una obra material, etc. 3.1.2.3 La tarea como representación meta Esta es una dimensión intangible de la tarea. No es observable en tanto actividad grupal como el trabajo, ni constatable en tanto que transformación producida, como la obra. Sin embargo, de las tres dimensiones, es la más determinante, en la medida en que opera como el elemento que orienta el deseo del grupo. Podríamos decir que las dos dimensiones anteriores de la tarea tienen el carácter de una presencia, mientras que esta tercera dimensión tiene el carácter de una ausencia, que opera como causa del trabajo grupal. Cuando un grupo se formula una tarea como aquello que aspira a realizar, está situando una falta como principio organizador que va a regir su quehacer. La tarea, en su calidad de representación meta, podemos situarla como una falta que causa el trabajo grupal. Tomando los ejemplos mencionados, si un grupo comunitario define como tarea la construcción de una obra de infraestructura, es porque consideran que esa obra falta, y en ese sentido la falta de esa obra opera como causa del trabajo del grupo. Lo mismo sucede con el grupo de formación que define como tarea hacer una publicación. 44 Pichón Rivière E. Historia de la técnica de los grupos operativos. Citado en Diccionario de términos y conceptos de psicología y Psicología Social. Joaquín Pichón Rivière y Otros. P, 24.
  • 54 Si una fantasía de completud se llega a apoderar de un grupo (ilusión de “tenerlo…todo”), esto puede tener efectos inmovilizadores, incluso puede conducir a los fenómenos de cierre y de estereotipia más radicales. Esto ocurre con ciertas castas sociales y en ciertas élites del mundo académico que logran crear un gueto que monopoliza algún campo del saber y que puede terminar produciendo un empobrecimiento grupal y un deterioro progresivo. También puede ocurrir lo contrario, la experiencia de la falta puede llegar a exacerbarse tanto en un grupo, que se constituya en un emblema que dificulte la operatividad grupal; esto ocurre con algunos grupos cuya identidad se constituye en torno a algún significante de la falta, sea ella material o simbólica. Un grupo puede instalarse de manera temporal o duradera en la identificación con una falta radical en virtud de una pérdida fundamental real o imaginada, y convertirla en un obstáculo fundamental contra cualquier posibilidad de trabajo y transformación; esto puede ocurrir en cualquier escenario: familiar, académico, laboral, comunitario, y es muy peligroso. Tenemos entonces que “la falta de la falta”, es decir una pretendida plenitud, puede paralizar la productividad grupal; y, que una identificación del grupo a la falta, en virtud de la exacerbación o exaltación de la misma, también puede ser un obstáculo para el trabajo de un grupo. Podríamos decir todavía algo más sobre la relación de la tarea con la falta. La tarea, en su calidad de representación meta que opera como la falta que causa el trabajo de un grupo, no sería, en sentido estricto, una ausencia, ya que una representación, aunque su materialidad no sea otra que la de un sonido o una imagen, de todos modos constituye una presencia. Así, podríamos definir más rigurosamente la tarea, en tanto que representación meta, como “la presencia de una ausencia”. Este desdoblamiento de la tarea en estas tres dimensiones, nos permite trascender su dimensión empírica y abordar su dimensión significante. Aunque ni Pichón ni Freud usan el término significante, el concepto de representación de palabra, que es otra manera de decir significante, es imprescindible para pensar el inconsciente de Freud y el vínculo social de Pichón. Una tarea puede operar como significante, en el sentido más riguroso que Lacan le da a la noción de significante, es decir, “aquello que representa a un sujeto para otro significante”, y en este caso la noción de sujeto no hay que confundirla con la individuo, un grupo puede operar como un sujeto. Así, una tarea puede funcionar como un significante en la medida en que representa a un sujeto –individuo o grupo- para los otros. Estamos hablando en este caso de la tarea como representación meta, por ejemplo, aquella que en las organizaciones se expresa en “la misión institucional” y en los individuos se expresa en su proyecto vital. Por Freud y Pichón sabemos que en ambos casos hay una dimensión manifiesta y una dimensión latente. Las instituciones, los grupos y los individuos, suelen ser representados ante los otros –instituciones, grupos o individuos- por la representación meta que, como tarea, les define un lugar en el mundo.
  • 55 Pero la tarea no solamente opera como significante en su condición de representación meta, la tarea como trabajo tiene una función significante fundamental en la medida en que opera como un tercero que, según Pichón, triangula, es decir regula y ordena los vínculos entre los humanos. Finalmente, la tarea como obra, puede ser también un objeto de intercambio de un sujeto o un grupo con otros, es decir un elemento puesto en función de la construcción de vínculos sociales y un elemento que le sirva al grupo o al sujeto para hacerse representar ante otros grupos y en virtud de ello, hacerse a un lugar en el entramado social. A continuación abordaremos la tarea en su dimensión significante a la luz de una de las cuatro estructuras que propone Lacan para pensar los vínculos sociales: el discurso del amo. 3.1.3. Un grupo es una urdimbre significante La realidad de los grupos es siempre cambiante, en mayor o menor grado, de acuerdo con el grupo; ningún grupo puede pretender permanecer idéntico a sí mismo. En general los fenómenos de cristalización y estereotipia constituyen síntomas grupales. El cambio es, podríamos decir, parte de la esencia misma de los grupos. Aún con los mismos integrantes, la misma tarea, el mismo lugar, etc., un grupo es cada vez una realidad distinta que, en cada momento llama a ser leída en su particularidad. Esto se debe a que los grupos humanos están organizados como sistemas significantes. Lo que caracteriza al significante es que su relación con el significado no es necesaria sino arbitraria, ello hace que a un mismo significante se le pueda encontrar cada vez articulado con un significado distinto. Esto tiene efectos importantes para la realidad psíquica de los seres humanos y para la constitución de nuestras tramas vinculares, ya que los significantes en los que se enhebra nuestro ser y que determinan nuestro lugar en los distintos entramados grupales a los que pertenecemos, no nos garantizan un lugar, un valor o un sentido estables. La movilidad permanente del valor y el sentido de unos significantes a otros, caracteriza todos los sistemas simbólicos que están estructurados como lenguajes. En virtud de ello, aunque un sujeto sea representado por un mismo significante (padre, profesor, gobernante, coordinador, etc.), eso no le garantiza que su lugar en la misma trama vincular (la familia, la institución, el estado, el grupo) sea en cada momento el mismo, ni mucho menos que tenga resuelta la pregunta por su ser en ese contexto simbólico de manera permanente. Así mismo, los significantes que nos representan a los seres humanos en una trama vincular determinada, no nos sirven en otra. El significante “padre”, que representa a un hombre ante sus hijos en el hogar, no le sirve cuando llega a la empresa; allí tiene que apelar al significante correspondiente a su cargo, por ejemplo, “jefe de recursos humanos”; pero, a su vez, ese mismo significante, lo sitúa en una posición distinta cuando está frente a un obrero, cuando está ante el
  • 56 gerente de la empresa, o cuando está ante otro jefe de departamento. Otro tanto ocurre cuando va a la universidad, donde ya no es padre, ni jefe, ni subalterno, sino estudiante de maestría, por ejemplo. Pero, aún en cada una de estas tramas vinculares: la familia, la empresa, la institución educativa; aunque conserve el mismo lugar, el valor de ese lugar y el significado que le asigna como ser, varían según las circunstancias y según las vicisitudes de los vínculos con los otros. No es lo mismo ser padre o jefe en circunstancias normales que en una fiesta, donde hay una cierta licencia para subvertir los valores y los límites de los lugares. No es igual ser un padre admirado que un padre humillado. Los otros pueden no reconocer el lugar que un significante le confiere a un sujeto en determinada trama, o pueden tener una relación ambigua o ambivalente frente a ella. Por otra parte, puede ocurrir que un sujeto, a nivel consciente, pretenda sostenerse en una determinada trama vincular, en el lugar que le asigna el significante que lo representa (volvamos a los mismos ejemplos: padre, profesor, coordinador), pero, a nivel inconsciente, él mismo puede desear destituirse de allí. Por ejemplo, que su voluntad de sostenerse como padre, como jefe, o como coordinador, sea boicoteada sistemáticamente por un deseo inconsciente que lo lleva a producir respuestas correspondientes a lugares opuestos, en la misma trama (hijo, alumno, integrante anónimo del grupo). Es típico encontrar esto en ciertos neuróticos y produce efectos de muy diversa índole en cada uno de los sujetos que integran las urdimbres simbólicas a las que pertenecen: angustia, ambivalencia, apatía, compasión, odio... Todo grupo −incluido el grupo operativo− constituye una trama vincular que está articulada como una urdimbre simbólica, un orden significante. Los significantes no son solamente los que representan a los sujetos (coordinador, observador, integrante, líder, portavoz, chivo emisario, etc.). También hay otros significantes como grupo, tarea, emergente, operatividad, pertenencia, pertinencia, etc., que hacen parte del orden simbólico que constituye un grupo operativo. Incluso el curso y el programa en el que se inscribe el grupo operativo de un programa de formación de psicólogos sociales, la institución y la ciudad, entre otros, son significantes que pueden ser fundamentales en la trama simbólica que conforma dicho grupo. Cada uno de los significantes que constituyen un grupo operativo determinado, está cambiando de valor y de sentido según el momento grupal y según el lugar que en ese momento ocupen en relación con los demás significantes. La resultante de la combinatoria de los valores de los significantes, en cada momento grupal, es lo que puede dar una lectura del sentido de lo que ocurre en el grupo en ese momento. Esto sucede gracias a esa movilidad permanente del sentido y del valor entre los significantes que es propia de todo orden simbólico. 3.1.4. La tarea en el lugar del agente del discurso del amo La tarea es un significante fundamental en el grupo operativo. Como todo significante, no tiene un valor ni un sentido estables, sino que éstos varían de
  • 57 acuerdo con las permanentes reconfiguraciones de los elementos en el grupo. La tarea, como cualquier otro significante, puede llegar a significar casi cualquier cosa. En este capítulo abordaremos algunas variaciones de un sentido y un valor posibles de la tarea, cuando ésta se articula en el lugar del agente en la estructura que Lacan llama el discurso del amo. Recordemos que en el discurso del amo el significante que ocupa el lugar dominante es el S1, que Lacan llama significante amo; el significante que ocupa el lugar del otro es el S2, que es el significante del saber; en el lugar del producto estaría el objeto a minúscula; y, en el lugar de la verdad tendríamos el significante del sujeto dividido $. Agente → otro____ S1 → S2 Verdad ∆ Producto $ ∆ a El lugar del agente en el discurso del amo es la posición en la que cualquier significante convoca sus efectos de sentido más feroces, más totalitarios y más destructivos. Gracias a esta estructura vamos a poder observar las tres dimensiones que mencionamos de la tarea (el trabajo, la representación meta y la obra) operando en esta perspectiva. Quizá no sobra insistir en que la tarea como cualquier otro significante, no tiene un significado fijo ni inmutable, sino que en cada momento del grupo puede cambiar de sentido, incluso a lo largo de una misma sesión. Un ejercicio como este puede tener el valor de curarnos contra las idealizaciones que suelen construirse en algunas comunidades académicas en torno a ciertos significantes. La tarea es un significante fundamental para los grupos operativos, que despliega toda su potencia y operatividad cuando está operando en el lugar que le corresponde en estructuras vinculares como el discurso analítico y el discurso de la histérica, que son los más acordes con el dispositivo grupal inventado por Pichón, pero puede ser también un significante despótico, enajenante y productor de efectos destructivos si se articula en una estructura vincular como el discurso del amo. Aunque por definición la dinámica del grupo operativo es diametralmente opuesta a la estructura vincular que Lacan denomina el discurso del amo, el valor que tiene esta reflexión sobre la tarea en el lugar del agente del discurso del amo radica justamente en mostrar que, gracias a esa movilidad del sentido y el valor en las urdimbres significantes que habitamos los humanos, un significante como la tarea también puede llegar a operar como un amo feroz, y que, cuando ello ocurre, un grupo operativo puede llegar a desvirtuarse hasta convertirse en lo más opuesto a su especificidad. En otras palabras, este capítulo, en el que vamos a ver operando la tarea en el lugar del agente del discurso del amo, nos va a servir, ante todo, para observar perversiones en el funcionamiento del grupo operativo. En ese sentido, constituirá
  • 58 una herramienta muy útil para los coordinadores y los psicólogos sociales en formación, en la medida en que les advertirá que, por más democrática y participativa que sea la concepción de un dispositivo de trabajo grupal, por más que esté diseñado en función de limitar los efectos de poder de los dispositivos tradicionales y de liberar a los sujetos de las diversas formas de enajenación, esto no lo inmuniza contra el peligro de desvirtuarse y terminar operando al servicio de alguna forma de tiranía. Un significante amo es un imperativo absoluto. La tarea entendida como trabajo en el lugar del significante amo, nos remitiría en primera instancia a una manía por el trabajo, entendido el trabajo en este caso, no como un medio, sino como una compulsión irreflexiva, es decir, en su dimensión más sintomática. En esta primera perspectiva, la tarea en el lugar del agente del discurso del amo nos remitiría a una versión absurda del quehacer de un sujeto o un grupo, que se podría expresar de una manera tautológica como “el trabajo por el trabajo”. La adicción al trabajo sería una de sus expresiones más patéticas. La tarea en tanto que producto, es decir, entendida como obra terminada, como un significante en el lugar del agente, nos remitiría al productivismo, ya no irreflexivo sino subordinado a la obtención de rendimientos. Esta versión de la tarea, operando en el lugar del agente, estaría en la vía del auténtico espíritu capitalista, remitiría al eficientismo más puro en términos de utilidad, es decir de plusvalía. La tarea, en tanto que representación meta, operando como significante amo en el lugar del agente del discurso que lleva ese nombre, nos remite a la tiranía de una representación que se yergue ante el grupo como un amo absoluto que reclama sumisión. La tiranía en el campo de las representaciones es común encontrarla en la subjetividad individual y en la vida grupal del lado de las idealizaciones. En este punto es importante subrayar una diferencia, en apariencia sutil, pero de consecuencias decisivas, entre los ideales y las idealizaciones. Toda idealización tiene en su base un ideal, pero no todo ideal deviene una idealización. El ideal, en el sentido más general, es una representación meta que orienta el querer ser del yo, a nivel consciente; también hay ideales inconscientes que orientan el deseo, sin que el yo lo sepa. Los ideales, por definición, son ideas: la belleza, el talento, la inteligencia, el prestigio, el poder, la felicidad, la justicia, la paz, el amor... pero pueden encarnarse en personas que se convierten en referentes para el sujeto y pueden devenir objetos de amor y de identificaciones. El vínculo de cada sujeto con sus ideales puede ser de muy diversa índole, puede ser benigno y permisivo, puede incluso exhibir un componente importante de ambigüedad y, no pocas veces, presenta altas dosis de ambivalencia. En general, podemos decir que la relación de cada sujeto con sus ideales es cambiante y, en algunos casos, acomodaticia de acuerdo con las circunstancias.
  • 59 Algo semejante podría decirse acerca de los grupos humanos, cada grupo tiene sus ideales colectivos, en el caso de las instituciones estos ideales están consignados en la misión y en los principios que las rigen; es frecuente que la tarea de una institución o un grupo se articule en torno a uno o varios ideales. Cuando un ideal se vuelve tiránico, se convierte en una idealización. No todos los ideales son tiránicos, pero toda idealización funciona como una forma de tiranía. En la idealización el ideal pierde su plasticidad, se petrifica en una imagen absoluta que opera como un amo implacable en relación con el sujeto o el grupo. La tarea, en tanto que representación meta, operando como una idealización en el lugar del agente del discurso del amo en un grupo operativo o en un grupo de cualquier otra clase, sería algo así como “la Idea”, con mayúscula, que puede tomar la forma de la “Verdadera Causa”, el ideal absoluto que reclama el sacrificio y la entrega incondicional de los integrantes. Hay ciertos ámbitos grupales, como los religiosos y algunas militancias políticas y académicas, en los que se puede observar de una manera nítida este fenómeno; pero cualquier tarea, entendida como representación meta, puede funcionar para un grupo o para un sujeto, de manera permanente, o en algún momento del acontecer grupal, como una idealización y por lo tanto como una tiranía. Cuando una idealización opera como la representación meta que nombra la tarea del grupo, nunca hay trabajo del grupo que sea suficiente respecto de lo que debería hacerse; el grupo siempre estará en déficit, pero felizmente unido; y, en cierta manera, se puede considerar “privilegiado” como grupo elegido para la “Gran Tarea”. Cualquier interrogación de uno de los integrantes del grupo sobre la verdadera pertinencia de la tarea, o sobre la desmesura del trabajo impuesto al grupo, será vivida por los demás integrantes como una amenaza que dispara toda clase de ansiedades persecutorias, que se tratan de conjurar aislando o estigmatizando al integrante que interroga, como un conspirador, una especie de enemigo interno. Ya mencionamos las versiones que pueden encontrarse de cada una de las tres acepciones del significante “tarea” (trabajo, representación y obra) cuando este significante opera como agente del discurso del amo. Vamos a ver ahora los efectos que tiene la tarea como significante dominante en el discurso del amo sobre los demás significantes que conforman esta estructura discursiva: “el otro”, “el producto” y “la verdad”. 3.1.5. El grupo en el lugar del otro del discurso del amo. Recordemos que el significante que está en el lugar del otro en el discurso del amo es el S2, el significante del saber, que en este caso se entiende como el saber hacer del siervo, es decir ante todo como una actividad al servicio de un producto que será objeto de goce del amo, o al servicio de la producción de un plus de goce, una de cuyas formas puede ser la plusvalía “a”. La verdad que está en la base de esta operación es el significante de la división subjetiva “$”, que en
  • 60 este discurso en particular se puede leer como la castración del amo, como síntoma, o como malestar. S1 → S2 $ ∆ a Si pensamos en la tarea operando como significante amo, bien sea bajo la forma de un activismo irreflexivo y absurdo, o bajo la forma de un productivismo enajenante, o de una militancia al servicio de un ideal convertido en tiranía, el significante que estaría en el lugar del otro sería el grupo mismo (al fin y al cabo se trata de un grupo centrado en la tarea). El grupo operaría al servicio de la producción de un plus para el amo. Lugares: Símbolos: Significantes: Agente → otro S1 → S2 Tarea → grupo Según cuál de las tres versiones de la tarea sea la que está operando en el lugar del amo, el grupo en su condición de otro, presentará diversos matices. Por ejemplo, si el significante que opera como tarea es una idealización que se presenta ante el grupo como verdad absoluta que reclama la entrega irrestricta, el grupo tomará el matiz de una secta, o de un grupo de fanáticos dispuestos a inmolarse; si el significante que opera en el lugar de la tarea es la productividad, entendida como la eficiencia capitalista, es decir el máximo rendimiento, el grupo tomará el matiz de una grey de esclavos modernos, bien explotada. El tercer caso es un poco más difícil de pensar para los grupos pequeños: se trata de aquellos casos en los que el significante que opera como tarea es el imperativo sordo del trabajo por el trabajo. Esto se puede observar con alguna frecuencia en el campo individual, en ciertos neuróticos y, de una manera más clara, en ciertos psicóticos; incluso hay grupos humanos que presentan como uno de sus rasgos distintivos un cierto fanatismo por el trabajo y que incluso lo pueden exhibir como un emblema, pero se trata sólo de un matiz que difícilmente llega a ser dominante. En el campo de los grupos pequeños es difícil encontrar versiones de este fenómeno. Sin embargo, hay muchos grupos, incluidos grupos operativos, que aunque tengan una racionalidad que los rige, pueden entrar en ciertos períodos en esta lógica del hacer por el hacer mismo. Son períodos en los que se pierde la perspectiva del verdadero propósito del grupo, o de los fines que busca; y que pueden ser épocas de intenso trabajo y desgaste. 3.1.6. “a” en el lugar del producto del discurso del amo “a”, como producto del discurso del amo también puede tomar diferentes matices, según cuál sea la dimensión de la tarea que abordemos. El caso más simple es, por supuesto, la tarea como consigna del eficientismo, entendido en el más craso espíritu capitalista, como la máxima productividad en el mínimo de tiempo, con el mínimo de inversión. La “a”, en este caso, en tanto que producto, toma la forma de
  • 61 la plusvalía, es decir de los rendimientos, un goce susceptible de ser medido, comparado, acumulado e intercambiado. En esta perspectiva estarían los grupos altamente competitivos. El precio de esta eficiencia en un grupo operativo sería la enajenación grupal en la dimensión manifiesta de la tarea. Esa enajenación grupal sería justamente la que lo asemeja a una grey de esclavos modernos, es decir, asalariados. Quizá en este punto sea importante subrayar que el grupo operativo se opone a la lógica capitalista. Por su concepción y sus fines, la productividad grupal en este dispositivo no depende de la eficiencia, sino en función de las transformaciones de los ECROs de los integrantes, entendidos como las maneras de pensar, sentir y hacer de cada uno. Estas transformaciones suponen, en cada grupo, procesos de aprendizaje de nuevas formas de aprender, de comunicarse y de relacionarse, vencer las resistencias, afrontar ansiedades. Todo esto produce en los integrantes y en el grupo como conjunto, efectos terapéuticos, aunque la tarea del grupo no esté definida en función de la terapia. Por ello, aunque el ECRO de Pichón Rivière, como instrumental de lectura de fenómenos grupales, ha mostrado su fecundidad y su potencia en el escenario de las organizaciones productivas, y el grupo operativo se usa ocasionalmente en este ámbito, su lugar allí no está al servicio de la producción de plusvalía, sino al servicio de la salud mental. Lugares: Símbolos: Significantes: Agente → ___otro_____ S1 → S2 Eficientismo→Grey de siervos Producto “a” Plusvalía Una versión diferente del objeto “a” obtenemos como producto, si la versión de la tarea que opera como dominante de la estructura es una representación transformada en ideal tiránico. Ya el goce que constituye el producto no es un rendimiento que se puede usufructuar, sino un goce de otra naturaleza más inquietante, que en el furor extremo de una secta o un grupo de fanáticos enardecidos, puede coincidir con el exterminio físico o la devastación material de aquello que se opone al significante que opera como verdad revelada al grupo y que como parte de ese goce también puede contabilizar la inmolación de los seguidores de la verdad de la secta; pero también puede tener versiones matizadas que pueden adoptar la forma de las diversas modalidades de segregación de minorías sociales, que suelen producir los grupos a los que les ha sido revelada cualquier forma de verdad absoluta; o, también, las formas más sutiles de segregación de mayorías que producen las élites que se autorizan a sí mismas como depositarias de alguna forma de la pureza en un campo del saber o alguna práctica social. En todos estos casos podemos decir que el grupo funciona al servicio de la producción de un goce al servicio del ideal tirano. La tiranía de los ideales (convertidos en idealizaciones) en el campo social, siempre produce como efecto de goce, un efecto de exclusión, que puede ser más o menos radical y que
  • 62 en el extremo puede coincidir con la eliminación definitiva del diferente o de sus significantes45 . En los grupos o instituciones pequeñas, también podemos encontrar idealizaciones operando como amos en el lugar dominante de la estructura. Pueden producir como efecto de goce la periódica expulsión de alguno o algunos de sus integrantes, como una especie de residuo de su permanente operación de “depuración” interna, que puede ser exhibida por el grupo como un emblema de sus altos niveles de exigencia, de su capacidad de autopurgarse, o de sus procesos periódicos de limpieza de la casa. Otra modalidad de goce puede expresarse en el mantenimiento, en su interior, de un subgrupo satanizado que contribuye de manera indirecta al mantenimiento de la idealización que opera como amo del grupo, por la vía de hacerlo objeto, periódicamente, de sanciones ejemplarizantes. Es el caso de los pequeños grupos de transgresores en las instituciones con regímenes disciplinarios severos. Cuando un grupo operativo está temporalmente bajo el régimen de una poderosa representación idealizada, es fácil que el grupo produzca sistemáticamente chivos emisarios de esta clase, que se convierten en los depositarios del mal del grupo, la causa que impide al grupo acercarse al ideal. El chivo expiatorio está destinado a convertirse en un desecho con el que el grupo goza. Lugares: Símbolos: Significantes: Agente → __otro_______ S1→S2 R. idealizada → Secta de fanáticos Producto “a” Segregación El tercer caso, en el que la tarea opera como dominante de la estructura bajo la forma del imperativo de “el trabajo por el trabajo”, el producto es la basura. La lógica es impecable en este caso: si el sentido del grupo se agota en el trabajo, en la medida en que este opera como un fin en sí mismo, el producto de este trabajo, independientemente de sus atributos de excelencia, es de antemano un desecho. En un plano general, es lo que ocurre en cualquier economía cuando la maquinaria productiva se enloquece y produce más de lo que el mercado demanda: algunas empresas tienen que destruir sus inventarios o desecharlos para impedir un desplome de los precios. En otro orden de ideas, un paradigma de una institución en la que siempre hay actividad en el sentido de trabajo y donde el producto es un desecho son las fuerzas armadas, el desecho es de distinta naturaleza en tiempos de paz y en tiempos de guerra, pero siempre es un desecho. 45 El ejemplo más reciente y más infame es la quema de la Biblioteca principal de Bagdad, con sus seis mil años de historia de la humanidad, por parte de las tropas estadounidenses e inglesas. Este hecho se produjo una semana después de que habían cesado los combates en la capital de Irak, cuando la ciudad estaba bajo control de los ejércitos invasores que se habían tomado el país en nombre de la democracia.
  • 63 En las instituciones pequeñas y en los grupos pequeños, ocurre otro tanto: si en un grupo el imperativo del activismo superyoico, “el hacer por el hacer”, se yergue como un amo, el producto de ese hacer puede ir desdibujándose hasta perder todo sentido y se puede convertir en cualquier cosa. Así los analistas de las organizaciones suelen encontrar instituciones de diversa índole que entran en la lógica de una especie de campo de concentración o de campo de trabajos forzados, en el que puede incluso producirse alguna plusvalía, pero ésta no es lo más importante, ya que el trabajo está puesto en función de la mortificación de los integrantes del grupo. En estos casos, los ideales y los beneficios mismos pueden convertirse en la coartada tras la que se oculta esa otra dimensión radicalmente enajenante del trabajo, en la que opera como una forma de tortura colectiva. Cuando una lógica mortífera de esta clase se apodera de una organización provoca un desgaste mucho mayor del personal, que contrasta con una escandalosa ineficacia de la organización, desde el punto de vista de su objeto social. En un grupo operativo puede ocurrir que se apodere de su dinámica un productivismo sintomático de esta clase. Un coordinador inadvertido puede apresurarse a celebrar e interpretar ese estado de actividad maníaca del grupo como una efusión de cooperación de los integrantes, etc., pero puede tratarse de un productivismo sintomático y vacío, que le sirve al grupo como una modalidad de goce superyoico. Cuando algo así ocurre en un grupo operativo, el producto, independientemente de su aparente pertinencia, es un desecho. Una enajenación sistemática en la dimensión manifiesta de la tarea, puede ser un signo de que la tarea ha entrado en una lógica de esta clase. La basura es otra de las formas del objeto “a”. Lugares: Significantes: Agente → __otro__ Imperativo del trabajo → Campo de trabajo forzado producto Basura 3.1.7. “$” en el lugar de la verdad del discurso del amo Sabemos que el significante que está en la base de la estructura vincular que constituye el discurso del amo, es el significante del sujeto dividido: “$”, que también lo podemos leer como el significante de la castración, como el significante que remite lo sintomático; o, de una manera general, en el plano colectivo, lo podemos leer como un síntoma social, puede ser un síntoma grupal o institucional; y, de una manera más amplia, lo podemos leer como el significante del malestar en la cultura. Cada una de las versiones de la tarea, operando como significante amo, nos arrojará, a su vez, una versión particular de este significante que iluminará uno u otro costado del mismo. Vamos a iniciar por la tarea entendida como representación idealizada operando en el lugar del agente. Ya sabemos que el efecto que produce sobre el grupo es
  • 64 convertirlo en una suerte de secta y que el producto de goce que arroja tiene la dimensión destructiva de las diversas formas de segregación. La verdad de las representaciones idealizadas es la existencia de la idealización misma, no algo que tenga que ver con la esencia de la representación que se idealiza. En cierto sentido se puede decir que casi cualquier representación puede ser objeto de idealización, basta con que posea el rasgo requerido por el grupo o el sujeto, para que tal representación se sostenga allí en el lugar del ideal hasta que no sea necesaria. Esto nos lo muestra hasta la saciedad la psicopatología de la vida cotidiana en el campo del amor y Freud lo muestra a propósito de la relación de los pueblos primitivos con sus Dioses y sus príncipes, en su texto Tótem y tabú. La experiencia del desenamoramiento le revela al amante, ya liberado del hechizo, que los atributos ideales que veía en el objeto no pertenecían a él, sino que le eran conferidos por efecto de la idealización propia del amor. Freud nos muestra en Tótem y tabú la feroz ambivalencia que está en la base de la construcción de representaciones idealizadas en los grupos humanos; y, de qué manera, la corriente hostil de esta ambivalencia se hace valer tan pronto el objeto idealizado deja de cumplir su función, o desilusiona al grupo. Esto se puede ver, también de una manera palpable, en la relación de los fanáticos de un equipo de fútbol con sus estrellas. Podría decirse que de lo idealizado a lo execrado, puede no haber sino un paso. Ese paso tiene que ver con el cambio de signo de la ambivalencia, de acuerdo con las contingencias individuales o grupales. Por ello, la pregunta por la verdad de la aparición de una representación idealizada, operando como significante amo en el lugar del agente de una estructura vincular, debemos remitirla a la necesidad del grupo o del vínculo, antes que tratar de hallarla en una propiedad de la representación misma. La pregunta que debemos hacernos en este caso es: ¿qué ocurre en un grupo o en un sujeto, para que sea llamada una representación a operar como una Idealización-amo? Lo que nos puede responder la dinámica de cualquier grupo y la historia de la humanidad es que la idealización y el terror suelen ir de la mano, en otras palabras que toda idealización tiene como correlato una liberación de la pulsión de muerte que se dispone a dirigirse contra lo que se oponga al ideal, incluso a lo que simplemente difiera de él, e introduce una lógica paranoide que fácilmente desata en el grupo la fantasía del enemigo interno. En nombre de los ideales de pureza suelen desplegarse los odios más irracionales: la religión del amor en los piadosos cruzados, el estado proletario en los militares estalinistas, la pureza de la raza aria en el nazismo. Este fenómeno también se puede observar en las instituciones que operan en nombre de ideales absolutos y en toda clase de grupos. En un grupo operativo todo coordinador debe estar atento a los coeficientes de agresión que se liberan cuando éste está bajo el gobierno de una representación idealizada. Un coordinador debe poder seguirle la pista a esta agresión y
  • 65 determinar si el grupo termina endilgándosela a alguno o algunos de los integrantes del grupo, o si la dirige hacia un objeto externo al grupo. Esta versión del discurso del amo la podemos representar de la siguiente manera: Lugares: Símbolos: Significantes: Agente → ___Otro__ S1 → S2 R. Idealizada → ___Secta______ Verdad ∆ Producto $ ∆ a Odio ∆ Segregación Cuando el significante de la tarea opera en el lugar del agente del discurso del amo como imperativo categórico de “el trabajo por el trabajo mismo”, podríamos decir que el grupo se haya bajo el efecto de un ferocidad superyoica, que encuentra en la compulsión al trabajo una forma de goce en la mortificación, al mejor estilo de la metáfora bíblica del “sudor”. Cuando el imperativo del trabajo está al servicio de una necesidad de mortificación del grupo o del sujeto, uno de los primeros signos que se vuelve notorio para cualquier observador es su carácter, a la vez compulsivo y displacentero. Lugares: Significantes: Agente → Otro Imperativo del trabajo → Campo de trabajo forzado Verdad ∆ Producto Ferocidad superyoica ∆ Basura Cuando la tarea opera como significante dominante en el lugar del agente del discurso del amo bajo la forma de la consigna de la “eficiencia”, y esta eficiencia es entendida como la producción de alguna forma de bienes o servicios, el grupo queda colocado en la posición de una grey de siervos. La producción grupal en esta modalidad vincular suele ser alta en términos de los rendimientos, pero el precio de la alta eficiencia grupal es la enajenación del grupo respecto de su producto, el cual puede llegar a circular socialmente como cualquier otra forma de mercancía. La verdad de esta operación es la existencia de un síntoma grupal gracias al cual se enajena un grupo en función de la producción de rendimientos. Este síntoma puede exhibir diversas formas. Uno de los síntomas que con mayor frecuencia contribuyen a disparar la eficiencia de los grupos hasta el vértigo es la rivalidad imaginaria con otros grupos semejantes. Esto lo saben muy bien los psicólogos organizacionales expertos en diseño de estrategias para incrementar la productividad en las empresas. Una seria amenaza de desintegración grupal también puede disparar una ansiedad en el grupo que derive en un llamado a la eficiencia, como forma de conjurar dicha amenaza. Una profunda fragmentación de los vínculos en el interior de un grupo, también puede encontrar en el llamado al productivismo una vía para silenciar un conflicto latente que el grupo decide eludir. Lugares Símbolos Significantes Agente→___Otro__ S1→S2 Eficientismo __→ Grey de siervos Verdad ∆ Producto $ ∆ “a” Síntoma grupal ∆ Rendimientos
  • 66 33..22.. LLAA TTAARREEAA EENN EELL LLUUGGAARR DDEELL AAGGEENNTTEE DDEELL DDIISSCCUURRSSOO UUNNIIVVEERRSSIITTAARRIIOO 3.2.1. La nueva tiranía del saber Lacan propone que el discurso universitario es una versión moderna del discurso del amo. Esto implica que debemos estar preparados para que una reflexión sobre la tarea en el lugar del agente del discurso universitario nos muestre una lógica vincular que no difiere fundamentalmente de la que ya analizamos en el capítulo sobre “la tarea en el lugar del agente del discurso del amo”, incluso en algunos aspectos puede ser idéntica; pero también exhibirá diferencias, que si bien pueden ser solamente de un mayor nivel de complejidad en la misma operación, nos pueden ayudar a arrojar una luz lateral sobre los fenómenos grupales, y nos permitirá observar mejor ciertos matices y relieves que no se ven tan claramente con la crudeza elemental del discurso del amo. Para entender correctamente la estructura vincular que constituye el discurso universitario, es indispensable empezar por situar claramente el lugar que tiene el significante que está en el lugar dominante y que le imprime su sello particular a este discurso: el significante del saber “S2”. El término saber tiene varias acepciones en la obra de Lacan, algunas de las cuales difieren radicalmente del sentido que tiene este mismo término para algunos epistemólogos, filósofos y, en general, para el sentido común del mundo académico. En la obra de Lacan, el saber aparece en algunos momentos como opuesto a la verdad, en otros como opuesto al conocimiento, en otros casos se puede encontrar referido a la genética, como el saber de los instintos, etc. Para efectos de esta reflexión vamos a tomar solamente aquellas referencias que nos permiten situar con claridad el lugar de este concepto en la batería conceptual de los cuatro discursos. En El Revés del Psicoanálisis, el saber tiene varias acepciones según cual sea el lugar que le corresponde en cada estructura discursiva. Por ejemplo, en el discurso del amo se trata de un saber de los siervos que es puesto al servicio de la voluntad de goce de un amo. Este saber puede, incluso, llegar a tomar la forma de un saber sobre el goce del otro, lo que le permite al siervo adelantarse al deseo del amo. En el discurso de la histérica veremos al saber en el lugar del producto, como el efecto de la incidencia de la histérica sobre el amo que le suscita el deseo de saber. Esta versión del saber puede ser la que más se aproxima al saber académico y al saber filosófico. En el discurso analítico vamos a ver al saber bajo una forma fascinante e insólita: un saber en el lugar de la verdad, un saber hacer sobre una práctica que tiene como condición, para el analista, simultáneamente destituirse de su saber y sostener la suposición de saber que le confiere el analizante, manteniendo claro que el saber está del lado de este último. Otra manera de aludir al saber en el lugar de la verdad es como un saber mítico que solamente puede articularse bajo la forma de un medio decir y que se sitúa en los
  • 67 límites de los demás saberes, allí donde ya no puede saberse más del amor, de la sexualidad y de la muerte. En el discurso universitario el saber está en el lugar del agente. Es decir el saber está operando como aquello que estructura el vínculo. En el sentido más general, esta versión del saber puede coincidir con el orden simbólico y operar como Otro (con mayúscula) para cada sujeto y para un conjunto social. Este saber, nos dice Lacan, es un “medio de goce”. Luego el mismo autor va a precisar su aseveración: “di en llamar saber al goce del Otro”. Esta mirada del autor nos hace dos advertencias importantes. La primera es que el gran Otro es gozón y la segunda que el saber no solamente puede ser un medio para el bienestar y el placer sino que también puede ser un medio de goce en la acepción mortificante y mortífera de este término. Se trata, ciertamente, de una dimensión del saber muy ajena a la idea común, según la cual éste sería siempre algo deseable, incluso liberador. Por el contrario, Lacan afirma que el saber en el lugar del agente del discurso universitario “muestra el núcleo de la nueva tiranía del saber”. Para poder entender más claramente esta dimensión tiránica del saber, es necesario mostrar la compleja relación del científico con el saber. En un sentido podemos decir que el saber es un producto de la ciencia y que la operación científica está justamente en función de producir saber. Más aún podríamos decir que un científico al igual que un filósofo, son tales, por su deseo de saber. Sin embargo, en otro sentido podemos decir que hay un aspecto en el que el saber se opone al pensar y al desarrollo de la ciencia. Más aún, podemos decir que la ciencia y la filosofía avanzan en contra y a pesar del saber, entendido como el saber establecido. Una ruptura epistemológica implica la ruptura con un saber previo. Así tenemos dos dimensiones del saber: en un caso aparece como lo deseable y en otro como aquello que hay que combatir −qué paradoja− para producir un nuevo saber. Cuando un saber se petrifica empieza a operar en la lógica de la repetición, contrariamente a la ciencia y la filosofía que operan en la lógica de la creación de nuevas articulaciones de sentido. El saber operando en la lógica de la repetición deviene una moral pseudocientífica, un conjunto de imperativos categóricos que invaden todas las esferas de la experiencia y terminan exacerbando el malestar en la cultura. Esta última dimensión del saber, que podríamos llamar un saber cosificado, es la que opera como una forma de tiranía en el lugar del agente del discurso universitario. Digámoslo de una manera simple. El saber racional, producto de la operación científica, opera en la cultura al servicio del sometimiento de los cuerpos y las almas, y reemplaza cada vez con mayor eficacia las formas desnudas de dominio de los amos, o las legitimadas en el discurso religioso. Bajo la forma del control y la manipulación, o bajo la forma de los imperativos del deber ser, (“porque está científicamente comprobado”) el saber de la ciencia es el amo moderno. Esta es la forma que ha tomado el gran Otro en nuestro tiempo, es un amo que somete “científicamente”, y que en la medida en que las ciencias se desarrollan, va volviendo más sofisticados sus mecanismos de sometimiento y control.
  • 68 Esta reflexión previa nos advierte que las distintas formas del lazo social que se articulan bajo la forma del discurso universitario, en su dimensión más manifiesta, operan bajo la lógica de la repetición de lo que ya se sabe, pero que el producto de esta misma operación, por su condición sintomática, es la condición de posibilidad para la ruptura de dicha lógica. 3.2.2. Tres versiones del saber como agente: el inconsciente, la cultura y el contrato social Si un agente interpela a un “otro” desde el lugar de aquél que tiene el saber (S2), en ese mismo acto, el “otro” queda colocado en el lugar de la falta (“a”), es decir, queda en la posición de quien carece de ese saber que el agente sí tiene. La verdad que está en la base de un vínculo tal, en el cual el agente se presenta como aquél que sabe; es, sin duda, una voluntad de poder encubierta, en otras palabras, un amo agazapado (“S1”). El producto de la modalidad vincular que se organiza bajo la forma de este discurso es siempre sintomático (“$”). Este carácter sintomático del producto tiene las dos dimensiones de todo síntoma: la condición de una anomalía, es decir algo que no marcha; y, a la vez, la virtud de ser el lugar privilegiado en el que se cifra una verdad fundamental sobre un sujeto. En este caso, ese sujeto puede ser individual o colectivo, es decir, puede ser un individuo o un grupo. Agente → __otro__ S2 → a Verdad ∆ producto S1 ∆ $ En un plano general podemos decir que una de las versiones del saber como agente es el inconsciente mismo, por ello una de las versiones fundamentales del discurso universitario es la constitución del sujeto deseante, como sujeto dividido por la acción del lenguaje. Recordemos que uno de los nombres que Lacan le da al inconsciente es justamente “el saber” (S2), un saber que no se sabe y que, sin embargo, nos determina. Ese saber inconsciente que nos tiraniza como un amo es una escritura, “está estructurado como un lenguaje”. Desde esta perspectiva podríamos decir que el sujeto dividido ($) es el producto de la incidencia del saber del inconsciente (S2) sobre el goce (“a”), entendido este último como goce pulsional perdido, que por acción del lenguaje es puesto a operar en las redes del deseo. La verdad de esta operación es la sujetación (S1) del humano al lenguaje. También, en un plano general, podemos decir que otra de las versiones del saber como agente, íntimamente vinculada con la anterior, es la cultura, entendida como un universo simbólico que determina los lugares posibles para los seres humanos inscritos en ella, y determina también las normas que regulan los vínculos entre estos lugares. Una expresión fundamental de este saber son las estructuras elementales de parentesco. Podemos decir con Lacan y con Lévi−Strauss que, así como el inconsciente, la cultura también está estructurada como un lenguaje. Si nos atenemos a esta definición de cultura, podríamos decir que no hay saber sin ley, en otras palabras, no hay S2 sin S1.
  • 69 Dicho de una manera simple, toda cultura está ordenada por un texto. Este texto puede tener múltiples versiones, en algunas culturas puede tener la forma de un mito cuyo soporte es la tradición oral, en otras puede ser un libro sagrado que opera a la vez como texto religioso e histórico. En otras culturas pueden existir, además, versiones laicas como las constituciones y las leyes. Estos textos fundantes, que operan como principios organizadores de los diversos grupos humanos, son síntesis del saber acumulado por cada complejo cultural. En las culturas modernas, estos saberes organizadores son objeto de permanente debate y revisión, en otras culturas permanecen invariables durante largos períodos de tiempo. Un saber tal, operando desde el lugar del agente sobre un conjunto humano, le traza a esa comunidad los caminos por los que discurrirán sus dichas y sus pesares, sus síntomas y sus curas, sus guerras y sus expresiones artísticas. La relación de cada cultura con sus textos fundantes es paradójica: estos textos son producto de la comunidad, son formas de saber acumulado por la tradición; y a la vez la someten. En ese sentido, puede decirse que todo conjunto humano estará siempre en falta respecto de sus textos fundantes. Siempre estos textos operarán sobre la comunidad como un “Otro” (con mayúscula), ante el cual la comunidad está en la posición de un “otro” con minúscula, como una especie de materia prima que es modelada de acuerdo con los designios de los Dioses o los legisladores supremos que tejen sus destinos. Como producto de esta operación emerge una forma de subjetividad particular ($), que tendrá las marcas propias que le imprime su respectivo complejo cultural. A ese conjunto de rasgos particulares, que le imprime a la subjetividad de un grupo humano el gran Otro de su respectiva cultura, Lacan lo llama “factor C”. También hay que decir que no hay complejo cultural sin síntomas, que toda cultura en cada época posee sus formas particulares de malestar y sus dispositivos para operar sobre ellos. Estos malestares son quizá lo más particular de la subjetividad de cada conjunto humano. Toda forma cultural conlleva inevitablemente un malestar irreductible derivado de la renuncia que impone a lo pulsional. Todas las culturas imponen restricciones a las pulsiones. No existe el “buen salvaje”. Así que la diferencia entre las culturas no radica en que unas producen malestar y otras no, sino en la clase de malestar que produce cada una y las formas de expresión y de trámite que tiene cada una para sus propios malestares. Cada complejo cultural le imprimirá a sus integrantes una marca, ese factor común al que se refiere Lacan, pero a la vez, por efecto de su historia personal, cada sujeto desplegará también sus propias particularidades respecto de los otros sujetos del mismo grupo humano. Antes de seguir adelante puede ser importante hacer una breve acalaración: el lector recordará que en el segundo capítulo mostramos cómo el discurso del amo nos sirve para pensar la estructuración del sujeto. Puede parecer extraño que ahora planteemos lo mismo con respecto al discurso universitario. En realidad el discurso del amo nos permite entender el lugar del yo en la subjetividad –un pretendido amo−. mientras que el discurso universitario nos
  • 70 permite pensar al sujeto (que va a ser el agente del discurso de la histérica) como producto de la cultura. Una tercera versión del saber en el lugar del agente, que nos pone de lleno sobre el problema de trabajo de esta investigación, tiene que ver con los textos que organizan las diversas instituciones que existen en cada cultura y que operan como una suerte de carta magna que rige sus destinos. Estos textos, que de una manera genérica, podemos llamar el contrato social institucional −parafraseando a Rousseau− son los estatutos, el organigrama, las políticas, la filosofía, la misión y visión que definen las coordenadas simbólicas de cualquier institución, desde un país hasta una pequeña asociación comunitaria, pasando por toda clase de organizaciones públicas y privadas. Estamos hablando de los discursos manifiestos, la conciencia de sí de las instituciones, por decirlo de alguna manera. Estos textos suelen aspirar a un alto grado de racionalidad, expresan los ideales institucionales, los imperativos que guiarán el proceder de sus integrantes, las normas que determinan los lugares, derechos y deberes de sus miembros, etc. Cada texto manifiesto de esta clase tiene su dimensión latente, es decir su verdad oculta, el crimen inconfeso o el goce maldito que está en su fundamento. Tótem y tabú y Por qué la guerra, son contundentes en este sentido: el acto fundacional de la cultura es un crimen y todo pacto social entraña una concentración de violencia al servicio de la construcción de una forma de poder. Se trata de una lectura en crudo que hace Freud de la conocida sentencia: “la unión hace la fuerza”. Esta es otra manera de decir que todo saber (S2) en el lugar del agente, tiene como verdad oculta una operación de poder (S1). En cada organización social se reproducen algunos rasgos fundamentales del orden cultural. Así, podemos decir que el grupo humano que conforma cada institución, como conjunto, y cada uno de sus integrantes, tomados de manera aislada, estarían en el lugar de la “a” minúscula, como una suerte de materia prima que es modelada por el saber que opera como agente, en cierto sentido sería una operación bancaria en la que los integrantes operarían como depositarios portadores de unos contenidos fundamentales por el hecho de pertenecer a ese conjunto que es estructurado por una batería significante. Así como pudimos decir que el malestar es consustancial a la cultura y que cada una de posee sus propias formas de malestar, podemos decir también que cada institución produce sus síntomas particulares, y que no hay institución que carezca de productos sintomáticos ($). Estos productos sintomáticos serían a la vez el producto y una especie de residuo o de desecho de la operación. Lo más interesante, para el análisis institucional, es que se puede saber más de la verdad de una institución por los síntomas individuales y grupales que produce en sus integrantes, que por su estructura orgánica, sus manuales de funciones, sus publicaciones, sus balances sociales y todos sus discursos manifiestos. Esta reflexión sugiere una vía para pensar el reverso de lo que los psicólogos empresariales suelen llamar la “cultura organizacional”; bajo esta denominación suelen hacer referencia a un conjunto de rasgos propios de cada institución, entre
  • 71 los que se destacan los valores. Esta nueva perspectiva sugiere que toda institución, en la medida que está estructurada como un lenguaje, puede ser analizada como una microcultura, en el sentido más cabal de la palabra. En virtud de ello podría hacerse un análisis de los efectos subjetivos que produce en cada uno de sus integrantes, en especial, de los efectos sintomáticos. Algunos de ellos serán comunes a todos los integrantes, pero la mayoría, y en especial los más significativos, serán diferentes de acuerdo con el lugar que cada integrante ocupa dentro de la organización. 3.2.3. El Saber (“S2”) como tarea en el lugar del agente del discurso universitario En los tres casos anteriores −el saber inconsciente, el saber del gran Otro de la cultura y el saber del pacto social que organiza una institución−, se trata de saberes sedimentados que operan la mayoría de veces como tradición, en la lógica de la repetición y producen síntomas. En este caso, los síntomas son aquello que hará posible la configuración de otra modalidad de vínculo que permitirá operar modificaciones sobre el mismo discurso universitario, pero sobre ello trataremos en el discurso de la histérica. Por ahora, pensemos en una tarea operando como saber en el lugar del agente, en los grupos en general y en los grupos operativos en particular. Podemos empezar diferenciando algunas clases de saber posible, partiendo de la definición que ya sugerimos de éste como una articulación significante relativamente estática que gobierna con carácter imperativo; en este sentido –ya lo dijimos- estaría más del lado de las tradiciones, las doctrinas, las morales y las ideologías, que de la ciencia y la filosofía, aunque en algunos casos sean sedimentos de estas dos últimas. Una de las características del saber, cuando opera como función dominante de un vínculo, es decir como agente, es que prescinde de su fundamentación y su justificación suele ser dogmática o tautológica: “es así, porque es así”. Una de las formas más habituales del saber es la tradición, que se materializa en las prácticas cotidianas que nadie interroga, en lo que Bourdieu llama los hábitus. Estos existen en todos los campos y se manifiestan en los actos más triviales y cotidianos, como las formas de saludar, hasta en los rituales más sofisticados de cada grupo humano. Otra forma de saber tradicional se articularía en los discursos religiosos, en particular en los preceptos morales. Una tercera forma de saber serían las ideologías, en el sentido que le confiere Gastón Bachelard a este término −por oposición a la ciencia− como aquel saber establecido contra el cual se producen las rupturas epistemológicas. Finalmente, podríamos hablar de un saber filosófico, allí donde un sistema filosófico es adoptado como una cosmovisión que lo explica todo.
  • 72 Los grupos en los que el saber tradicional de la costumbre está en el lugar del agente del discurso universitario, operando como significante dominante que determina la naturaleza del vínculo, serían aquellos que están en función de mantener el orden establecido, es decir garantizar que la cosa siga marchando más o menos igual. Podríamos decir que los hay de dos clases, aquellos que formalmente velan por el orden y aquellos que lo hacen de manera informal y que pueden ser, por ello, más eficaces en esta tarea. Entre los primeros estarían aquellas instituciones que garantizan la reproducción del orden social, lo que Luis Althuser llama los aparatos ideológicos y represivos del estado. Los más emblemáticos son la escuela y el ejército y lo que caracteriza su operación es la repetición (S2). Pero hay otras organizaciones sociales que de una manera decidida contribuyen a la conservación del statu quo, como ciertos clubes sociales, o ciertas organizaciones de ultraderecha que abiertamente exhiben esta vocación conservadora. También podríamos mencionar, en este orden de ideas, a ciertos agrupamientos informales “espontáneos” como los cocktailes rutinarios en ciertos sectores sociales, que ejercen una importante función de control social. Incluso ciertas festividades tradicionales en las que se conmemoran ciertos eventos en torno a los cuales se construyen rasgos de identidad colectiva, pueden funcionar bajo esta lógica repetitiva agenciada por un saber que opera como tarea. Todo aquel que ingresa a un grupo regido por esta lógica está en la posición de un recipiente vacío (“a”) presto a ser llenado con los significantes que el discurso grupal provee a los integrantes. En los grupos que operan bajo esta lógica, la homogeneidad es un valor por excelencia y la capacidad de adaptación pasiva es una garantía de ascenso en la jerarquía del grupo. En el límite de esta lógica están los votos de obediencia en las comunidades religiosas, o la lógica militar que eleva a la categoría de delito la insubordinación. Para esta modalidad vincular, los integrantes del grupo son materias primas de una operación, sustituibles en tanto que idénticos unos de otros. S2 → a El producto sintomático ($) de este discurso lo podemos leer de dos maneras: en primer lugar, a partir de los efectos de malestar subjetivo que produce toda institución que uniforma y, en segundo lugar, a partir de las depositaciones que hace el grupo de este malestar en uno o algunos de sus integrantes que funcionan como portavoz del síntoma grupal. En el primer caso, es decir, con respecto a los efectos de malestar, podríamos decir que la versión más general de este producto es nada menos que El malestar en la cultura, en el sentido más preciso que Freud le atribuye a esta expresión en el texto que lleva ese nombre. En un plano institucional, ya lo mencionamos más arriba, cada organización produce sus propios efectos de subjetivación en sus integrantes, y por supuesto sus síntomas particulares, lo que podríamos llamar una especie de “Factor I”, parafraseando a Lacan. No hay instituciones asintomáticas, toda institución produce sus síntomas. Al igual que ocurre con los complejos culturales, la diferencia entre una institución y otra, desde esta
  • 73 perspectiva, depende de la calidad de los malestares que produce y de los medios que emplea para tratarlos. Con respecto a los grupos en general, y los grupos operativos en particular, hay que decir lo mismo: no existen grupos armónicos y felices, en todo grupo hay que suponer la existencia de tensiones agresivas, rivalidades imaginarias, agendas encubiertas, envidias, celos, luchas de poder, existencia de bandos, amores y odios secretos, etc. Y, en particular, cuando el factor dominante que le imprime su sello particular al grupo es un saber que opera como tarea en posición de agente de la operación grupal, estos fenómenos grupales producen síntomas particulares que los diferencian de los síntomas que produce otro tipo de grupos. La forma particular que adquiere el malestar en esta modalidad grupal tiene que ver justamente con el aplastamiento de la singularidad de los integrantes del grupo en aras de lograr la estandarización a la que aspira el saber. En el segundo caso, esto es, con respecto a la depositación de lo sintomático en uno o algunos de los integrantes del grupo, que funcionarían como chivos expiatorios y a la vez como portavoces de la patología grupal, podemos decir que en el nivel más amplio de lo cultural esta función es agenciada por los grupos minoritarios que se resisten a la presión de homogeneización que hay en toda cultura. Son muchos los grupos que surgen como producto del discurso universitario en cada complejo cultural, y los hay en todos los campos. Desde las llamadas tribus urbanas, pasando por los movimientos contestatarios legales e ilegales de grupos segregados, hasta algunos movimientos artísticos. Estos grupos van a ser el agente del discurso de la histérica que abordaremos más adelante. En el plano institucional, podemos decir que los depositarios de esta función son aquellos subgrupos al interior de la organización que no se acomodan a lo establecido y que constituyen una amenaza para quienes detentan las posiciones de poder o privilegio. En el plano de los grupos en general y los grupos operativos que se estereotipan bajo la lógica vincular del discurso universitario, los productos serían aquellos sujetos que de una manera expresa o tácita interrogan permanentemente el funcionamiento del grupo, la pertinencia de su tarea, y que se convierten en el lugar en el que se expresa el malestar grupal. S2 → “a" $ La verdad de los discursos que tienen en el lugar del agente al significante del saber, es el significante amo (S1). Tanto en el plano general de los complejos culturales, como en el plano medio de las organizaciones y en el primer plano de los grupos centrados en la tarea, como el grupo operativo, este significante que está en el lugar de la verdad, remite a la sujetación y sobredeterminación que tiene el saber sobre cada sujeto, que es una moderna forma del sometimiento del amo antiguo. De acuerdo con esta perspectiva, habría que preguntarle, por principio, a todo saber, cuál es el poder al que sirve. No existe la epistemofilia desinteresada, ni mucho menos un deseo de informar o formar, o concientizar a otros, que no esté al servicio de una secreta voluntad de dominio.
  • 74 S2 → “a" S1 ∆ $ Un grupo operativo puede llegar a funcionar de acuerdo con esta modalidad vincular. Cuando ello ocurre se manifiesta justamente en un empeño sintomático de que nada cambie, que se apodera de los integrantes. Para que esto ocurra se requiere que haya un cierto consenso al interior del grupo, en el sentido de que todos saben, más o menos, lo que hay que hacer y lo hacen conforme a ese saber (S2). 3.2.4. El saber tradicional, el saber religioso, el saber filosófico y el saber académico como emblemas del “S2” en los grupos El grupo operativo fue creado por Enrique Pichón Rivière como un instrumento para contrarrestar los efectos aplastantes que tienen los saberes institucionalizados, articulados bajo la lógica del discurso universitario. En la experiencia del Hospicio de las Mercedes, el grupo operativo permite la producción de un saber alternativo al saber de la psiquiatría y que permite intervenir sobre los efectos de malestar de la práctica tradicional del discurso médico. En la llamada “Experiencia Rosario”, el equipo coordinado por Pichón, convoca a la comunidad para que produzca un saber sobre sí misma, una especie de autodiagnóstico participativo, lo cual constituye, en acto, un desafío tácito a la posición tradicional del científico social que opera como un amo del saber que administra o aplica a la comunidad. Por eso, este capítulo, nos servirá para observar algunos cuadros extremos en los que se pueden mostrar algunas desviaciones radicales del grupo operativo, que pueden llevarlo a reproducir justamente aquello a lo que se opone fundamentalmente. En efecto, como ocurre en otros campos de la vida grupal e institucional, puede ocurrir que un dispositivo que se diseña para remediar un determinado problema, termine padeciendo del problema mismo que intenta resolver, o incluso exacerbándolo. Ocurre con frecuencia en el campo de lo político, que ciertos movimientos que se fundan bajo el emblema de combatir ciertos vicios de los partidos tradicionales, terminan reproduciendo esos vicios, con el agravante de que el exceso de clarividencia que exhiben para evidenciarlos en los otros es directamente proporcional a la ceguera para verlos en sí mismos. Por ello no hay que escandalizarse porque un grupo operativo pueda llegar a operar bajo la modalidad del discurso universitario. Todo lo contrario, hay que contar con esta posibilidad como un principio de evaluación permanente. El aporte de este capítulo a la reflexión del grupo operativo reside justamente en mostrar algunas posibles desviaciones típicas que pueden llegar a pasar desapercibidas para una mirada no instrumentada. El saber de la tradición, operando como agente de un vínculo, nos produce una imagen del grupo similar a una compañía de danza folklórica; el trabajo de estos
  • 75 grupos no estaría orientado hacia la búsqueda de nuevas expresiones de la danza, sino a la conservación de lo existente. En un grupo operativo esto se puede manifestar por una ritualización radical que lleve a la estereotipia estéril, en nombre de mantener, por ejemplo, la pureza de la técnica. El grupo puede llegar a entrar en una inercia, reforzada por un goce de ejecutar de una manera, más o menos invariable, unos compases aprendidos de memoria. Cualquier intento por romper esta dinámica repetitiva será neutralizado con un coro que asevera que “así se ha hecho siempre” y esa apelación a la tradición será el principal apoyo de su resistencia al cambio. En un grupo que está bajo un régimen vincular de esta índole, la tarea particular que está operando en el lugar del agente garantizará que siempre encuentre la confirmación de lo mismo. Si tomamos el saber religioso como emblema, la imagen del grupo que tendríamos no sería ya la de una danza folklórica, sino otra más problemática: la del grupo de oración que se reúne para la celebración del culto. Nuevamente la tarea que convoca al grupo es la repetición de un ritual que entraña un saber que sirve de guía al grupo. Los participantes en un ritual de culto habitualmente lo conocen de memoria y lo más normal es que no se interroguen si se podría hacer de otra manera. Podríamos decir que lo reiterativo es justamente uno de los elementos consustanciales a esta modalidad vincular. Cualquier cuestionamiento del ritual, de la doctrina que imparte, o de sus fundamentos mismos, caerá irremediablemente bajo la categoría de lo herético. Un grupo operativo que caiga bajo este régimen vincular se puede identificar fácilmente por su aire de monasterio, suele ser un grupo que pierde la capacidad para el humor, la creatividad, las posibilidades de ser irreverente, transgresor y creativo. Las sesiones de trabajo podrán exhibir una atmósfera de solemnidad y las referencias permanentes a citas del maestro, como palabra sagrada, serán una forma de sanción privilegiada. Es muy frecuente encontrar en el campo las ciencias sociales que, en torno a la obra de algunos autores, se construyen pseudo religiones. El saber filosófico, en el sentido de las cosmogonías, puede ser emblemático del agente que ejerce la función dominante en ciertos grupos operativos. La imagen que producen estos grupos es la de un delirio paranoico colectivo de un alto nivel de consistencia. El empeño fundamental del grupo será velar por preservar la consistencia de la cosmovisión del grupo mediante una reducción sistemática de la diversidad del mundo a los significantes que organizan la cosmovisión del grupo. En cierto sentido comparte algunos rasgos de lo religioso, con la diferencia de que no hay una apelación a alguna forma de la divinidad y el valor supremo en este caso estaría en función de la referencia al universo simbólico que constituye el sistema filosófico en cuestión. Finalmente, el saber académico como emblema de un saber que puede hacer de agente en un grupo operativo, nos traería la imagen de las instituciones educativas, especialmente en esta época en que los estándares se están convirtiendo en un imperativo tiránico que uniforma los programas de formación profesional. La imagen ideal de esta versión desnuda del discurso universitario sería la de un mismo grupo realizando un ejercicio exactamente igual, de manera
  • 76 simultánea, en distintos lugares del mundo. Para los efectos del grupo operativo la imagen ideal desde esta perspectiva también estaría en la vía de la estandarización y de la reproducción idéntica del modelo en cualquier contexto, independientemente de sus particularidades. 33..33.. LLAA TTAARREEAA EENN EELL LLUUGGAARR DDEELL AAGGEENNTTEE EENN EELL DDIISSCCUURRSSOO DDEE LLAA HHIISSTTÉÉRRIICCAA 3.3.1. A propósito de la histeria Para iniciar con la reflexión en torno a la modalidad del vínculo que Lacan denomina “el discurso de la histérica” y luego observar lo que ocurre cuando los significantes “tarea”, “grupo” y “coordinador” se sitúan en el lugar del agente de dicha forma de hacer lazo social, es necesario hacer algunas consideraciones previas sobre su denominación misma. Ciertamente, de los nombres que Lacan le asigna a sus cuatro discursos, el que más sorpresa produce, aún para los familiarizados con la teorización del autor, es, sin duda, el “discurso de la histérica”. En la historia del psicoanálisis, el concepto de histeria se desdobla en dos acepciones, que dan cuenta de la evolución de la teoría y la investigación clínica. La primera acepción conserva en lo fundamental su sentido original: remite a un cuadro clínico específico, caracterizado por un conjunto de síntomas que perturban la capacidad de trabajo y los vínculos significativos de quien lo padece y le implica una cuota de sufrimiento que puede evitarse. Por otro lado, el estudio profundo de la histeria permitió al psicoanálisis comprender la dinámica del deseo en los seres humanos. Aquello que en las histéricas aparece de una manera exacerbada, y por ello patológica, constituye la dinámica propia del deseo. En la histérica aparece, como en una especie de hipérbole, una verdad fundamental de todos los deseantes, a saber, que el deseo, en su sentido de deseo sexual, no está hecho para ser satisfecho, -como todavía lo siguen prometiendo los sexólogos-, que la sexualidad es insatisfactoria por su misma naturaleza. A diferencia de los demás neuróticos que, a pesar de todo, perseveran y no pierden la ilusión de alcanzar el goce prometido, y que incluso se conforman con algunos pocos de ese goce; una histérica radical hace de la imposibilidad misma de la satisfacción una estrategia de su deseo, pide que no le den caviar porque es su plato favorito. Entre el caviar y el deseo de caviar, una buena histérica elige lo segundo. Esta estrategia, si bien tiene un costo enorme desde el punto de vista de las cuotas de displacer que implica, por contrapartida, tiene el efecto de hacer aparecer la castración en el otro y de hacerlo desear. Otro rasgo particular de los sujetos deseantes, que aparece acentuado hasta lo caricaturesco en las histéricas, es la transformación del padecimiento en una interrogación que se dirige a un “Otro”, a quien se atribuye un saber y en consecuencia se le coloca en un lugar de amo. Este rasgo, que en los deseantes
  • 77 constituye una condición necesaria para hacer vínculos, en la patología histérica se manifiesta como la tradicional peregrinación de amo en amo, de pareja en pareja, o de un terapeuta a otro, sin encontrar una cura para sus males, o quien satisfaga su incolmable falta. Así la histeria, en un sentido amplio, remite a la condición misma de deseante en el sentido más preciso del deseo como “deseo del otro”, es decir, “deseo de deseo” (desear ser deseado por el Otro), y en un sentido más estricto sigue denominando el cuadro clínico en el que una exacerbación cuantitativa deriva en un sufrimiento que puede llegar a ser insoportable para el sujeto y convertirse en una forma de miseria psíquica. 3.3.2. A propósito del significante del sujeto dividido “$” El significante dominante que le imprime su índole particular a la estructura vincular que Lacan denomina el “discurso de la histérica” se representa en el psicoanálisis con la letra “S”, atravesada verticalmente por una barra: “$”, lo cual se lee como el sujeto dividido o también el sujeto barrado. La barra que divide el sujeto es la acción del lenguaje que lo constituye como deseante, es decir como carente; como determinado por una falta constitutiva de su ser, que es el fundamento mismo de su deseo. Esta división, constituyente del deseo, puede ser experimentada por un sujeto como el anhelo incolmable que lo lanza al mundo a buscar en los otros aquello que le falta. El deseo, por su misma naturaleza metonímica, nunca encontrará un objeto que lo satisfaga plenamente, lo cual determina que mantenga su incesante desplazamiento de un significante a otro. Esta trashumancia, desplegada en el tiempo, es la historia misma de cada sujeto, su biografía. Por ello la acepción fundamental del significante “$” será la de “sujeto deseante”. El deseo es lo que define al ser hablante y orienta su existencia, a diferencia de las demás criaturas de la naturaleza que son guiadas en el mundo por el saber de sus instintos. Una de las diferencias fundamentales entre el deseo y el instinto consiste en que el instinto –por ejemplo el instinto sexual de los animales-, tiene un objeto predefinido genéticamente, mientras que el objeto del deseo del ser humano -por ejemplo el deseo sexual-, no tiene un objeto específico y por ello puede desplazarse de un significante a otro. Digámoslo de otra forma, el instinto “sabe” de antemano cuál es su objeto y qué hacer con él, el deseo se define por no saber de antemano cuál es el objeto y tampoco saber qué hacer con él. Por ello la pregunta al otro es un elemento definitorio del deseo, una pregunta que, por cierto, nunca podrá tener una respuesta definitiva. Siempre habrá un nuevo significante que vendrá a resignificar todos los anteriores y a dejar nuevamente abierta la cadena, llamando a otro significante. Esta condición metonímica que, insistimos, es consustancial al deseo, puede ser una potencia productiva y creativa cuando toma la forma de la búsqueda
  • 78 constante y la reinvención permanente de su propia realidad, por parte de un sujeto. Pero esta metonimia también puede articularse bajo formas sintomáticas, como lo podemos constatar en la neurosis obsesiva y en la histeria, entendidas como cuadros clínicos. El deseo imposible que define la estrategia del neurótico obsesivo puede desvirtuar la metonimia consustancial al deseo, transformándolo en un aplazamiento y un rodeo permanente que garantizan al sujeto mantenerlo a salvo de su cumplimiento, aunque sea en términos relativos. La estrategia del deseo insatisfecho de la histérica, por su parte, puede hacer del desplazamiento del deseo de un significante a otro, una vocación de consumidora compulsiva que termine siempre corroborando y exacerbando su insatisfacción. Son radicalmente distintas estas dos formas de trashumancia patológica del deseo de un significante a otro, si las comparamos con otras formas de la metonimia como las que podemos observar en un artista, en un científico, o en un enamorado. En los tres casos la metonimia constitutiva del deseo está, digámoslo así, subordinada a una metáfora previa que le sirve como centro de gravedad. Así, también en estos casos, el deseo será cada vez “deseo de otra cosa”: otro descubrimiento, otra creación, u otro significante que le permita saber un poco más de ese objeto deseado y a la vez le garantice mantener la promesa incumplida. En estos casos la condición metonímica del deseo deviene una potencia que relanza permanentemente al sujeto en pos de nuevas realizaciones y de afirmar su singularidad. Este rasgo del deseo puede articularse, pues, en función de vidas originales, de seres modestos o geniales, pero también puede tomar la forma de la banalidad de los consumidores frívolos, que siempre los lleva de una mercancía a otra manipulados por la maquinaria massmediática. Si bien, en este segundo caso, el deseo está subsumido en la demanda, no por ello deja de serlo. El deseo puede adoptar formas problemáticas y enajenantes, sin dejar de ser, por ello, deseo en el sentido legítimo de la palabra. En algunos círculos psicoanalíticos, el término “deseo” ha sido objeto de una especie de libidinización, gracias a la cual se ha exaltado como un valor superyoico, lo cual le quita su potencia explicativa y su valor operativo como concepto y lo convierte en un instrumento más de las idealizaciones tiránicas. Debemos estar preparados, pues, para encontrar el deseo en los sujetos y en los grupos, articulado en lógicas acordes con la preservación del mismo deseo y de la vida; y, también, articulado en lógicas enajenantes y destructivas. Tenemos entonces que el significante “$” se puede leer como “sujeto dividido” y como “sujeto deseante”. Vamos a abordar a continuación otra acepción de este significante, que si bien está vinculada con la anterior, nos arrojará una luz lateral que nos permitirá iluminar otro costado de la realidad humana, a saber “$” como sujeto sintomático. Esta condición del sujeto, dividido por su constitución como hablante, puede ser experimentada como una inconsistencia fundamental, como una disarmonía
  • 79 estructurante, un desencuentro del sujeto con sus objetos, con los otros y con el mundo, que adquiere la forma de lo sintomático. Lo sintomático, en este caso, no hay que tomarlo como una anomalía indeseable a combatir, sino en su acepción más amplia, como un significante que remite a otro significante; es decir, la disarmonía como aquello que remite a nuestra condición de sujetos hablantes. Dicho de una manera general, la constitución del sujeto como hablante y deseante conlleva un desajuste irreductible del sujeto con el objeto y por consiguiente con los otros, con el mundo y consigo mismo. En virtud de ello el sujeto siempre estará deseando y siempre estará haciendo alguna clase de síntoma. Así, la diferencia entre unos sujetos y otros no es que unos sean sintomáticos y otros no lo sean, sino lo que hace cada uno con su síntoma. La condición sintomática del ser humano, entendida como esa desadaptación originaria del sujeto con el mundo, puede ser una potencia de la que se deriven producciones tan valiosas como el arte, la ciencia y la política. Incluso en el campo modesto de la experiencia individual, la experiencia amorosa es una invención que hace más soportable esa inconsistencia fundamental; y, también, este desajuste del hablante con el mundo puede ser el origen de las peores miserias individuales y colectivas: desde los delirios y los rituales torturantes de los neuróticos obsesivos, en el ámbito individual, hasta los fanatismos y las distintas formas de la segregación y exterminio, en el colectivo. En unos y otros lo que se revela es un esfuerzo desesperado por restaurar un pretendido estado mítico de plena armonía individual o social. Ya tenemos dos acepciones posibles para leer este significante del sujeto dividido: su condición de deseante y su condición sintomática. Como podemos ver, están muy vinculadas entre sí, justamente porque tienen un fundamento común; pero en sus expresiones más acentuadas llegan a contraponerse de una manera radical: lo sintomático, cuando se articula en su dimensión más patológica y más destructiva es una amenaza fundamental para el deseo. Vamos a abordar una tercera acepción de este significante de la división subjetiva ($), que también está muy relacionada con las dos anteriores, pero que puede ser importante considerarla independientemente porque nos puede permitir iluminar algunos fenómenos. Esta tercera acepción es el malestar. El sujeto dividido también lo podemos llamar el sujeto del malestar, en la acepción que Freud le da a este término cuando nos advierte del malestar irreductible al que está expuesto todo sujeto por el hecho de hacer parte de la cultura. El malestar mismo −y sus expresiones− hay que abordarlo, en principio, como un elemento constitutivo y, por lo tanto, irreductible, de la condición humana; no es algo contingente, a lo cual podamos buscarle explicaciones coyunturales. Una vez admitida esta premisa, estamos preparados para establecer diferencias entre los sujetos y los grupos, no en función de la presencia o ausencia de malestar en ellos, sino por la calidad del malestar, de sus expresiones y de las formas de afrontarlo. Esto es fundamental, porque de la aceptación del malestar como un
  • 80 elemento consustancial de la condición humana no se puede derivar un nihilismo de la falta o, peor, una invitación tácita a la resignación. Lo que planteamos para el síntoma, vale también para el malestar: éste puede ser una potencia que conduzca a un sujeto o a un grupo social a conquistas elevadas o, también, una fuente vana de padecimiento que se autoreproduce en una espiral que puede llevar a un sujeto, o a un grupo, hasta la propia autodestrucción. 3.3.3. “$” en el lugar del agente del discurso de la histérica Como podemos ver, el significante que está en el lugar del agente del discurso de la histérica no es tan elemental como el que hace de agente del discurso del amo, ni tan previsible y sobredeterminado institucionalmente como el que hace las veces de agente del discurso universitario. Es un significante muy rico que tiene facetas muy disímiles. Vamos a ir todavía un poco más lejos: el significante que opera como agente del discurso de la histérica, por su misma condición de dividido, presenta un rasgo particular que lo torna bastante impredecible y complejiza los vínculos que se organizan en función de esta estructura vincular. Nos referimos a su condición contradictoria. Podríamos decir que subvierte la lógica vincular de los dos discursos anteriores y la pone en crisis. Hablar del significante del sujeto dividido, en el sentido más preciso de este término, implica, desde el punto de vista conceptual, que estamos ante la presencia de un conflicto irresuelto y, a menudo, estructuralmente irresoluble. Es decir que en todo “$”, allí donde aparezca, siempre están coexistiendo dos términos irreconciliables. Debemos estar preparados, entonces, para que los lazos sociales en los que este significante imprime su estilo, sean de una índole fundamentalmente diversa a la de los dos anteriores, que por lo demás, eran fundamentalmente homogéneos entre sí. 3.3.4. “S1” en el lugar del Otro En todo discurso, el carácter del agente determinará cuál significante va a estar operando en el lugar del “otro”. Es decir, cada agente convoca a un “otro” particular, no a cualquier “otro”. Así como el significante amo en el lugar del agente determina que en el lugar del otro vamos a tener a un significante de la servidumbre (S1→S2), y “la luz del saber” en el lugar del agente va a determinar que en el lugar del otro tengamos un “a-lumno” (S2→a); el significante de la división subjetiva, de lo sintomático y del conflicto, en el lugar del agente, va a determinar que en el lugar del otro tengamos a un significante amo: $ → S1
  • 81 Veamos por qué. Cuando un sujeto o un grupo se hacen representar para el Otro por aquello que no marcha, en ese mismo acto, ese Otro, sea quien fuere, queda colocado en un lugar de amo. Esto se puede constatar en los vínculos cotidianos. El enfermo ($) apela al médico (S1), el pecador al ministro de la iglesia, el ciudadano reclama sus derechos ante el gobernante. El que sufre porque no sabe, le supone ese saber a un Otro y lo interpela como sujeto supuesto saber… Esto también lo podemos constatar en el campo de lo colectivo: cuando un grupo se hace representar para el Otro por un significante del malestar, de lo sintomático o del conflicto, siempre lo hace ante Otro investido por un significante amo. Las reivindicaciones de derechos grupales se hacen ante instancias de autoridad, los mítines y las manifestaciones ante instancias del poder. Podemos decir que la novedad o, por decirlo así, la virtud del discurso de la histérica no es la existencia del significante “$”. Sabemos que en el discurso del amo ya existe este significante como verdad reprimida y en el discurso universitario como producto. El mérito es que tome la iniciativa y comande la operación discursiva. Esto no hay que perderlo de vista. No es lo mismo un síntoma silenciado por la represión (discurso del amo) o un síntoma como producto (discurso universitario), que un síntoma haciéndose escuchar y produciendo una forma de vínculo en la que comanda la estructura vincular. Lo mismo podemos decir de los significantes de amo. No es lo mismo un amo en el lugar del agente en toda su pretendida plenitud (discurso del amo), o un amo agazapado bajo la barra actuando por intermedio de sus “comités” o de sus “sociedades anónimas” (discurso universitario), que un amo increpado en el lugar de Otro (discurso de la histérica). Digámoslo nuevamente, la virtud del discurso de la histérica es el lugar en el que coloca al amo. Vamos a ver que es un lugar paradójico, nada sencillo y nada cómodo para el amo. Y esa condición embarazosa, repitámoslo, deriva de la índole paradójica del agente “$”. Lo paradójico del significante amo (S1) en el lugar del otro, en el discurso de la histérica, radica en que de un lado es reconocido como tal; pero, de otro lado, la forma como es increpado lo coloca en una posición problemática. El discurso de la histérica no es un discurso de siervo. La histérica, o el sujeto que interpela a un Otro desde el lugar del agente del discurso de la histérica, no se dirige a un amo desde la sumisión, aunque en algunos casos juegue con este semblante como un recurso de seducción. Lo paradójico del agente del discurso de la histérica es que interpela al amo, pero no lo hace desde la posición de un siervo, ni desde la posición de otro amo (un par desafiante), sino desde la posición de un sujeto que le reconoce su lugar de amo, pero desde otra lógica que subvierte la dialéctica amo-esclavo y termina transformando al amo en otra cosa. Es decir, el sujeto que interpela al amo desde el lugar del agente del discurso de la histérica, acepta de antemano que exista el lugar del amo, como un lugar diferenciado y que alguien lo ocupe; pero lo que le
  • 82 dirige al amo es, en cierta forma, el propio mensaje del amo en forma invertida. Le dice algo así: “Tú que todo lo sabes y todo lo puedes, he aquí el enigma por el que sufro, si lo resuelves seguirás siendo el amo absoluto”. Se trata de una fórmula maravillosa, que además aparece por doquier en los cuentos de hadas. Lo que tiene de maravillosa esta fórmula es que resulta una tentación irresistible para cualquier amo; es tremendamente seductora, es decir pone a desear al amo; pero además es paradójica, porque simultáneamente afirma la plenitud del amo y la pone en cuestión. Un amo que realmente crea que lo es, no puede dejar de aceptar el reto. En el mismo momento que el amo acepta el reto de responder al enigma, algo en su naturaleza se transforma. Lacan dice que se vuelve filósofo. Por una razón muy simple: empieza a pensar y a desear el saber. Al respecto, Lacan dice que el deseo de saber no es el producto de una pulsión epistemofílica sino el producto del discurso de la histérica. Esta imagen que aparece tan loable a los ojos de nuestra época: un amo pensando y deseando el saber, constituye un salto en la historia que se repite cotidianamente cada vez que un vínculo social se articula bajo la forma del discurso de la histérica. En la historia de la literatura hay una metáfora preciosa de esta operación. Se trata de la pequeña historia con la que empieza Las mil y una noches. Es la historia de un rey que tras descubrir que su esposa le ha sido infiel decide matar a todas las doncellas con las que pasa la noche, para evitar que esto vuelva a suceder. Así en aquel reino cada noche antes del amanecer es sacrificada una doncella. El rey en el lugar del amo, bajo la coartada de una falta en el otro (que está en posición de siervo), se abandona a un goce devastador. Scherezada, una doncella hija de un Visir, descubre la manera de escapar a ese destino y salvar a las demás doncellas. Empieza a contarle una historia al rey, que interrumpe cada amanecer. El soberano la deja con vida a la espera de que la noche siguiente termine de contarle la historia, que nuevamente quedará interrumpida. Scherezada logra que el rey se mueva del lugar del agente del discurso del amo y se sitúe en el lugar del otro del discurso de la histérica, en el que ella está como agente. Mediante el enigma que siempre remite de un significante a otro, logra convertir la voluntad de goce del rey en deseo de saber. El rey no deja de ser el rey, pero su potencia mortífera logra ser neutralizada gracias a que deviene un rey en otro lugar, o mejor en el lugar del otro. La única que puede poner a un amo en el lugar del otro, es una histérica, dicho en otras palabras: un sujeto que, poniendo en juego su división, logre suscitar su deseo. 3.3.5. “S2” en el lugar del producto El producto del discurso de la histérica se puede inferir de lo dicho: si el sujeto que opera desde el agente del discurso de la histérica, increpa a un Otro investido por significantes de amo y esto tiene por efecto hacerlo desear el saber, el resultado de este discurso será justamente una producción de saber.
  • 83 Si nos atenemos estrictamente a lo que nos sugiere este matema, no podemos decir que el saber que recupera el analizante en su proceso de análisis sea el “S2” que está abajo a la izquierda en el matema del discurso de la histérica, porque ese es un saber producido por el amo. En un sentido estricto, el “S2”, producto del discurso de la histérica, es el psicoanálisis mismo, entendido en el sentido en que se habla de la teoría psicoanalítica, es decir un nuevo saber sobre la histeria, sobre el sujeto y sobre el malestar en la cultura. El producto de este discurso se puede constatar en múltiples referentes en el escenario social. Digámoslo de esta manera, cada que un sujeto o un grupo han logrado, en la historia de la humanidad, colocar al amo contra la pared, ponerlo a pensar y obligarlo a producir un significante nuevo, es decir, producir otra respuesta, distinta de la reiteración de su poderío, allí se ha producido una operación que podemos representar con el siguiente matema: $ → S1 S2 La resistencia del Pueblo Hindú frente al colonialismo inglés, es paradigmática en este sentido. También lo son los grupos minoritarios que obligan a los ordenamientos institucionales a crear nuevos significantes que los hagan existir jurídicamente y que les garanticen sus derechos. De otra manera radicalmente distinta, los grupos sociales que hacen síntomas inéditos, como las nuevas tribus urbanas y los grupos satánicos, también exigen al poder poner a trabajar a sus comunidades académicas para producir nuevos significantes que permitan nombrar esos nuevos síntomas y producir alguna clase de respuesta frente a ellos. Otra expresión de esta misma operación discursiva en el campo social, la constituyen los movimientos artísticos, que con sus rupturas obligan a una producción de nuevos significantes en todo el escenario social. Puede decirse que en el campo de la experiencia modesta de cualquier ciudadano, cada acción de tutela que crea un nuevo precedente jurídico, constituye un “S2” en el sentido más estricto del producto del discurso de la histérica. También podemos decir que significantes como “Sindicato”, “Comité estudiantil”, “Comité Cívico”, y otros análogos, son nominaciones que en el escenario social representan a ciertos grupos para los demás significantes, en particular para los significantes amo: “Junta Directiva”, “Rectoría”, “Alcaldía”. Los grupos que se hacen representar socialmente por este tipo de significantes operan, con respecto a la sociedad en su conjunto, desde la lógica del discurso de la histérica. Los grupos que operan bajo esta lógica no se plantean el proyecto de llegar a ser los amos (aunque algunos sujetos de estos movimientos puedan pasarse al grupo de los amos), sino de representar la división de sus respectivas comunidades y obligan a los amos a producir respuestas, es decir, que cuando estos grupos funcionan de la mejor manera, tienen el mérito de mantener a los amos atareados pensando y produciendo cada tanto nuevos “S2” y, con ello, logran morigerar su
  • 84 ferocidad. También podríamos decir que un movimiento como el de Las Madres de la Plaza de Mayo opera de acuerdo con esta lógica y produce unos efectos sociales realmente notorios. Finalmente, desde el punto de vista de la lucha política, los movimientos que se articulan bajo esta lógica discursiva se caracterizan por una estrategia premeditada que incluye como uno de sus fundamentos renunciar de antemano a la pretensión de constituirse en una alternativa de poder. El ejemplo por excelencia son los movimientos autogestionarios y el movimiento zapatista en México. En el campo institucional, los sujetos y los grupos que operan como agentes del discurso de la histérica son aquellos que hacen el rol de portavoces, chivos emisarios, incluso de boicoteadores (cuando se trata de un boicoteo que expresa un síntoma y no una voluntad de destrucción sistemática). Cuando aparece un síntoma en una institución, agenciado por algún sujeto o un grupo, y la institución logra responder de manera acertada, siempre la resolución dejará alguna clase de “S2”: una nueva reglamentación, un nuevo cargo, una experiencia acumulada, un aprendizaje, o una reorganización (en el buen sentido). Otra versión del discurso de la histérica en las instituciones son los grupos o los sujetos que sin estar en posiciones de poder, logran mediante formas creativas producir cambios en su interior, aquellos que producen un significante instituyente, en el sentido que Castoriadis le otorga a este término. 3.3.6. “a” en el lugar de la verdad La concepción de estructura, que Lacan toma de la lingüística, nos permite escapar a las concepciones esencialistas y nos pone sobre la perspectiva de pensar que es el lugar que ocupa un significante el que le confiere un valor y una significación determinada, por lo tanto, ningún significante tiene un valor y una significación en sí mismo, sino que el valor y la significación siempre van a estar en función de su relación con otros significantes. Si esto no está suficientemente claro, no es posible entender que un amo, en el lugar del otro, es totalmente distinto que un amo en el lugar del agente, o que el saber en el lugar del producto es un saber muy diferente al mismo significante en el lugar del otro, por ejemplo. Otro tanto ocurre con la “a” minúscula. Este significante, como producto de la operación, en el discurso del amo, muestra sus dimensiones más destructivas y, por ello, se puede leer como “goce” en el sentido más vinculado a la pulsión de muerte y a la repetición; y, en ese orden de ideas, también se puede asimilar a la “plusvalía”,“basura”, “desecho, etc. La “a” en el lugar del otro (en el discurso universitario) cobra un valor distinto: el de lugar vacío, el de un estado de ausencia radical, ausencia de saber por ejemplo; y es por ello que puede funcionar como coartada que justifica la pretendida vocación mesiánica, incluso liberadora, de los
  • 85 significantes del saber (“las letras os darán la libertad”) siempre al servicio de algún poder. Pues bien, en el discurso de la histérica, la “a” ocupa el lugar de la verdad. Este significante de la “a” minúscula lo podemos leer como “goce” y el lugar particular que tiene en este discurso: abajo a la izquierda, nos anuncia que se trata de un goce reprimido. Recordemos que la línea que separa al agente de su verdad es la barra de la represión. Esto lo convierte en un goce de una naturaleza muy diferente, incluso diametralmente opuesta, al goce que encontramos abajo a la derecha en el lugar del producto del discurso del amo. Se trata de la diferencia entre el goce (“a”) que se pierde con la constitución del sujeto por la acción del lenguaje (discurso de la histérica) y el goce (“a”) que recupera y ostenta el amo como una plus-valía (discurso del amo). Digámoslo de otra manera, en el primer caso se trata de un goce compatible con el lazo social, en tanto que su condición de reprimido neutraliza sus efectos más devastadores, mientras que en el segundo se trata de un goce que se consuma y que produce efectos devastadores de los vínculos sociales. Vemos pues, dos costados opuestos del mismo significante según el lugar donde lo encontremos. A partir de esto podemos colegir que el goce de la histérica, o del sujeto dividido, es el más compatible con la cultura, mientras que el goce del amo es más destructivo. Incluso podemos decir que el goce del neurótico, como también lo podemos llamar, es un goce productivo tanto en el sentido en el que se habla de las producciones (o formaciones) del inconsciente, como en el sentido de la cultura misma, como una producción de los sujetos hablantes. $_ → S1 “a” ∆ S2 3.3.7. La tarea en el lugar del agente del discurso de la histérica Este título nos sitúa de entrada sobre un problema muy interesante: pensar el síntoma como una tarea, como un trabajo. Nos sugiere pensar en un “trabajo del síntoma”, en el mismo sentido que Freud nos habla del “trabajo del sueño” o del “trabajo del duelo”. Se trata de una idea del trabajo, del sueño, del duelo y del síntoma que contradice el sentido común. Para el sentido común, lo sintomático es, por definición, aquello que se opone al trabajo. Sabemos que una persona o un grupo están haciendo un síntoma porque el trabajo no marcha. Es decir, que para el sentido común hacer síntoma y trabajar serían opuestos, de la misma manera que serían opuestos soñar y trabajar, o elaborar un duelo y trabajar. Se sueña o se trabaja, se hace duelo o se trabaja, se hace síntoma o se trabaja… Entonces, siguiendo la vía de un “saludable” sentido común, para preservar el trabajo es aconsejable hacer a un lado los sueños, los duelos y los síntomas. Lo que revela el psicoanálisis es que los soñantes, los
  • 86 dolientes y los neuróticos (en el sentido clínico de la palabra), trabajan de una manera desmesurada. Es notable que allí donde el sentido común establece una oposición, el psicoanálisis permita encontrar todo lo contrario, una identidad fundamental. ¿Qué implica esto? Nada menos que trascender la noción manufacturera del “trabajo” como actividad que implica un movimiento observable, una transformación de materias primas en productos elaborados y que, además, produce plusvalía. Esta noción del sentido común es, valga decirlo, la del discurso del amo. Un rasgo particular de esta noción de trabajo del amo capitalista es que en un sentido hay una transformación y una actividad evidentes, pero en otro sentido hay una repetición y una quietud, no menos notorias. El trabajo, en el sentido del amo, está organizado en función de que la cosa marche siempre igual, se autoreproduzca. En la noción psicoanalítica de trabajo, puede ocurrir, al contrario, que tras una quietud aparente haya una enorme producción. Los paradigmas de esto son el soñante, el doliente y el analizante. También la noción psicoanalítica de trabajo remite a una transformación, pero la materia de ésta es el significante. Y, en la medida en que el significante es la materia de la que está hecho el sujeto, podríamos decir que en el trabajo, en el sentido fuerte que tiene este término en una expresión como “trabajo analítico”, lo que se transforma es el sujeto. Quizá para entender mejor el alcance de esta reflexión sobre la tarea en el lugar del síntoma, o el síntoma operando como tarea, sea importante hacer una precisión más sobre la noción psicoanalítica de síntoma. Es decir, diferenciar lo que llamamos síntoma analítico de otras formas de lo sintomático. Lo que caracteriza al síntoma en el psicoanálisis y permite diferenciarlo de otras formaciones sintomáticas, no analíticas (o no permeables al dispositivo freudiano), es que el síntoma analítico está constituido como un complejo de representaciones articuladas bajo la forma de un conflicto susceptible de transformaciones. Lacan se refiere al síntoma con la misma fórmula que usa para el inconsciente, dice que “el síntoma está estructurado como un lenguaje” y, en el mismo orden de ideas, dice que es una metáfora en la cual la carne o la función es tomada como un elemento significante. Esto es lo que permite pensar el trabajo analítico como un despliegue del trabajo significante del síntoma, y es por ello que dos elementos fundamentales del encuadre son la suspensión de las funciones de amo del yo del analizante y una renuncia del terapeuta a ocupar el lugar de gobernante o maestro del paciente, para que el síntoma pueda desplegar su producción significante. Este preámbulo acerca del síntoma analítico, pensado en sí mismo como actividad significante, es decir, como un trabajo que en condiciones apropiadas está destinado a producir nuevas significaciones, nos deja el terreno abonado para pensar el síntoma como tarea en los grupos en general y en el grupo operativo en particular.
  • 87 Pensemos ahora en la noción de tarea en el grupo operativo. Las tareas más congruentes con la especificidad del dispositivo del grupo operativo no son el gobernar ni el educar, es decir, que el grupo operativo no está diseñado para la tarea de hacer marchar la cosa (discurso del amo) o aprender y transmitir cómo hacer que la cosa marche (discurso universitario). El tipo de tarea congruente con la especificidad del dispositivo del grupo operativo es justamente aquella que se define por lo sintomático. El grupo operativo muestra toda su pertinencia y su potencia justamente allí donde no marchan el discurso del amo y el discurso universitario, incluso, operando sobre los síntomas que producen los dos anteriores. Hacer de lo que no marcha un articulador para el trabajo grupal, un lugar de comando del trabajo de un grupo, ya pone a cualquier grupo sobre la vía del discurso de la histérica, en el mejor sentido: un grupo que se articule a trabajar a partir de un malestar común de sus integrantes, un drama compartido, un problema que los identifica entre sí y los diferencia de los otros. Si lo que es definido como el problema común se mantiene como aquello que define la tarea de un grupo y determina su orientación (en lugar de ser un líder, como en el discurso del amo, o una maquinaria burocrática, como en el discurso universitario), estamos, sin lugar a dudas, ante un grupo articulado bajo la lógica del discurso de la histérica. Y si, además, el grupo opta por dejar que el problema determine la dirección del trabajo (no los amos, ni las repuestas previas de la ciencia, de las religiones o las ideologías) y se aventura a la construcción de una respuesta propia, que sea el resultado de la especificidad de ese problema, interpelando a ese grupo específico, estamos ante una versión lograda de un grupo operativo. Esto no quiere decir que los grupos operativos deban funcionar en todo momento bajo la lógica del discurso de la histérica; pero sí nos advierte que este discurso le es más congruente al grupo operativo que el discurso del amo y el discurso universitario. Lo deseable en todo caso, de acuerdo con Pichón, es que la dinámica grupal no sea estereotipada y haya siempre una rotación de roles y de formas de liderazgo, lo que podemos traducir en términos lacanianos, como una alternancia de las modalidades discursivas en la dinámica grupal. 3.3.8. El grupo en el lugar del Otro en el discurso de la histérica Si el agente del discurso es el síntoma como tarea, el Otro, interpelado por el síntoma, es el grupo mismo como conjunto en calidad de significante amo. Cuando aparece un síntoma que empieza a perturbar la “buena marcha” de un grupo, siempre tiene el mérito de poner en crisis las ilusiones de omnipotencia o de autosuficiencia grupal y, por ello siempre, en primera instancia, es vivido como una amenaza. Cuando esto ocurre es usual que se pongan en marcha operaciones defensivas colectivas, similares a las de la subjetividad individual. El grupo puede crearse un enemigo exterior para proyectar en él su parte maldita y tratar de combatir en él aquello que se resiste a reconocer como un problema propio. Una de las
  • 88 condiciones para que otro grupo pueda funcionar como enemigo externo es que sea lo bastante similar para que sirva como referente especular; es decir que un grupo o una institución se puede trenzar en una lucha fraticida con un semejante para eludir ser confrontado por un síntoma propio. En estos casos, lo que ocurre es un refuerzo de la lógica del amo para mantener el síntoma silenciado con la ayuda de una operación proyectiva. En otros casos, los grupos y las instituciones se las arreglan con su dimensión sintomática de acuerdo con la lógica del discurso universitario: en estos el síntoma tampoco llega a constituirse en un agente que confronta al amo grupal y lo hace pensar y trabajar para producir nuevos “S2”, es decir, nuevas respuestas. Lo que suele ocurrir es que los síntomas aparecen como residuos de la operación grupal que son expulsados o marginados sin que el grupo reconozca en ellos algo que le concierne. Una vez aparece el síntoma, si un grupo o una institución está operando bajo esta lógica del discurso universitario, es previsible que traten su síntoma de acuerdo con el modelo de las enfermedades infecciosas, como la presencia de un cuerpo extraño que debe ser eliminado o extrirpado en una especie de operación de apendicitis. Estas vías tienen el precio de empobrecer la dinámica grupal e impedirle al grupo transformarse. Quizá este es uno de los aspectos en los que un grupo operativo difiere fundamentalmente de cualquier otro grupo. El dispositivo pichoniano, por su misma concepción, dispone de las condiciones óptimas y las herramientas conceptuales para que el síntoma, cuando aparece, pueda operar desde el lugar del agente y desde allí confrontar al grupo en el lugar del otro, haciendo de ello la ocasión de una producción de saber sobre la verdad que está en la base de ese síntoma. 3.3.9. El saber colectivo del grupo en el lugar de la producción La producción de un grupo operativo, cualquiera que sea su tarea, siempre tiene una dimensión fundamental que es la generación de un saber colectivo del grupo sobre sí mismo y sobre lo grupal, que no se presta para ser intercambiado como una mercancía. Es un saber que, como dice Gladys Adamson, es capitalizado por el grupo. Una consecuencia de ello es que si se evalúa la producción de un grupo operativo desde los criterios del discurso del amo, es decir, en función de sus rendimientos, el balance siempre será deficitario. En ese sentido, el dispositivo pichoniano es subversivo respecto de los imperativos de la productividad capitalista. Es por ello que con mucha frecuencia este dispositivo produce desconcierto y malestar en aquellos integrantes (incluso en algunos coordinadores) fanáticos de la producción de rendimientos y que se empeñan a toda costa en que el grupo no se “desvíe” de la tarea manifiesta. Aquellos que se mantienen en esta posición, pierden la perspectiva de la importancia que tiene la dimensión latente de la tarea en este dispositivo grupal. Esta dimensión latente es justamente la que concierne al
  • 89 trabajo de construcción grupal de una mutua representación interna, a la transformación de los esquemas referenciales individuales. En este proceso cumple un papel fundamental la transformación grupal y el saber particular que deriva de la elaboración colectiva de las propias inconsistencias y malestares, de sus propias ansiedades depresivas o esquizoparanoides, es decir, la apertura permanente del grupo a ser confrontado por su propia dimensión sintomática. 3.3.10. Los goces excluidos en el grupo operativo, en el lugar de la verdad Toda formación grupal excluye alguna o algunas formas de goce. Quizá una vía para pensar lo que diferencia a unos grupos de otros sea justamente interrogar a cada organización grupal por los tipos de goce que deja por fuera en su constitución, en lugar de centrar el interés en sus tareas o en sus objetivos. En esa perspectiva, una posible definición del grupo operativo sería algo así: “aquel grupo cuya dinámica se caracteriza por mantener en niveles mínimos la lógica del discurso de amo y del discurso universitario”. Una definición como ésta resulta bastante sugestiva y nos puede ayudar a pensar los goces excluidos que retornan en los síntomas más típicos de los grupos operativos. De acuerdo con lo anterior, debemos estar preparados para encontrar, de forma velada, los goces del discurso del amo y del discurso universitario en los síntomas de los grupos operativos. Según la lógica que define la organización de cada grupo, lo que en unas configuraciones grupales puede resultar un ideal, en otras será un síntoma. Verbigracia, la existencia de un claro principio de autoridad es un valor en las masas artificiales como la iglesia y el ejército que funcionan de acuerdo con el discurso del amo y en las cuales la obediencia es un principio fundamental al que se deben someter sus integrantes. Los goces excluidos de estas formaciones grupales son aquellos que remiten a la singularidad de lo subjetivo. En un grupo articulado bajo la lógica del discurso universitario serán valores fundamentales la sujeción de sus integrantes a la racionalidad específica que gobierna los procesos grupales, la observación escrupulosa de sus procedimientos, la coherencia de las manifestaciones de los integrantes del grupo con la cosmovisión que opera como universo simbólico que define la realidad grupal. El saber que opera como agente en este discurso implica una exclusión de los goces de amo desnudos, en particular la arbitrariedad irracional. Aunque el discurso universitario sigue siendo una estructura organizada en función del sostenimiento de un orden al servicio de un poder, la expresión de éste excluye sus manifestaciones crudas. El grupo operativo está concebido como una estructura fundamentalmente democrática que apunta a una construcción de un saber propio del grupo de acuerdo con su particularidad, sus necesidades, sus deseos y su historia. Esta concepción particular del dispositivo grupal implica la renuncia de sus integrantes
  • 90 y del grupo como conjunto a erigir figuras de autoridad o saberes hegemónicos que gobiernen de manera totalitaria el devenir grupal. Es por ello que dos de los síntomas típicos de los grupos operativos tienen que ver con intentos de retorno de los goces propios del discurso del amo y del discurso universitario. Así las oposiciones dilemáticas suelen ser expresiones de rivalidades imaginarias entre dos integrantes o fracciones del grupo que pretenden imponer su posición como una verdad absoluta que no reconoce otra diferente. Las estereotipias en los integrantes o en el grupo son dinámicas ritualizadas tras las cuales hay un saber que se autoreproduce y que impide la creación de nuevos saberes transformadores de los integrantes y del grupo. El coordinador, por ocupar un lugar diferenciado, es quizá el integrante del grupo que está más expuesto a deslizarse hacia goces de amo o goces universitarios. El espacio de supervisión de su labor de coordinación es, en este sentido un lugar valioso, precisamente para observar cómo se deslizan en su tarea de coordinación, a pesar de sí mismo y de formas muy sutiles, estos goces que constituyen el reverso del grupo operativo. 33..44.. LLAA TTAARREEAA EENN EELL LLUUGGAARR DDEELL AAGGEENNTTEE DDEELL DDIISSCCUURRSSOO AANNAALLÍÍTTIICCOO 3.4.1. El discurso analítico Recordemos que en el discurso analítico la “a” minúscula está en el lugar del agente. Allí la podemos leer fundamentalmente como semblante del objeto causa del deseo, de la falta de ser, o del plus de goce; también hay otras lecturas posibles que veremos más adelante. En el lugar del “otro” está el sujeto dividido por la acción del agente. Este sujeto lo vamos a entender como el sujeto deseante. “a”→ $ En un capítulo anterior advertimos al lector que el significado y el valor de cada uno de estos significantes no es fijo ni unívoco, sino que depende del lugar que ocupa en relación con los demás significantes en la estructura que opera. Así, el significante amo aparecerá en el lugar del producto de este discurso, tendrá un sentido muy diverso del que este mismo significante tiene en los tres discursos anteriores. Luego veremos cuál es su sentido y su valor. “a” → $__ S1 El saber que está en el lugar de la verdad de este discurso, de un lado, remite al saber hacer del analista, que es bastante paradójico porque se trata de un saber sostenerse en el lugar de la falta de saber y, a la vez, soportar la transferencia del analizante que le atribuye el lugar de “sujeto supuesto saber”. Es un saber fundamentalmente negativo, entendiendo esta negatividad como el saber que hay
  • 91 algo que no es posible saber: Vg., no se puede saber de la sexualidad y de la muerte más que en la experiencia particular de cada sujeto y aún allí no hay un saber a priori, sino que se construye en la propia experiencia; en lo fundamental es un saber retroactivo y en ese sentido inútil, desde los criterios de instrumentación funcional del discurso del amo. Sobre el saber que está en el lugar de la verdad del discurso analítico también podemos decir que siempre es un saber que sólo se puede decir a medias y, en ese sentido, podemos interpretar la barra que separa al saber del agente. El enigma y el mito son formas por excelencia del medio-decir de un saber referido a la verdad. La literatura y la poesía tienen la virtud de construir articulaciones significantes que bordean verdades fundamentales en las que cada sujeto puede acceder a un saber formulado como decir a medias. “a” → $_ S2 S1 La “a” minúscula es uno de los significantes más ricos en acepciones en la obra de Lacan, algunas de ellas disímiles, incluso opuestas en algún sentido. Algunas de las acepciones del significante “a” son: “plus de goce”, “objeto real”, “resto”, “objeto causa del deseo”, “falta de ser”, “objeto que falta”, “falta de objeto”; pero también, “objeto de la pulsión”, algunas de cuyas formas son “el pecho”, “las heces”, “la mirada” y “la voz”; incluso, en algunos casos, la “a” minúscula se puede leer como “objeto de amor”. Todas estas versiones coinciden en un punto fundamental, el cual justifica que sean nombradas por el mismo significante, que allí donde aparecen tienen el efecto de dividir al sujeto, o para ser más precisos, constituir en esa operación vincular a un sujeto, en tanto que sujeto dividido. Esta precisión es importante porque en el psicoanálisis el sujeto no es una esencia, ni una entidad que posea una suerte de existencia a priori al margen del vínculo social; sino, al contrario, es el efecto de la relación con el otro, gracias a una operación mediante la cual “es representado por un significante para otro significante”. 3.4.2. La tarea, como el objeto de amor, en el lugar del agente del discurso analítico Para pensar esta particular acepción de “a” quizá sirva como telón de fondo hacer una breve referencia al lugar que, según Freud, ocupa el analista respecto del analizante. Freud propone en varios lugares de su obra que la mejor manera de definir a un analista es por vía negativa, es decir, no diciendo aquello que es, sino aquello que no es. Y en todos los casos, aunque admite que el psicoanalista en la transferencia puede operar como un amo o un maestro para el analizante, lo que define la tarea del analista es que no es un gobernante y no es un educador. Si seguimos adelante con la enumeración de lo que no es un psicoanalista (no es un psicólogo, no es un científico social, no es un guía espiritual) podríamos decir que, en definitiva, el psicoanalista se define más claramente por la vía de su “no ser”
  • 92 que por la vía de su “ser”, si es que hay algo que pueda denominarse “el ser” del analista. Recordemos que, según Freud, el analista permite que el analizante lo utilice como objeto de amor, odio, deseo, rivalidad, fascinación y horror. Gracias a ese uso que el analizante hace del analista en la transferencia, es posible el análisis. No hay análisis sin transferencia. Para que el analista pueda “ser” todo aquello que el analizante le confiere en la transferencia debe, justamente, renunciar a jugarse alguna dimensión de su “ser” y sostener el semblante de la “falta de ser”, esa versión del objeto “a” que va a operar como proscenio sobre el cual se despliega la transferencia. En este punto es necesaria una precisión. No hay que pensar que la relación entre analizante y analista es simétrica, ni mucho menos complementaria. En otras palabras, no hay que pensar que aquel que llega a un consultorio a intentar apalabrar su sufrimiento, lo hace porque nota que allí hay alguien que está exhibiendo su falta de ser. Todo lo contrario: sabemos que la transferencia se apoya sobre una suposición de saber al analista. Y que el analista no se apresura a desmentirla, por el contrario, la convierte en un instrumento de trabajo. Así, la relación analítica, desde el origen, se funda en un malentendido en virtud del cual el analista, como cualquier amado, sin poseer necesariamente un brillo particular, opera como depositario de un objeto maravilloso. El analista, en tanto objeto del “amor de transferencia” (para decirlo con una redundancia), estaría operando como una versión del “a”, de acuerdo con la definición que propone Jacques Alain Miller del amor: “darle nombre propio al objeto “a”. Para un grupo, de manera análoga, un objeto de amor puede operar como causa cuando es la ocasión que da lugar a la constitución del grupo. Decimos entonces que el objeto de amor opera como causa de la “agrupación”, entendida esta palabra en el doble sentido: como la acción de agruparse y como el grupo. El objeto de amor que causa un grupo puede encarnarse en un individuo, como ocurre con las masas artificiales, en el caudillismo y aún en los grupos de fanáticos de un artista, un deportista o un equipo deportivo como conjunto; puede ser una idea abstracta en función de la cual trabaja el grupo (la paz, la justicia, la libertad, la igualdad de género), pero puede también concretizarse en una representación meta de una realización concreta, que puede ser el objetivo en función del cual se define la tarea del grupo. Un grupo puede funcionar expresa o tácitamente como el grupo de los amantes de… (la naturaleza, la filosofía, los derechos humanos, Cristo, la poesía, etc.). Podemos agregar que en virtud de la idealización propia de toda experiencia amorosa, el objeto de amor –sea concreto o abstracto- siempre funcionará como un ideal. Gracias a la propiedad condensadora del estado de enamoramiento, siempre subsiste el riesgo de que la idealización derive en fanatismo, caso en el cual la exacerbación podría conducir al grupo a la lógica del discurso del amo. Siempre hay este riesgo en el amor, que un enamoramiento extremo conduzca a una servidumbre peligrosa.
  • 93 Mientras la tarea se mantiene como objeto de amor en el lugar del agente, el grupo operará como sujeto deseante en el lugar del otro (“a”→$), causado como deseante por amor a esa tarea. La verdad que está en la base de esta operación, podemos pensarla como un saber muy particular: saber hacer semblante de ese objeto precioso, para constituir un grupo en torno a un deseo; dicho de otra manera, saber movilizar la falta del grupo y articularla a una representación determinada que le da un sentido preciso al trabajo grupal. Es claro que se trata de un saber de una índole muy distinta al de los siervos del que tratamos en el discurso del amo, o al saber académico formalizado del discurso universitario −que se puede almacenar, transmitir e intercambiar−, o al saber hecho por el grupo a la medida de sus necesidades y posibilidades del discurso de la histérica. En este caso se trata de un saber de otra naturaleza, que podríamos llamar el saber seducir, en el sentido de saber situarse en ese justo lugar que constituye al otro como deseante. No sería un seductor en condición de amante, sino de amado. Son dos estrategias fundamentalmente diversas. El amante interpela al “otro” desde el lugar del sujeto, mientras que el amado lo hace desde el lugar del objeto; la modalidad vincular del primero es el discurso de la histérica, mientras que la del segundo es la del discurso analítico. El saber hacer de un seductor de esta clase está más del lado del arte que de la ciencia; incluso en el campo mismo del arte está más del lado de la obra que del artista, es decir, está más del lado del objeto de arte que del sujeto que lo produce. Lugares Símbolos Significantes Agente→ ___otro___ “a”→$ objeto de amor → ____grupo______ Verdad S2 saber hacer semblante de “a” El producto de esta operación es un significante amo, que lo podemos pensar en el sentido del “amo de la casa” al que Freud hace referencia en su célebre sentencia. Si el “hombre no es el amo de su casa” es porque en su casa hay otro amo que gobierna sin que el hombre lo sepa. Ese amo que gobierna su casa como un tirano, sin que él lo sepa, es el propio inconsciente, que está cifrado como una escritura. Es el “destino” escrito cuyo texto desconocemos y, sin embargo, acatamos como el hipnotizado cumple una orden de la que no tiene conciencia, o como los personajes de algunas obras trágicas cumplen inexorablemente con la trama que el oráculo había sentenciado. Vamos a decirlo de esta manera: el enamorado está expuesto permanentemente a la angustia, aún en el arrebato de felicidad, porque está confrontado con su propia escenificación de la escritura que determina su deseo y gobierna su destino. En el discurso de los enamorados es muy claro que conciben el amor, o el objeto de amor, como a un amo absoluto; con frecuencia, incluso, hacen un elogio de la servidumbre. En cierto sentido, este es el principio de funcionamiento del dispositivo analítico: permitir al sujeto, en virtud de la transferencia, confrontarse con el rasgo que se repite en su manera de amar, desear y gozar. Una vez culminada esta operación,
  • 94 el sujeto queda solo para decidir qué posición tomar frente a ese amo que constituye la fantasía inconsciente fundamental que determina su deseo: es decir su fantasma. El producto del discurso analítico es un significante amo muy particular -o mejor en una posición muy particular-, cuya índole es diversa a la del amo feroz del discurso del amo, al amo solapado (y por ello más eficaz) del discurso universitario, al amo impugnado (pero amo al fin y al cabo) del discurso de la histérica. Podríamos decir que se trata de un amo íntimo develado, expuesto a cielo abierto. De las cuatro versiones del amo que hemos mencionado ésta es, sin duda, la más benigna. Lugares Símbolos Significantes Agente→ otro “a” → $_ objeto de amor → _____grupo___ Verdad ∆ producto S2 ∆ S1 semblante de “a” ∆ amo develado La diferencia entre el no analizado y aquél que ha hecho la travesía de una experiencia analítica, no es que el segundo sí sea el amo de su casa mientras que el primero no lo es, o que el segundo quede curado del amor mientras que el primero está condenado a ser un enamorado. Se trata de una diferencia más sutil, pero de consecuencias decisivas: el sujeto que ha hecho una travesía analítica puede soportar vivir en su casa sabiendo que no es el amo y puede amar soportando que el amado no sea idéntico al ideal amoroso. En los grupos operativos, en general, la tarea puede operar como objeto de amor común, que da lugar a la constitución del grupo. En los grupos operativos de formación, este amor tomaría la forma de una transferencia de trabajo dispuesta hacia la producción de un autor o hacia un saber particular y tendría, además, otra dimensión que podríamos llamar la “affectio societatis”, en el sentido que Jacques Alain Miller toma esta expresión latina para referirse al lazo amoroso que es condición para el sostenimiento de una comunidad de trabajo. En este caso, la affectio societatis sería una derivación metonímica de la transferencia de trabajo. En los grupos operativos cuyas tareas se definen en función de ideas abstractas, obras sociales o realizaciones de interés colectivo, también podemos admitir que, gracias a la sublimación, cada una de estas tareas puede operar como un objeto de amor en el sentido más legítimo del término. Esta sería la expresión más lograda de un grupo centrado en la tarea, por oposición a los grupos centrados en el grupo y los grupos centrados en el individuo. Como de costumbre, para evitar la tentación de hacer una apología de uno de los discursos, es importante mostrar el costado problemático que puede tener esta dimensión vincular. Este lado oscuro tiene que ver justamente con los matices problemáticos del enamoramiento, a los que ya aludimos. Recordemos que Freud insiste en la tendencia de todo enamorado a exaltar hasta el delirio los atributos del objeto amado, es decir a idealizarlo; esto tiene por contrapartida un
  • 95 menoscabo del narcisismo del amante que puede llegar hasta límites peligrosos para la subsistencia misma. El grupo de fanáticos es, a la causa colectiva, lo que el sujeto perdidamente enamorado, a su objeto de amor. En ambos casos estamos ante manifestaciones problemáticas del amor, que no pocas veces tienen desenlaces funestos. En este sentido es importante advertir que el vínculo analítico, cuando no es objeto de una supervisión y un control escrupulosos, puede deslizarse inadvertidamente hacia una lógica amo-siervo. 3.4.3. La tarea, como objeto del deseo, en el lugar del agente del discurso analítico Las nociones de objeto de amor y objeto del deseo en algunos aspectos coinciden y en otros difieren. El objeto de amor puede ser también objeto de deseo, pero puede ocurrir que el amor y el deseo de un mismo sujeto tomen caminos opuestos e irreconciliables. Thomas Hobbes hace una diferencia entre amor y deseo que puede ser útil para la reflexión que estamos desarrollando. En el Leviatán dice: “Así que deseo y amor son la misma cosa, sólo que con el deseo siempre significamos la ausencia del objeto y con el amor por lo común la presencia del mismo; así también, con la aversión significamos la ausencia y con el odio la presencia del objeto”46 Una de las definiciones del “a” más difundidas en el campo psicoanalítico es, sin duda, “el objeto del deseo”. El objeto del deseo tiene varios nombres en el psicoanálisis. El primero de ellos nos remite a Freud, es el “objeto perdido”. El objeto perdido es una noción que condensa varias pérdidas que son condición de la humanización: la pérdida de la madre como objeto -por obra de la prohibición del incesto-, la pérdida del “paraíso” de la naturaleza -en el que nunca estuvimos- por nuestra constitución como sujetos de cultura, la pérdida de los goces de las pulsiones parciales por obra de la ley de la castración, que ordena la sexualidad; y, en un sentido más general, que abarca los anteriores, la pérdida del objeto del instinto animal, al transformarse en pulsión humana. La pulsión se puede definir como un instinto que perdió su objeto, o mejor un instinto con un objeto estallado. Pero ya llegará el momento para que veamos algunos de esos objetos fragmentarios de la pulsión. Por ahora, volvamos al deseo. Freud nos dice que el deseo se eleva desde las pulsiones como un hongo desde su micelio. El deseo, definido por Lacan, como “deseo del otro” (y del Otro), implica la inscripción del goce pulsional en el vínculo social y lo sujeta a la ley que regula el goce en ese contexto vincular. El paso del goce al deseo implica la inscripción de la sexualidad en los desfiladeros del significante, con lo cual se da lugar a la constitución de una nueva modalidad de objeto, “el objeto del deseo”, que difiere fundamentalmente de los objetos parciales de las pulsiones y que tiene una dimensión fundamentalmente significante. 46 Hobbes Thomas, Leviatán. México: Fondo de Cultura Económica, 1982. p, 41.
  • 96 Esta dimensión significante del objeto del deseo, le confiere propiedades que lo van a diferenciar, claramente, del objeto de la pulsión, de un lado; y del objeto de amor, del otro. Mientras que el vínculo de las pulsiones con sus objetos respectivos se caracteriza por ser de una rigidez adictiva, el objeto de la pulsión se caracteriza por su movilidad metonímica de un significante a otro, movilidad que puede llegar a detenerse en virtud de la capacidad que tiene el amor de producir metáforas condensadoras. Pues bien, volvamos al principio. Lo que caracteriza al deseo es su trashumancia de un significante a otro; lo que caracteriza al amor es su condición de detener el movimiento del deseo en un significante particular. Esta diferencia aparentemente sutil tiene efectos muy importantes en la experiencia individual y grupal. Los individuos y grupos cuya experiencia se articula fundamentalmente desde la experiencia del amor (de los que ya hablamos), en cierto sentido, logran arreglárselas más o menos bien con el problema de la falta de objeto, en tanto que pueden vivir con la ilusión de que éste existe y su problema será, o bien el no poder alcanzar a este objeto, o no poder tenerlo totalmente, o no estar a la altura del amor del objeto, o estar expuestos a la angustia de llegar a perderlo, o no conseguir hacer lo suficiente para llegar a ser todo para ese objeto, etc. Los individuos y grupos, cuya experiencia se articula desde la perspectiva del deseo, están menos expuestos a los estragos de la idealización, pero tienen que estar permanentemente confrontados con la inminencia de la falta de objeto que les impone el desplazamiento del deseo de un significante a otro. Un grupo cuya tarea se articula bajo la forma del objeto del deseo en el lugar del agente va a tener características muy similares al caso que mencionamos anteriormente de un grupo causado por un objeto de amor. La diferencia será que, donde prima el objeto de amor habrá menos movilidad; mientras que allí donde el objeto tiene la condición de objeto de deseo habrá más movilidad y primará una lógica de relación dialéctica entre el objeto y el grupo. El objeto podrá cifrarse en articulaciones significantes cada vez diferentes y esto no alterará su potencia para suscitar el deseo de trabajo del grupo. En el tercer capítulo, titulado “La tarea en el lugar del agente del discurso del amo”, mencionamos que el significante “tarea” puede tener al menos tres sentidos diferentes: el primero sería una presencia expresada en rendimientos cuantificables, el segundo un proceso, en el sentido de una actividad transformadora; y el tercero, una representación meta, un significante que nombra algo que falta, es decir, “la presencia de una ausencia”. Pues bien, en un grupo operativo la tarea opera como objeto del deseo allí donde tiene este carácter de una representación meta que sirve de norte al quehacer del grupo. Un grupo articulado bajo la lógica del deseo puede llegar a ser menos “productivo” que un grupo que opera bajo la lógica del amor, pero es un grupo que le retribuye más a cada uno de sus participantes, que no demanda fidelidad, ni entrega, es un grupo menos expuesto a las estereotipias y menos proclive a atribuir a algunos de sus integrantes el rol de chivos emisarios.
  • 97 Un grupo que opera fundamentalmente a partir de esta lógica también tiene sus costados vulnerables. Por ejemplo, hay una mayor fragilidad en el vínculo de los integrantes con la tarea y de ellos entre sí, en comparación con los grupos que se articulan bajo otras lógicas vinculares como el discurso del amo, el discurso universitario, y el discurso de la histérica. Un deseo no brinda la misma certeza que un amo, una institución o un síntoma. Pero existe quizá otro riesgo más específico e indeseable, inherente a la naturaleza metonímica del deseo, para los grupos operativos articulados bajo la lógica de éste. Si se exacerba la propiedad del deseo de desplazarse de un significante a otro, este rasgo puede convertirse en una forma de enajenación grupal muy semejante a la banalidad de la moda. Esto lo podemos ver en aquellos grupos operativos que, pese a tener más o menos claro su objetivo, consumen sus energías en una redefinición permanente de la manera de lograrlo o en estar cambiando de una tarea a otra, lo cual produce un efecto de inestabilidad que puede llegar a favorecer el desarrollo de ansiedades entre sus integrantes o incluso amenazar la existencia misma del grupo. 3.4.4. La tarea, como objeto parcial, en el lugar del agente del discurso analítico Otro nombre del objeto “a” es objeto parcial y, en tanto que parcial, perdido por efecto de la ley de la castración. Nos referimos, por supuesto, al objeto de la pulsión, o mejor a los objetos de las pulsiones parciales: el pecho, las heces, la mirada y la voz. Recordemos que gracias a la reversibilidad propia de lo fantasmático, cada una de estas formas del objeto puede remitir a una modalidad particular de goce, que puede designarse a medias, con un verbo particular en forma activa y pasiva, sin que se excluyan la una a la otra, Vg. chupar y ser chupado (devorar y ser devorado); cagar y ser cagado (cagarse en el otro o hacerse cagar del otro); mirar y capturar la mirada del otro; y, finalmente, la pulsión que Lacan llama “invocante”, cuyo objeto no es la palabra sino algo más radical y más primario que está más allá, o mejor más acá de la palabra: la voz. Quizá el goce de “insultar” y “ser insultado” nos puede guiar en esta dirección, si entendemos el insulto en el sentido de una voz que golpea o con la que se es golpeado. Aquella definición clásica que Freud hace de la neurosis como una perversión negativa, nos advierte que el fantasma del neurótico es de naturaleza perversa; y, en consecuencia, no debe extrañarnos que el objeto “a”, entendido en este caso como objeto pulsional, tenga estas dimensiones inquietantes. En este caso, el objeto que causa al sujeto y que orienta su búsqueda, ya no se define en torno a un objeto amado o a un deseo escurridizo entre los significantes –aunque comparte algunos rasgos con estos, ya que se trata solamente de diferentes dimensiones de la misma “a”-, sino que debemos pensarlo bajo la forma de alguna de las fórmulas antes mencionadas relativas a los verbos que definen los objetos de las pulsiones, especialmente aquellas fórmulas que corresponden a la voz
  • 98 pasiva del verbo, ya que de acuerdo con Freud y Lacan, son más originarias y más radicales: ser chupado o devorado, ser expulsado (en el sentido de ser cagado) pero también ser convertido en heces, o ser mirado hasta el horror como le ocurre al paranoico. El objeto “a” tiene esa doble condición de ser a la vez objeto de fascinación y horror. Estamos, como puede notarse, sobre la vía de una dimensión del objeto “a” mucho más difícil de asir con palabras. No obstante, algo se puede formular, aún con todo el riesgo que implica tratar de apalabrar aquello que es fundamentalmente innombrable. La experiencia clínica y la experiencia colectiva nos muestran que existen individuos y grupos en los que el sentido de su historia, si se mira retrospectivamente, se puede sintetizar claramente en una sentencia corta encabezada por alguno de los verbos mencionados u otros con un sentido semejante. Esto puede ser particularmente diáfano en algunos individuos y en algunos grupos radicales −el cine se nutre permanentemente de ellos−, pero está presente en alguna medida en todo individuo y en todo grupo, sin excepción. Para poder leer esta dimensión del vínculo social es menester desprenderse del sentido común que nos indica que los individuos y los grupos son guiados por la búsqueda del bien-estar o la felicidad en cualquiera de sus formas. Uno de los hallazgos del psicoanálisis es justamente que existe un principio que empuja a los seres humanos a buscar lo peor. Muchas veces esta búsqueda del mal-estar se escuda tras la fachada de discursos de buenas intenciones, o “causas nobles”. Tal como lo decíamos, si se hace un análisis retrospectivo de la historia de ciertos grupos humanos que terminan en desenlaces funestos, quizá podamos situar ciertos hechos que aparecen en distintos momentos de la historia grupal y que permiten inferir que dicho desenlace no es solamente producto de factores externos adversos, errores o circunstancias accidentales; sino que es completamente congruente con la especificidad del grupo y, en un caso extremo, puede llegar a comprobarse que era el propósito secreto del grupo, en términos de Pichón Rivière, la tarea latente. Hay formaciones grupales, independientemente de cuál sea la coartada que usan como discurso manifiesto, cuya tarea latente es hacerse cagar por el Otro, tanto en el sentido de hacerse expulsar, como en el sentido de hacerse convertir en un desecho social; otras formaciones grupales definirían su vínculo con el Otro social como un afán de hacerse devorar, −usando la expresión popular, hacerse chupar la sangre, en el sentido de hacerse escurrir por el Otro−. Hay otros grupos en los que predomina una vocación que podríamos llamar pornográfica (los periodistas han acuñado el neologismo pornomiseria, para referirse a este fenómeno), cuya vocación es suscitar la mirada obscena y escandalizada del Otro, una mirada de repudio y fascinación. Finalmente, podemos decir también que hay formaciones grupales, efímeras y duraderas, informales y organizadas, en las que el goce de insultar y ser insultado es una parte fundamental de la dinámica grupal o institucional. No sobra subrayar nuevamente que, gracias a la reversibilidad propia del montaje gramatical fantasmático, el objeto podrá adquirir la forma de algo que traga o vomita, ensucia
  • 99 o es depositario de la inmundicia, mira como un basilisco o arrebata diabólicamente la mirada, es la voz alucinada que insulta y ordena o el objeto que suscita el deseo de denigrarlo, humillarlo o vituperarlo. Solamente estas modalidades de goce individuales y colectivas permiten entender la causa y la lógica de ciertas formaciones colectivas, generalmente marginales (no siempre), que no pueden ser explicadas de otra manera. Pero si somos un poco sutiles y no nos empeñamos en buscar las formas puras de estos grupos, podemos encontrar que existen muy diversas agrupaciones (políticas, religiosas, académicas, etc.) que no se diferencian entre sí en su tarea manifiesta, pero que podemos diferenciar muy claramente, si lo hacemos desde este punto de vista de la tarea latente. Es decir, en cualquier campo específico podemos encontrar muchas agrupaciones que supuestamente buscan los mismos fines, pero que en los resultados que producen, tanto en sus integrantes como en su relación con el resto del conjunto social, tienen diferencias notorias. En algunos casos extremos la finalidad manifiesta revela ser sólo una coartada para la puesta en marcha de goces inconfesables. Podemos llevar un poco más lejos esta ilación de ideas y suponer que en todo grupo están presentes, de una u otra manera, en mayor o menor medida, estas modalidades de goce u otras análogas y que no solamente son inevitables sino necesarias para la constitución y el mantenimiento de los grupos. La importancia que tiene una reflexión como ésta para el análisis de los grupos en general y en particular del dispositivo pichoniano, tiene que ver justamente con que constituye una herramienta valiosa para un coordinador de grupo saber leer estas modalidades de goce en las dinámicas grupales, no para extirparlas, sino para identificar cuándo están operando al servicio de la preservación y desarrollo del grupo y cada uno de los integrantes y cuándo se convierten en un síntoma que pone al grupo en la lógica de la repetición inútil y destructiva. Otro de los nombres del objeto “a” en el psicoanálisis lacaniano es el “plus de goce”, el cual puede entenderse en el sentido del exceso de goce, es decir de un excedente de una operación en el sentido de la plusvalía, o también como un residuo tanto en el sentido que tiene este término en las operaciones matemáticas, como en el sentido de desecho. Esta acepción del plus de goce nos pone sobre la vía de las diversas formas de la desmesura con sus efectos destructivos y resulta muy operativa para pensar muchas patologías individuales y colectivas que tienen que ver con los excesos. Eric Laurent, aludiendo al texto bíblico, dice que allí donde hay dos o más, siempre está presente en medio algo del goce47 . En efecto, el psicoanálisis nos sirve fundamentalmente para develar el goce que opera como causa del acontecer grupal en sus diversas formas. El discurso analítico nos permite iluminar esa dimensión que podemos llamar, parafraseando a George Bataille, “la parte maldita” del grupo. 47 Cf. Laurent E. El analista ciudadano.
  • 100 No hay grupos de ángeles, así como “no hay almas bellas”. La pregunta por el objeto de goce de cada formación grupal, no solamente ha de ser un principio fundamental para todo investigador de los fenómenos colectivos, sino que es una herramienta básica de trabajo para todo coordinador de grupos operativos. ¿De qué está gozando el grupo? He ahí una pregunta que el coordinador debe hacerse en todo momento, especialmente cuando aparece un síntoma, o cuando transcurre un período de sesiones impecables, como crímenes perfectos. Las distintas versiones del objeto que mencionamos pueden servir de guía a un coordinador para buscar la respuesta a esta pregunta: ¿cuál es el sentido que tienen determinados excesos reiterativos en el acontecer grupal’. Hay que decir que algunas de las nociones que introdujo la psicología social de Enrique Pichón en el análisis de los fenómenos de grupo, tales como portavoz, estereotipia, emergente y chivo emisario, son potentes instrumentos para develar los goces propios de la vida colectiva. El dispositivo pichoniano es un espacio en el que, con ocasión de cualquier tarea manifiesta, un grupo puede confrontarse con esa otra dimensión latente de la tarea relativa a estas modalidades de goce (a), que lo determina como un imperativo mudo. Así el producto del trabajo grupal no será solamente una obra en el sentido fáctico de su objetivo, sino el develamiento de estos goces que devienen amos silenciosos (S1) que inciden de una manera determinante en todo acontecer grupal 3.4.5. La tarea, como semblante de la falta de ser, en el lugar del agente del discurso analítico Un último nombre del objeto “a” que vamos a mencionar sería la “falta de ser”, fórmula que condensa de manera formidable las versiones anteriores de esta noción lacaniana. El precio de la humanización es la pérdida del ser. Un animal no tiene ese problema que sí tenemos los humanos. Un animal no tiene cómo preguntarse “quién soy” porque no tiene lenguaje, pero tampoco lo necesita porque su ser está determinado desde antes de su nacimiento por sus instintos, que están escritos como un saber en sus códigos genéticos. Por ello, podemos decir que cada animal tiene su ser bajo la forma de lo que Heidegger llama “el ser del ente”, que sería algo así como la animalidad del animal −la “oqueidad” de una oca, por ejemplo−. Un ganso no tiene que preguntarse cómo ser ganzo, sus instintos operan como una batería de respuestas que garantizarán que siempre responda como un ganso y no como una oca. El animal no tiene problema con su ser, porque no puede ser sino lo que es. Con los seres humanos ocurre todo lo contrario, la pérdida del registro instintivo tiene como consecuencia la pérdida del ser. Los humanos podemos definirnos como animales que perdimos el ser. Y la condición de hablantes determina que es en el lenguaje donde el sujeto desplegará la búsqueda del ser perdido; en otras palabras, su deseo de ser. Los seres humanos permanentemente nos estamos preguntando por nuestro ser: ¿qué soy o quién soy?, ¿soy un hombre o soy una mujer?, ¿cómo ser padre,
  • 101 amigo, profesional, esposo?, ¿cómo ser verdaderamente lo que soy o creo ser? Este deseo de ser que se articula bajo la forma de la pregunta por el ser, nunca tendrá una respuesta rotunda, lo cual garantiza que los humanos estemos siempre andando de un significante a otro, sin poder colmar nunca nuestra falta de ser. Así pues, vemos como la fórmula “falta de ser” nos permite articular nociones como “objeto perdido”, “falta de objeto de la pulsión”, “objeto del deseo”, etc. Volvamos a la fórmula original del discurso del analista. La falta de ser es aquello que nos causa como sujetos deseantes (“a”→$), tanto a los individuos como a los grupos. El objeto real que causa nuestro deseo, en últimas, es un vacío radical, un agujero insondable e irrepresentable que inicia en los límites del universo simbólico e imaginario que habitamos. “La locura”, “la muerte”, “el caos”, “el goce”, son algunos significantes que apenas indican la existencia de esa dimensión de lo humano y lo grupal imposible de simbolizar. Esa nada de la que venimos y hacia la que vamos es, paradójicamente, lo que nos hace producir como sujetos y como grupos. Se trata de un caso insólito de causalidad negativa. La falta de ser, o la falta a secas, en el lugar del agente que determina una operación vincular, garantiza que el grupo que se constituye en el lugar del otro convocado por esa falta fundamental en el lugar del agente, siempre tenga garantizada la existencia de una tarea que, es interminable por su definición misma, mientras la falta se mantenga en el lugar de la causa del grupo y que implica necesariamente la dimensión creativa, ya que desde el lugar del agente no hay una voluntad, ni un saber, ni una queja que determinen de antemano la producción grupal. Es quizá por esa misma falta de determinación de la tarea del grupo desde el lugar del agente, por lo que esta modalidad vincular del discurso analítico es particularmente favorable para que un grupo se confronte mediante su propia producción con las determinaciones más íntimas que constituyen sus modalidades de goce. A la vez hay que decir que para que un grupo se pueda sostener en esta lógica vincular de una manera más o menos consistente, se requieren ciertas condiciones especiales en el conjunto que no se encuentran fácilmente; todo lo contrario, lo más usual es encontrar grupos que buscan amos, verdades estables, o un destinatario para su queja. Pero, nuevamente, procuremos escapar a la tentación de tratar de encontrar esencias, o grupos que se definan por exhibir de una manera más o menos pura esta modalidad vincular, y tratemos mejor de pensar este tipo de vínculo en función de los momentos lógicos por los que suele atravesar un grupo, y en este caso en particular un grupo operativo. Podemos estar de acuerdo en que la modalidad del vínculo analítico difícilmente se puedan encontrar en la fase de la pretarea y la tarea del grupo, es más probable que un grupo logre esta modalidad vincular en la fase del proyecto, ya que esta fase implica que el grupo ya está lo suficientemente maduro, es decir en el tercer tiempo que Gladys Adamson menciona en El silencio y la mirada en los grupos operativos, en el que el grupo puede soportar la diferencia y la pluralidad ($), sin que derive en una rivalidad
  • 102 imaginaria, y sin que se trate de denegar mediante ilusiones de armonía plena. A la vez el grupo ya cuenta con la madurez necesaria para soportar confrontarse de una manera más o menos permanente con el lado oscuro de sus goces secretos (S1), sin que esto se viva como una amenaza desestructurante. Esa madurez grupal implica un cierto saber hacer con la técnica, pero más que ello un cierto saber colectivo construido en el proceso grupal (S2), no tanto de los alcances como de los límites del grupo, es decir que el grupo no puede colmar las demandas de felicidad, de certezas, de amor, saber, o sentido de sus integrantes. Esa madurez, que solamente se puede alcanzar en la fase del proyecto, es la condición para que el lugar del agente no tenga que ser ocupado por un padre, un maestro o un problema y pueda dejarse vacío (a) para dar lugar a una producción creativa, no entendida en un sentido absoluto como un inédito radical, sino como una producción a la altura del grupo que tenga su propia marca. Antes de finalizar es importante advertir, una vez más, -nunca sobra una advertencia en este sentido-, que estas modalidades vinculares que hemos presentado son matrices abstractas. Difícilmente se encontrará un grupo operativo que se mantenga de una manera más o menos estable de acuerdo con una de ellas, incluso sería un grupo muy extraño por su alto grado de estereotipia. Lo más común es que cada grupo adoptará una modalidad vincular diferente en cada momento, de acuerdo con su particularidad; incluso en una misma sesión de trabajo, un mismo grupo puede pasar de una modalidad vincular a otra, en función de una intervención del coordinador o cualquier otro acontecimiento. También es importante advertir, por contrapartida, que este argumento no debe servir de justificación a un coordinador, por ejemplo, para mantenerse cómodamente en el lugar de amo o educador, en nombre de la alternancia de los discursos. Si bien es cierto que en algunos momentos del trabajo en los grupos operativos es necesaria la lógica del discurso del amo o el discurso universitario, estamos autorizados a interrogarnos sobre lo que ocurre con un grupo que tiende a mantenerse preferentemente en estas dos lógicas vinculares, ya que son más acordes con la naturaleza del grupo operativo la lógica del discurso de la histérica y del discurso analítico.
  • 103 44444444........ EEEEEEEELLLLLLLL CCCCCCCCOOOOOOOOOOOOOOOORRRRRRRRDDDDDDDDIIIIIIIINNNNNNNNAAAAAAAADDDDDDDDOOOOOOOORRRRRRRR CCCCCCCCOOOOOOOOMMMMMMMMOOOOOOOO AAAAAAAAGGGGGGGGEEEEEEEENNNNNNNNTTTTTTTTEEEEEEEE EEEEEEEENNNNNNNN LLLLLLLLOOOOOOOOSSSSSSSS CCCCCCCCUUUUUUUUAAAAAAAATTTTTTTTRRRRRRRROOOOOOOO DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOOSSSSSSSS Por:Por:Por:Por: María Paulina MejíaMaría Paulina MejíaMaría Paulina MejíaMaría Paulina Mejía 44444444........11111111........ EEEEEEEELLLLLLLL CCCCCCCCOOOOOOOOOOOOOOOORRRRRRRRDDDDDDDDIIIIIIIINNNNNNNNAAAAAAAADDDDDDDDOOOOOOOORRRRRRRR YYYYYYYY EEEEEEEELLLLLLLL DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOO DDDDDDDDEEEEEEEELLLLLLLL AAAAAAAAMMMMMMMMOOOOOOOO 4444.1.1.1.1.1..1..1..1. Sobre el rol del coordinadorSobre el rol del coordinadorSobre el rol del coordinadorSobre el rol del coordinador Antes de articular el discurso del amo con el rol del coordinador en el contexto de la técnica de grupos operativos, es importante hacer una primera aproximación sobre dicho rol tal como lo propone Pichón -Rivière. Digamos en principio que el coordinador es un lector del devenir grupal, o como dice Pichón: “Como signo, lo que denuncia el portavoz debe ser decodificado, es decir, hay que quitarle su aspecto implícito. De esta manera es decodificado por el grupo – particularmente por el coordinador – que señala la significación de ese aspecto”48 . Esta afirmación puede derivar en las siguientes premisas. En primer lugar, podemos decir que si el coordinador es lector, es decodificador, ello le da un carácter de intérprete de una serie de sucesos grupales. Y si los sucesos grupales son susceptibles de ser interpretados es porque ellos tienen el estatuto de mensajes, de significantes o implícitos a descifrar. Los grupos producen, entonces, significantes que deben ser leídos por alguien. Y leer supone “entender el significado”49 , a lo que se podría agregar que los significados serán un producto del acto de la lectura, un producto inédito al transcurrir de cada grupo. Es decir, algo que resulta de la interpretación y que no podrá ser trasladado a todos los grupos. Cada uno de ellos tendrá sus implícitos y explícitos particulares. En palabras de Pichón podemos decir que el coordinador estará atento a la aparición de un portavoz, quien hace emergente un existente con su hacer o decir, procurando que eso emergente pueda ser elaborado por el grupo. Esos emergentes serán los significantes particulares del grupo, que deben ser descifrados gracias a un proceso de elaboración que deberá facilitar el coordinador con sus recursos técnicos. En tal sentido, el coordinador facilita que se explicite una verdad grupal, verdad que empieza a ser nombrada por el portavoz, pero que debe ser elaborada por todo el grupo. 48 Pichón−Rivière, Enrique. El proceso grupal. Del psicoanálisis a la psicología social (1). Buenos Aires: Nueva Visión, 2001. Pág. 221. 49 Gómez de Silva, Guido. Breve diccionario etimológico de la lengua española. México: Fondo de Cultura Económica, 2001, Pág.411.
  • 104 Otro aspecto que podemos derivar del quehacer del coordinador es que si su función es ayudar a que una verdad se explicite, es porque ella se está convirtiendo en un obstáculo para la realización de la tarea que convoca al grupo. Es porque siempre habrá algo que se oponga al trabajo, que la función del coordinador tiene sentido. Si lo que acompañara a los grupos fuese siempre una voluntad de trabajo y un deseo de saber, la presencia de un tercero sería inoperante. Pero la realidad grupal parece indicar otra cosa; ella siempre contará con impases, con obstáculos a resolver, con “resistencias” que deben ser analizadas e interpretadas; es decir que se debe producir el significado de lo que le sucede al grupo. Podría uno expresar con Lacan que lo simbólico se debe tomar lo imaginario para desarticular el poder que este último tiene, el cual, bien sea del lado del amor o del odio, se convierte en un obstáculo para el trabajo, tanto a nivel clínico como grupal. Este aspecto es claramente ilustrado por la licenciada Gladys Adamson50 , quien sistematiza una experiencia de grupos operativos pudiendo ordenar la lógica que se presenta en los grupos en varias fases. La primera de ellas está caracterizada por la hostilidad, en la cual, todo lo ajeno es amenazante. En la segunda fase, por el contrario prima el amor tanto a los miembros, como a la tarea y al coordinador. Es una fase que puede impedir la construcción de un nuevo saber, pues lo que la caracteriza es una tendencia a la homogeneización; lo diferente es excluido, protegiendo la ilusión de la unidad. En la tercera fase, se podría decir que el amor se desplaza al saber con tal fuerza que la figura del coordinador deja de ser tan protagónica. Podemos insistir diciendo que la función del coordinador es facilitar la construcción de un producto que tiene el carácter de verdad, carácter que se lo da el efecto que a posteriori produce en el grupo. Ello implica que el coordinador no interpreta desde un saber previo, su misión no será favorecer la adoración de un saber éxtimo. Esta afirmación supone que quien esté en ese lugar puede intervenir desde el lugar de la verdad, esperando que el grupo produzca eso que él piensa, interpreta los decires del grupo, e incluso lo que verbaliza el portavoz a partir de su erudición. Ello deja al grupo vacío de saber y alienado por completo al discurso del otro. Este tipo de interpretaciones supone que los significantes tienen un único significado; y ésta es precisamente la vertiente imaginaria de la construcción de sentido, vertiente opuesta a un abordaje simbólico, el cual supone que los significantes tiene múltiples sentidos, y ello obedece a lo más singular del grupo. Por lo tanto, será sólo la cadena significante del mismo grupo la que señale el sentido. La función del coordinador desde la vertiente simbólica supone que él sea quien facilite que el grupo produzca sus significantes y sus significados. Para ello se servirá de las técnicas que permitan esta producción. Esto es lo fundamental de la técnica, pues también puede ser utilizada con otros fines muy diversos como es la recreación, mientras que el fin de la técnica que utiliza el coordinador en grupo operativo es la producción de un saber inédito. 50 Adamson, Gladys. Fases y Mitos en grupo operativo. Buenos Aires: Nueva Visión. 1977.
  • 105 La técnica que introduce el coordinador es una operación en el discurso grupal que permitirá verbalizar esos nudos significantes que se cristalizan en el grupo como una fantasmática que interfiere con la relación al saber, operación que a su vez posibilitará retomar el hilo del trabajo que convoca al grupo, trabajo que siempre se verá impedido por el retorno de algo que como resistencia impide el aprendizaje. Esta fantasmática grupal pasará por unas fases como bien lo plantea Adamson en su texto Fases y mitos en grupo operativo, que oscilan entre la hostilidad y el amor, para finalmente desembocar en un deseo de saber, en una “curiosidad” que sobrepase los avatares imaginarios. En otras palabras, el coordinador ayuda al grupo en la tarea implícita de nombrar esos fantasmas que distraen al grupo, que hacen ruido, impidiendo construir una comunicación que construya sentidos. Dichos fantasmas, según Pichón, generalmente están asociados a dos miedos básicos: el miedo a la pérdida y al ataque. Es decir, el otro −grupo, coordinador o tarea− se puede constituir para los sujetos y para el grupo mismo en una amenaza y cuando ello se cristaliza es cuando aparece la inercia, la pesadez, la falta de deseo. Es en este punto en el cual el coordinador debe intervenir para favorecer que eso que le pesa al grupo pueda ser nombrado. En palabras de Pichón podemos decir: “el coordinador cumple en el grupo el rol prescrito, el de ayudar a los miembros a pensar, abordando el obstáculo epistemológico configurado por las ansiedades básicas”.51 4444.1.1.1.1.2..2..2..2. El coordinador y los cuatroEl coordinador y los cuatroEl coordinador y los cuatroEl coordinador y los cuatro discursosdiscursosdiscursosdiscursos Lacan nos ha aportado una batería conceptual para pensar diversas modalidades de vínculo social: los cuatro discursos, de los cuales nos serviremos para pensar en la función del coordinador y sus diversos efectos a nivel grupal. Sobre elSobre elSobre elSobre el coordicoordicoordicoordinador ynador ynador ynador y elelelel discurso del Amodiscurso del Amodiscurso del Amodiscurso del Amo Antes de iniciar recordemos como se sitúan los cuatro elementos en los cuatro lugares posibles bajo la lógica del discurso del amo: (Agente) S1 (saber) S2_ (Verdad) S (producto) Objeto a Digamos que cuando el coordinador se sitúa en el lugar del S1 aparece como quien se identifica con la ley, con la verdad. Habla desde la certidumbre sin dejar espacios para el enigma. Es quien legisla, vigila, castiga, pide sometimiento a su voluntad, es quien tiene la última palabra. Le importa que todo marche, que todo esté bajo control. De este modo se defiende de la angustia que le suscita la falta, la incertidumbre, lo relativo. En otras palabras, se defiende de no saber, de su propia castración, esa es la verdad que trata de ocultar bajo sus intervenciones sin fisura. 51 Pichón−Rivière, Enrique. Diccionario de términos y conceptos de psicología y psicología social. Buenos Aires: Nueva Visión, 1988. Pág. 44
  • 106 El coordinador en el lugar del S1 produce unos efectos en el grupo, el cual estará en el lugar del S2. El grupo construirá un decir que intente coincidir con aquello que el coordinador quiere escuchar, quien en consecuencia logrará satisfacer su narcisismo y quedará complacido con el grupo. El grupo logra develar cómo goza el coordinador, y lo satisface para aplacar su malestar. Cuando no se da esta subordinación es posible que el coordinador descalifique al grupo por su creciente ignorancia, produciendo en él la identificación con el desecho. Es decir que el producto será el objeto “a” en su dimensión de resto y, como es lógico, no se producirá un deseo de saber sobre la tarea que convocó al grupo. Es así como desde el discurso del amo si algo no marcha, ello no será tomado como un elemento significante a descifrar; podrá ser tomado por el coordinador como señal que revela la incapacidad del grupo. En tal sentido, si el coordinador está en el lugar de la verdad, podrá abordar la aparición de un emergente grupal, bien desde su erudición o bien desde la sanción o juicio de aquello que no le permite al grupo trabajar. Podrá descalificarlo, más no propiciará la construcción de un producto grupal que devele el sentido de lo que los detiene en el proceso de aprendizaje. Esto significa que el coordinador responde desde lo imaginario y lo real. Desde la vertiente imaginaria, se podrá involucrar en lo que le sucede al grupo como si fuese un ataque contra él. Y desde lo real, se puede decir que eso que retorna en el grupo como lo que se opone al trabajo, le recuerda al coordinador su castración, y ello le puede generar angustia, una de las manifestaciones de la cercanía de lo real. Para librarse, entonces, de ese malestar, responde con unos S1 que intenten ordenar eso que se opone al transcurrir monótono del grupo. Ello, lógicamente, favorece el incremento de la resistencia como un obstáculo para la construcción de un saber relativo a los malestares grupales. Esto de entrada desvirtúa uno de los objetivos fundamentales del grupo operativo. Desde esta lógica, el portavoz se puede convertir para el coordinador en un saboteador y, en consecuencia, lo sanciona pues no le interesa que se devele algo que se oponga a “un buen funcionamiento grupal”. Toda tiranía tiene su saboteador, quien se opone a dejarse gobernar por el amo, reduciéndolo con su rebeldía a la impotencia. El coordinador responderá como amo ante la diferencia que le resulta amenazante y que le recuerda que no existe lo uno sino lo múltiple. Quizás lo que sucede en un grupo operativo bajo el discurso del amo sea una aparente calma, todos los integrantes repitiendo lo que dice el coordinador o el texto. Estos son grupos que no producen nada inédito, pues se supone que la verdad ya está construida y sólo resta repetirla. Bajo estas condiciones, el grupo hablará metonímicamente, sin que el coordinador con su intervención ayude a la producción de sentido. Lo anterior nos conduce a reflexionar sobre el tipo de comunicación que se espera de un grupo operativo. El indicativo de la operatividad de un grupo no radica en la ausencia de silencio y en las múltiples intervenciones que se produzcan en una
  • 107 sesión. No es operativo el grupo que más habla, esto depende del tipo de producto del acto comunicativo. Ya sabemos que el producto que arroja el discurso del amo en un grupo operativo es el “a”, como ese resto, ese objeto al que quedan reducidos los participantes, apabullados por la multiplicidad de S1 que impone el amo. Desde otro tipo de vínculo, se espera que el coordinador sea el lector de la lógica del devenir grupal; lectura que deberá ser compartida por el grupo. Ello significa que el grupo es operativo si hay producción de nuevos sentidos. Sobre este punto, Pichón anota: “en estas técnicas grupales, la función del coordinador o copensor consiste esencialmente en crear, mantener y fomentar la comunicación, llegando ésta, a través de un desarrollo progresivo, a tomar la forma de una espiral, en la cual coinciden didáctica, aprendizaje, comunicación y operatividad”.52 Si la comunicación debe tomar la forma de una espiral es porque en ella habrán momentos de apertura y de cierre, momentos de estereotipia que se deberán deslizar hacia la nueva producción de sentido. Pero si ésta se queda en la repetición, se afectará el proceso de aprendizaje, pues éste es facilitado u obstaculizado tanto por lo intersubjetivo como por lo intrasubjetivo.53 En otras palabras, si el grupo operativo está inmerso en el discurso del amo será muy probable que su comunicación se estereotipe como efecto de la dinámica que impone el agente y a la que se somete el grupo. Otra de las consecuencias que puede tener el discurso del amo en el funcionamiento del grupo operativo es que éste no logre pasar de la pretarea a la tarea, en el sentido de constituirse en un grupo causado por un deseo de saber. Quizás se conforme un grupo, pero no en el sentido operativo. Ello significa que podrá establecerse entre los miembros un vínculo identificatorio y hacia el líder una admiración o incluso un sometimiento teñido de odio; pero en ningún caso se logrará instalar un amor al saber, como el motor fundamental del trabajo. Las anteriores son algunas de las consecuencias que puede tener en un grupo operativo que el coordinador se sitúe en el lugar del S1, propio del lugar del agente en el discurso del amo. 44444444........22222222........ EEEEEEEELLLLLLLL CCCCCCCCOOOOOOOOOOOOOOOORRRRRRRRDDDDDDDDIIIIIIIINNNNNNNNAAAAAAAADDDDDDDDOOOOOOOORRRRRRRR DDDDDDDDEEEEEEEESSSSSSSSDDDDDDDDEEEEEEEE EEEEEEEELLLLLLLL DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOO UUUUUUUUNNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEERRRRRRRRSSSSSSSSIIIIIIIITTTTTTTTAAAAAAAARRRRRRRRIIIIIIIIOOOOOOOO “El dios indica al hombre que la esfera divina es ilimitada, insondable, caprichosa, insensata, carente de necesidad, arrogante, pero su manifestación en la esfera humana suena como una norma imperiosa de moderación, de control, de límite, de racionalidad, de necesidad”. Giorgio Colli 54 4444.2.2.2.2.1. A modo de introducción.1. A modo de introducción.1. A modo de introducción.1. A modo de introducción 52 Ibíd.,. Pág. 44. 53 Ibíd.,. Pág. 22. 54 Colli, Giorgio. El nacimiento de la filosofía. Barcelona: Tusquete editores, 1994. Pág. 39
  • 108 Antes de iniciar la reflexión sobre las consecuencias en el devenir del grupo operativo del posicionamiento del coordinador en el lugar del agente en el discurso universitario, es menester hacer algunas precisiones sobre dicho discurso. Digamos en principio cual es la ubicación de cada uno de los cuatro términos en cada uno de los lugares que conforman cualquier discurso: Agente = S2 __ Otro = a_________ VERDAD = S1 PRODUCCIÓN = S Como puede observarse, en el lugar del agente encontramos al S2, lo cual significa que es el saber o la razón lo que viene a constituirse en el amo moderno. En otras palabras, allí donde Dios reinaba con su sapiencia, hoy reina la ciencia con su voluntad oculta de sometimiento; esa es la verdad que subyace tras el S2, en tanto la ciencia se ha convertido en el garante, en la certeza que puede validar o no cualquier tesis. Es común encontrar en las conversaciones más cotidianas afirmaciones que intentan respaldar cualquier argumento bajo la premisa “es que la ciencia lo demuestra...”, afirmación que se convierte en un criterio moderno de validez, que interrumpe cualquier dialéctica posible. Al convertirse el saber en amo, éste no se puede cuestionar. Innovar, interrogar, se constituye para cualquier disciplina que funcione bajo esa lógica en una amenaza, en una herejía. Es así como los autores y sus teorías se sacralizan, se vuelven intocables, se convierten en ortodoxias, con todo el peso etimológico de esta palabra. Orto viene de recto, doxia deriva de opinión, por tanto, cualquier disciplina se puede constituir en una ortodoxia cuando supone que tiene la verdad, que en ella no hay errores o puntos sin explicar. Nada más lejano, entonces, a la investigación que el S2 en el lugar del agente. Sin embargo, podríamos señalar una bondad de este discurso en la formación de cualquier espíritu investigador: poder conocer la tradición, lo existente, lo ya dicho, y eso es posible en el discurso universitario, conocer los S2 que ya circulan, que ya están previamente ordenados. Bien, ahora pensemos un poco qué sucede cuando en el lugar del Otro está la a. Aquí encontraríamos el lugar de la ignorancia, una posición de goce en la falta con respecto al saber, la cual contribuye enormemente para que en el claustro de enseñanza tradicional el docente se convierta para sus alumnos en un Dios omnisapiente. Aquel sujeto que nunca se autoriza será proclive a sostener este tipo de discurso y será seguramente quien no podrá nunca abandonar esta posición tradicional de estudiante, pues bajo este discurso será un recipiente vacío que debe ser llenado de un conocimiento que ya le preexiste. ¿Qué efectos, o mejor, qué producto arroja esta relación de subordinación a un saber ya establecido? Un S barrado que viene a representar una alienación y sometimiento a quien se supone tiene la verdad, una falta que siempre va a desautorizar e inhibir a las personas para decir lo que piensan. Este es el alumno o
  • 109 el participante de un grupo operativo que un coordinador ubicado en el lugar del agente del discurso universitario, necesita. 4444.2.2.2.2....2. El coordinador de grupo operativo y el discurso universitario2. El coordinador de grupo operativo y el discurso universitario2. El coordinador de grupo operativo y el discurso universitario2. El coordinador de grupo operativo y el discurso universitario Ya sabemos que el discurso universitario es una variante del discurso del amo. Ello nos anticipa una gran cercanía en los efectos y modo como opera un coordinador en el lugar del agente en ambos discursos. Es así como la voluntad de amo del coordinador en el discurso universitario se esconde tras el saber que promueve, saber que podrá ser el texto mismo. Para ilustrar esta premisa nos vamos a apoyar en cuatro modalidades del saber: el religioso, el científico, el técnico, el filosófico. 4444.2.2.2.2....2.1 El saber religioso2.1 El saber religioso2.1 El saber religioso2.1 El saber religioso Este saber se estructura básicamente sobre dos ejes: el sentido de la vida y de la muerte. Dos enigmas que han inquietado a los seres humanos en todos los tiempos. En este punto, cada religión estructura respuestas que se constituyen en dogmas de fe, es decir, en verdades indemostrables e incuestionables. Quien ponga en tela de juicio alguno de sus preceptos correrá el riesgo de ser expulsado de la congregación de fieles, quienes se constituyen en el Otro de esta modalidad del discurso universitario. El fiel es quien tiene fe, quien tiene una convicción. Si pone en cuestión alguno de los dogmas dejará de ser fiel. Ahora, este poner en cuestión puede derivar de la palabra o de los actos. Es decir, el fiel puede interpelar el saber constituido porque no está de acuerdo con algo; o de otro modo puede, con sus actos, desdecir su creencia, con lo que se constituiría en un pecador. Éste sería el producto arrojado, pues se convertiría en un ser en falta, en un culpable que debe redimir su acto. Digamos que el pecado es “la trasgresión de un precepto religioso o moral”.55 Los representantes del saber religioso serán los obispos, pastores o figuras de autoridad de cada religión. Ellos serán los encargados de transmitir la verdad que generalmente está consignada en un texto sagrado. ¿Qué oculta el saber religioso que opera bajo la modalidad del discurso universitario? El sinsentido, el S1 en el que se constituye la vida y la muerte, ese vacío de saber que es llenado con S2 para intentar erradicar la angustia que lo indecible produce. La cercanía de este tipo de saber con el funcionamiento de ciertos grupos operativos, se encuentra cuando el imperativo implícito que allí circula es la adoración y sacralización de los textos; es la dimensión de lo intocable de las formulaciones de cierto autor estudiado lo que acerca esa experiencia al saber religioso. Si el coordinador promueve en el grupo una relación de sometimiento a 55 Gómez de Silva, Guido. Breve diccionario etimológico de la lengua española. México: Fondo de Cultura Económica, 2001. Pag. 527
  • 110 todos los preceptos estudiados, si sanciona cualquier interpelación con juicios morales, si evita como un mal mayor la puesta en cuestión, estaremos cercanos a un grupo de feligreses frente a un amo disfrazado de erudito. 4444.2.2.2.2....2.2 El saber científico: el académic2.2 El saber científico: el académic2.2 El saber científico: el académic2.2 El saber científico: el académicoooo Encontramos reunidos en esta modalidad aquellos saberes llamados científicos que generalmente tienen como escenarios los claustros universitarios y que esperan que el otro (los estudiantes) puedan dar garantía de lo aprendido y con ello puedan ser acreedores de un título. El coordinador, en este caso el docente, pone el texto en el lugar del saber, en el lugar del amo. El estudiante deberá repetir lo allí escrito sin posibilidades de ponerlo en cuestión. Digamos con Pichón que se promueve una relación dilemática con el saber, en donde sólo se cuenta con dos posibilidades, lo tercero, lo incierto está excluido. Lo dilemático se opone al cambio y sólo favorece o bien la sumisión a lo establecido, un sí permanente, o bien una oposición que será borrada como algo impropio de la academia. La dialéctica, como favorecedora de la contradicción, como punto de partida para la creación, no tiene lugar en el discurso universitario, pues éste le impone al otro (a con minúscula) la repetición. Quien se oponga a este imperativo superyoico perderá la materia, estará en falta y no tendrá otro camino que la validación para recuperar, es decir, repetir el saber preestablecido. En esta modalidad del discurso universitario, la verdad que subyace al S2 es un no querer saber, el cual se representa con el S1, como verdad preestablecida, como voluntad de goce al gobernar y someter a los otros a la teoría que el docente como coordinador representa. Digamos que es otro modo de gobernar a un grupo, subordinándolo a una teoría que, como el saber religioso, se convierte en ortodoxia en el punto en el cual interrumpe cualquier cuestionamiento. Nada menos operativo, entonces, que el saber científico, pues se opone al aprendizaje tal como lo entiende Pichón. En primer lugar, favorece la estereotipia, es decir “movimientos o actos que se repiten en la misma forma dando la apariencia de una actividad automática. Sin embargo estos movimientos o actitudes tienen un contenido comprensible y una finalidad”.56 Con Lacan podríamos decir que la finalidad última de la estereotipia es conservar el lugar del poder que tiene quien se encarga de transmitir ese saber, es conservar ese goce derivado de su voluntad de amo. En segundo lugar, “este aprendizaje será facilitado u obstaculizado según que la confrontación entre el ámbito de lo intersubjetivo y el ámbito de lo intrasubjetivo resulte dialéctica o dilemática; es decir, que el proceso de interacción funcione como un circuito abierto, de trayectoria en espiral, o como un circuito cerrado, viciado por la estereotipia... Si el pensamiento queda demasiado tiempo cerrado en una determinada estructura, se estereotipia y se hace forma”.57 Por lo tanto, el saber científico promueve la repetición de fórmulas ya establecidas. 56 Pichón Rivière, Enrique. Diccionario de términos y conceptos de psicología y psicología social. Buenos Aires: Nueva Visión, 1988. Pág.63 57 Ibíd. Pág.23
  • 111 4444.2.2.2.2....2.3 El saber técnico: el artesano2.3 El saber técnico: el artesano2.3 El saber técnico: el artesano2.3 El saber técnico: el artesano En el discurso del amo se presenta el saber del esclavo en posición de S2, a la derecha del esquema. En el discurso universitario el S2 está en el lugar del agente. Si hacemos ingresar el saber técnico a este discurso, podemos decir que se trata de un saber hacer relacionado con el trabajo. No se trata, por tanto, del saber genético, se trata de un saber hacer que involucra el lenguaje articulado y el desarrollo de habilidades que permitan el desempeño escolar, social y productivo. Y como toda habilidad, es un saber que se transmite haciendo, sin que se requiera para ello de la episteme o de la reflexión sobre la lógica de los actos. Se trata de desplegar unas técnicas que garanticen un hacer adecuado. Luego de esta adecuación, sólo resta la repetición. El artesano está muy cercano a este saber técnico; cultiva unas destrezas y realiza en serie distintos objetos; esto lo diferencia del artista, quien lucha contra la repetición; la habilidad no es suficiente para la creación, para la construcción de algo inédito. El artista en este punto siempre se enfrenta al no saber, sin embargo, no puede dejar de intentar crear, como decía McEscher: “Lo que normalmente falta es el deseo incontenible de expresarse apretando los dientes con obstinación y diciendo: aunque no puedo hacerlo, sigo queriendo hacerlo”. El técnico sabe lo que hace, en tal sentido, un coordinador bajo esta modalidad del discurso universitario será aquel que sabe qué procedimiento aplicar frente a cada circunstancia. Digamos que existe para él un S2 como especie de manual de procedimientos. Ello implica que el otro no cuenta en su singularidad, el devenir grupal no será para el técnico algo a descifrar, sino un a priori. En tal sentido, el grupo será un medio y ello tendrá como efecto – o producto – un malestar por ese borramiento de su singularidad. El saber técnico le permite al coordinador gobernar bajo la ilusión de la completud, de la ausencia de falta. Por ello tratará de tenerlo todo bajo control, es decir, bajo ese saber hacer ya preestablecido. El coordinador que, por el contrario, se acerque al artista, estará ubicado en otro discurso, quizás más cercano al analítico. Como puede observarse, el saber técnico promueve la estereotipia en la utilización de las estrategias. Podemos aquí encontrar grupos que utilizan diversas técnicas o instrumentos de intervención, pero cuyo producto no es la construcción de un nuevo saber sino un malestar derivado precisamente de no poder dar cuenta de lo que pasa y del estancamiento. El saber técnico nos aleja de la sabiduría, es decir, de la posibilidad de despejar enigmas y de iluminar lo incierto, como dice Giorgio Colli: “sabio no es quien cuenta con una rica experiencia, quien descuella por la habilidad técnica, por la destreza, por la astucia, como lo era en cambio en la era homérica.”58 4444.2.2.2.2....2.4 El saber filosófico: El dios Apolo y la esfinge2.4 El saber filosófico: El dios Apolo y la esfinge2.4 El saber filosófico: El dios Apolo y la esfinge2.4 El saber filosófico: El dios Apolo y la esfinge Es preciso aclarar que tomaremos una de las posibles acepciones del saber filosófico. Digamos que nos interesa bajo el discurso universitario esa dimensión de la filosofía en sus orígenes que nos ilustra Apolo. Este es el dios que conoce el porvenir, pero lo dice a medias, como si no quisiera que el ser humano lo comprendiera. En esa medida conserva su poder, en ese no decirlo todo, en ese 58 COLLI, Giorgio. El nacimiento de la filosofía. Barcelona: Tusquete editores, 1994. Pag 13
  • 112 dejar puntos oscuros. Como dice Giorgio Colli, hay algo de perversidad y de crueldad en esta posición, pues reduce al otro a la condición de objeto, lo borra como sujeto, lo condena a la ignorancia, lo eclipsa en tanto que le cierra la posibilidad de la comprensión y el entendimiento. Apolo es entonces quien sabe, el otro es el lugar de la ignorancia y, por lo tanto, siempre estará dividido esperando que las respuestas vengan de quien posee el saber. En esta modalidad encontramos aquellos coordinadores identificados con el saber, que dejan al grupo siempre en vilo, en suspenso, que hablan en forma cifrada, no para producir efecto de apertura sino de cierre y el sentimiento de no comprender, es decir, dicen la verdad en forma oblicua sólo para demostrarle al grupo lo poco que sabe, lo poco que entiende, lo poco que es. En últimas, lo reduce a la condición de pequeño “a”. Este tipo de coordinadores despliegan grandes pasiones, o se les ama o se les odia. Quienes necesiten amos del saber y ciertos rasgos de perversidad en el agente podrán establecer una relación de franca admiración y sometimiento a ese tipo de coordinadores. Así lo afirma Giorgio Colli, citando a Platón en un pasaje del Timeo: “Existe una señal suficiente de que el dios ha dado la adivinación a la insensatez humana: efectivamente, nadie que sea dueño de sus pensamientos consigue una adivinación inspirada por el dios y verdadera. Al contrario, es necesario que la fuerza de su inteligencia esté paralizada por el sueño o por la enfermedad, o bien que la haya desviado por estar poseída por un dios. Pero al hombre cuerdo corresponde recordar las cosas dichas en el sueño o en la vigilia de la naturaleza adivinadora y entusiástica, reflexionar sobre ellas, discernir con el razonamiento todas las visiones entonces contempladas, ver de dónde reciben esas cosas su significado y a quién indican un mal o un bien, futuro, presente o pasado.” 59 En tal sentido, si el discurso universitario se sostiene en el dispositivo de un grupo operativo es porque existe un agente en el lugar del S2 y un otro – en este caso el grupo – que se identifica al objeto a. Esta identificación con el objeto a, borra al sujeto, lo excluye, lo silencia. En otras palabras, aleja al grupo de la posibilidad de develar aquellos obstáculos subjetivos y colectivos que se oponen a la construcción de un saber. Esta es una característica común a los cuatro saberes citados dentro del discurso universitario: esperar que el saber sea revelado por los dioses, característica que va en contravía de la tarea implícita de los grupos operativos: identificar los obstáculos epistemofílicos y epistemológicos que se presentan en el colectivo reunido bajo un propósito común. De otro lado, quizás le convenga más a un coordinador de un grupo operativo un lugar similar al de los profetas, intérpretes por esencia de los signos divinos. De ningún modo parece convenir el lugar de Apolo. Otra versión del agente en esta modalidad del saber y del discurso lo puede constituir la esfinge, quien no tiene el saber sobre el futuro, pero es un monstruo, mitad humana, mitad animal, que propone enigmas al pueblo bajo la sentencia según la cual si ellos no son resueltos serán devorados por la ferocidad de la 59 Ibíd. Pág. 35−36.
  • 113 esfinge. Es claro que las respuestas a los enigmas que propone la esfinge son unívocas, pues son verdades preestablecidas. Por lo tanto, el otro lo que debe hacer es responder eso que la esfinge ya sabe. Es evidente bajo esta figura la alienación que puede producir esta modalidad del saber en un grupo. En este caso, el coordinador operaría como la esfinge, en tanto propone enigmas, no para movilizar al grupo y ponerlo a construir el conocimiento, sino como un arma que obliga al grupo a responder eso que el coordinador quiere escuchar, o de lo contrario se expone a la furia de éste, a ser devorado por las críticas y hasta la burla. Lo curioso es que quien entra en el juego de la esfinge y procura responder el enigma, se aleja inmediatamente de un conocimiento que lo implica como sujeto. Le ocurriría como a Edipo rey, quien huyendo de su destino se precipita a él cuando se tropieza con la esfinge y se deja seducir con sus enigmas. Si nos trasladamos al grupo operativo, podemos decir que quien entra en el juego de un coordinador bajo la máscara de la esfinge no podrá construir un saber sobre la horizontalidad grupal. Lo anterior nos permite decir que el discurso universitario eclipsa la posibilidad del conocimiento de sí o, como lo diría Lacan, “forcluye al sujeto”; y ello elimina de esta estructura discursiva la aprehensión de lo subjetivo y colectivo que se opone al conocimiento dentro de un grupo operativo. 44444444........33333333........ EEEEEEEELLLLLLLL CCCCCCCCOOOOOOOOOOOOOOOORRRRRRRRDDDDDDDDIIIIIIIINNNNNNNNAAAAAAAADDDDDDDDOOOOOOOORRRRRRRR YYYYYYYY EEEEEEEELLLLLLLL DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOO HHHHHHHHIIIIIIIISSSSSSSSTTTTTTTTÉÉÉÉÉÉÉÉRRRRRRRRIIIIIIIICCCCCCCCOOOOOOOO Ahora nos corresponde pensar las particularidades que subyacen al coordinador cuando se sitúa en el lugar del agente en el discurso histérico y sus consecuencias en el grupo. A modo de recapitulación de lo que hasta ahora se ha trabajado sobre el coordinador desde la propuesta de Pichón, el discurso del amo y el discurso universitario, se `propone el siguiente cuadro: AGENTE:AGENTE:AGENTE:AGENTE: COORDINADORCOORDINADORCOORDINADORCOORDINADOR GrupoGrupoGrupoGrupo PrPrPrProductooductooductooducto VerdadVerdadVerdadVerdad PichónPichónPichónPichón Lector – intérprete Mensaje a ser descifrado Interpretación: Saber Deseo de saber Discurso del amoDiscurso del amoDiscurso del amoDiscurso del amo Amo: S1 Esclavo: S2 Falta: S Malestar: a DiscursoDiscursoDiscursoDiscurso UniversitarioUniversitarioUniversitarioUniversitario Conocimiento: S2 Repetición: “a” Deseo de poder: S1 Alienación: S En tal sentido, nos encontramos en el discurso histérico los elementos situados del siguiente modo: Agente: S Grupo: S1 Verdad: a Producto: S2
  • 114 Intentemos, entonces, pensar las bondades y los estragos del discurso histérico en el funcionamiento de un grupo operativo. 4444.3.1..3.1..3.1..3.1. Bondades del discurso histéricoBondades del discurso histéricoBondades del discurso histéricoBondades del discurso histérico Cuando el coordinador agencia un modo de relación con el grupo bajo la modalidad del discurso histérico, se sitúa en el lugar del sujeto dividido ($). Ello significa que éste será un sujeto que tiene noticia de la inexistencia del individuo, es decir, de la unidad, de lo unívoco, de la plena consistencia. Por el contrario, él se sabe fraccionado, múltiple, contrario. Sabe que lo absoluto es sólo un semblante para cubrir un agujero, una falta. Sabe que un significante (S1) no es suficiente para representar al sujeto, son necesarios uno, dos, tres y múltiples significantes. Es más, la verdad que subyace en este discurso, verdad situada debajo del agente, supone que más allá de los significantes hay en él una condición de objeto, algo que interroga los semblantes porque le recuerda al sujeto que él no es lo que representa. Él también es ese reducto, esa sensación evanescente, ese vacío que caracteriza a la histeria. Es así como el agente del discurso histérico, se sirve de su propia falta con un fin muy preciso: hacer que aparezca algo que oculta todo aquel que haga las veces de amo (S1), y ese algo es que él también es castrado, a él también lo habita el no todo; él, como ningún ser humano, es el falo. Esta modalidad del discurso, entonces, todo el tiempo nos está recordando que no existe la última palabra, que no existen las certezas, y es precisamente esta característica lo que la hace tan proclive para la creación, para la subversión de lo establecido y para un llamado permanente a la libertad, es decir, a un alejamiento de lo rígido. De modo tal que entre mayor urgencia exista en el agente por establecer la monosemia, más terminará distanciándose del discurso histérico. Para el agente del discurso histérico, la petulancia, la ostentación y, en general, todas las formas posibles de exhibicionismo intelectual y petrificación en las ideas, son blanco de su intervención. El agente de este discurso sabe que detrás de la vanidad se ocultan las dudas y las sombras de las que nada quiere saber aquel que está en el lugar del amo. Si pensamos al coordinador en el lugar del agente en el discurso de la histeria, podemos suponer que su intervención se acentúa allí donde el desarrollo de la tarea del grupo esté amenazada por alguna forma de completud imaginaria, que los puede dejar bajo la ilusión de que ya todo se sabe. De igual modo, este coordinador rompe, a través de múltiples estrategias, las situaciones dilemáticas, situaciones que presentifican al amo en tanto las discusiones del grupo se polarizan; cada una de ellas pretende agotar la verdad en alguna premisa. El coordinador rompe esta ilusión introduciendo un tercero, un tercero que será, en el mejor de los casos, un enigma que conmueva al grupo, que
  • 115 lo haga temblar, que lo movilice de la ilusión de la certeza. Y el motor de este tipo de intervención, como ya lo dijimos, radica en que el coordinador tiene noticia de la falta y sabe que la completud es un engaño para disipar la angustia que puede producir tanto en él, como en el grupo, el no todo. Digamos que en su versión más bondadosa el agente del discurso histérico se puede conducir como un filósofo, en tanto amante del saber, es decir, alguien a quien le falta siempre algo muy preciado. Ello lo dispone siempre a la búsqueda, la cual provocará igualmente en aquellos a quienes acompaña. Podríamos también afirmar que el discurso histérico parece emparentado con los nuevos postulados de la física cuántica, la cual pone en cuestión los postulados de la física clásica en su aspiración por el encuentro con una verdad inmutable. La cuántica nos dice que dicha ilusión es insostenible, sólo podemos aspirar a la certidumbre relativa y a las probabilidades cuando de construir conocimientos se trata. Es como si esta teoría se hubiese encontrado con la falta, con lo indecible, con lo infinito que desborda cualquier pretensión de atrapar la realidad en un postulado. Ya no es posible asegurar que los fenómenos son el resultado siempre de la misma causa. Y es esta característica lo que no le permite a la física cuántica situarse en el discurso universitario, pues no hay en ella la pretensión de ubicar el conocimiento en el lugar del agente. Hay en ella una apertura más cercana al reconocimiento de lo inconmensurable que a la aspiración de un saber absoluto. Es esta posición la que hasta ahora interroga a la física clásica y ha generado grandes debates incluso desde los tiempos de Albert Einstein. A su vez, el discurso histérico está muy cercano a lo real. Recordemos que esa es la verdad que subyace a quien ocupe la posición de agente. Y esa cercanía se traduce en la imposibilidad de decir la última palabra, es decir, de atrapar a lo real con lo simbólico. Esa imposibilidad, en vez de paralizar el deseo, por el contrario, lo provoca, lo alienta. Otra posible consecuencia de la cercanía con lo real es la pérdida de todo entusiasmo por el conocimiento, pues quien suponía que iba a encontrar una teoría ya acabada, portadora de todas las verdades, se desalienta frente al encuentro con lo múltiple. Digamos que el coordinador de un grupo operativo bajo la modalidad del discurso histérico, en tanto no se reconoce como el portador de la verdad, no cree que él tiene la última palabra, desconfía cuando el grupo que acompaña en su tarea se empieza a petrificar bajo una creencia o un dogma. En tal sentido, un grupo que en la fascinación por una teoría no le encuentra fisura, y, por lo tanto, lo que hace es repetirla; o un grupo que se aferra a posiciones dilemáticas, posiciones que lo entrampan en peleas de nunca acabar, que lo desvían de la búsqueda del conocimiento y en pequeñas guerras intelectuales cuyo único objetivo será demostrar poder, podrá ser movilizado si el coordinador se sirve del discurso histérico, esperando la producción de nuevos saberes. No se trata, entonces, de señalar la completud con la pretensión de gozar en el señalamiento de la falta, sino para crear, a partir del reconocimiento del vacío. Otra
  • 116 posición, muy distinta, es la de quien se la pasa señalando la falta, única y exclusivamente para demostrar que sólo él sabe, que sólo él tiene la razón. Digamos que un coordinador en el lugar del agente del discurso histérico le señalará al grupo lo que aún queda por decir, pero a su vez le ayudará a identificar esos anudamientos simbólicos que ha podido construir. El coordinador no deja al grupo en un vacío de saber como situación permanente, sino que lo lleva allí para alentarlo a la creación. Dicho de otra manera, el coordinador se parece al artista y a su vez le recuerda al grupo su tarea explícita: construir un producto inédito. Y un producto de estas características perfectamente podrá ser construir una pregunta fundamental a cierta teoría estudiada, a una ideología, una situación social, o a un discurso cultural. Son múltiples las experiencias sociales que pueden ser pensadas como expresiones del discurso de la histérica. En esta vía, el movimiento feminista ha logrado increpar al amo y ha logrado producir grandes revoluciones culturales sin requerir para ello de la guerra. Múltiples preceptos culturales (S1) se han tenido que desvanecer ante el cuestionamiento agudo de este movimiento. Creencias que se consideraban verdades inmutables, se han llenado de fisuras, dándole lugar a la pregunta relativa sobre lo que significa ser un hombre o una mujer. Estos enigmas que han inquietado a todas las épocas, ya no cuentan con una única respuesta. Antes, el S1 que definía a una mujer era “ser madre y ser esposa”; ahora estas son posibilidades, no certezas. En Colombia han surgido también movimientos políticos que intentan ir más allá de los discursos amo que siempre han existido. Y es precisamente por increpar a los amos existentes, por señalar su inconsistencia entre lo que dicen y hacen, que se han convertido en una verdadera incomodidad para ellos. Al respecto afirma William Ospina: “¿Qué fue del movimiento sindical colombiano? ¿Qué fue de los valerosos reclamos de los campesinos? ¿Qué fue de las movilizaciones estudiantiles? Estremece pensar que mientras en todo país democrático el derecho al reclamo, la indignación y la resistencia a la opresión son pilares de la vida social, aquí toda indignación popular es causa de feroces persecuciones”. 60 Bajo la experiencia de grupo operativo, la cual se constituye en una experiencia micro de lo que ocurre en lo social, el coordinador será un provocador de deseo. Con su intervención, no deja al grupo tal y como llegó en su relación a la tarea explícita o implícita; produce en él una conmoción, una incomodidad, la cual tendrá como consecuencia la producción de un nuevo saber (S2). 4444.3.2..3.2..3.2..3.2. Estragos del discurso histéricoEstragos del discurso histéricoEstragos del discurso histéricoEstragos del discurso histérico 60 OSPINA, William. ¿Dónde está la franja amarilla?. Santafé de Bogotá: Editorial Norma. 2000. Pág. 41
  • 117 Digamos que el discurso histérico no tiene como única expresión su aspecto creador. La dimensión histérica presente en un discurso también puede desencadenar una serie de consecuencias hasta producir estragos en la experiencia de grupos operativos. Aquí es importante detenernos también, pues un sujeto dividido no siempre agencia en el otro la creación. Señalar sólo las bondades de este discurso nos puede dejar sumidos en una apología de ese modo de vínculo, dejando en la sombra otra versión que nos puede servir como advertencia de lo que igualmente puede advenir en el funcionamiento de los grupos operativos. En tal sentido, podemos tener noticia de coordinadores que bajo el semblante socrático le dan curso a una intención muy demoledora: señalar que el otro nada sabe, dejándolo sumido en la apatía. Esta posición igual la podemos identificar ya no en la experiencia grupal, sino en situaciones de la vida cotidiana, en la cual ciertos sujetos están siempre en función de señalarle al otro la falta, única y exclusivamente para ocultar la suya. Son sujetos que se erigen en el superyó del mundo. Un ejemplo de ello lo constituyen aquellas personas que todo el tiempo le señalan a su pareja sus errores, constituyéndose éste en un goce que fractura y pulveriza los encuentros. Digamos que si bien un agente en el discurso universitario puede valerse de esta estrategia, al final él será el que haga ostentación del saber. En el discurso histérico, el agente no va a proponer verdades ni teorías, a él sólo le interesa desarmar certezas. Para pensar los posibles estragos que esta otra modalidad del discurso puede causar en el grupo, nos vamos a servir de la dialéctica, no en su acepción moderna, sino en aquella que reposa en los orígenes de la filosofía y del nacimiento del pensamiento lógico y racional. Ella funciona entre dos personas. El interrogador le propone al interrogado elegir una de dos tesis opuestas, quien luego debe demostrar la validez de la proposición elegida. Pero para el dialéctico, como lo afirma Giorgio Colli, la tesis adoptada por el interrogado es lo de menos, pues su función será demostrar el error a través de la interrogación. Por lo tanto, allí no interesa el llegar a la verdad, sino un ejercicio que permita la afirmación de poder. Dicho de otro modo, si el grupo elige una tesis, el coordinador destruye esa tesis, y si elige la otra tesis, el coordinador procederá de igual modo. Es como si prevaleciera un goce muy íntimo en el señalamiento de la falta. El pequeño a, entendido como un goce, será lo que aliente al coordinador en su función de demostrarle al grupo que independientemente de lo que diga siempre estará en un error. Un grupo con un coordinador de estas características podrá quedar atrapado en el sinsentido, o en una producción metonímica de S2, pero sin la posibilidad de hacer metáforas, de hacer puntos de parada en el conocimiento. Digamos que ese es el producto en este caso, a diferencia de las consecuencias que puede producir el discurso histérico bajo una versión moderada, como lo señalamos en el primer numeral. Giorgio Colli nos dice que la dialéctica tiene, por lo tanto, un fondo destructivo, un fondo devastador, pues cualquier juicio en el que crea el hombre será susceptible de cambiar. El dialéctico parece un amo, la diferencia es que el primero no propone verdades, mientras que el segundo cree que se las sabe todas. Con ello
  • 118 podemos notar cómo puede haber una aparente cercanía entre el discurso de la histérica y el del amo, en tanto ambos ponen a trabajar al otro, aunque el producto, obviamente, sea muy distinto.... Es como si lo que animara esta modalidad del discurso histérico, fuera algo muy devorador, una insatisfacción frente a la cual nada le resulta suficiente y portador de valor. Así, él ratificará constantemente una verdad que le subyace: finalmente nada es. Es como si el dialéctico se hubiera amistado con el sinsentido, como si la imposibilidad de que lo simbólico agote lo real, le restara valor a lo simbólico, y por ello, siempre va a insistir en que el conocimiento es una ilusión, un engaño. ¿Qué puede suceder con el funcionamiento de un grupo operativo regido por esta lógica dialéctica que puede agenciar un coordinador? Insistamos, el coordinador utilizará la pregunta dirigida a los planteamientos del grupo con un único fin: señalarles su contradicción. Digamos que traslapa su falta, señalándosela al otro, caso diferente al agente del discurso universitario, quien puede señalarle la falta al grupo, para luego hacer todo un despliegue de saber y así demostrarle que es él en su lugar de agente quien tiene el conocimiento. El dialéctico, por el contrario, no entrega respuestas, tampoco tiene el saber, su único objetivo es demostrarle al otro que nada sabe. En ningún momento hará un señalamiento que le indique al grupo la construcción de conocimiento que ha venido realizando, por el contrario señalará lo falso, lo incompleto, lo contradictorio de sus afirmaciones. Es decir, cada que el grupo hace metáfora, introduce una pregunta y ello va produciendo en el grupo una angustia creciente, una pérdida del deseo, una especie de nihilismo frente al saber, identificación que desautoriza al grupo como constructor de conocimiento. Existen múltiples experiencias de grupos, tanto académicos como comunitarios, literalmente paralizados por el encuentro con un coordinador que les impide disfrutar de la construcción de sentidos, pues siempre les señala lo que no fue bien hecho o quedó faltando. Lo anterior supone que el agente del discurso histérico se relaciona con un otro que él mismo inventa. Es por eso que se le llama agente, en la medida en que él genera un tipo de vínculo. No hace falta, entonces, que el grupo sea un amo para que el agente lo vea como tal. Es más, cualquier conversación, por sencilla que sea, tiene S1; el agente de este discurso puede estar siempre al acecho de cualquier certeza para demostrar su inconsistencia. ¿Cómo diferenciar esta dimensión de la dialéctica que puede estar presente en el coordinador de la propuesta de la dialéctica que hace Enrique Pichón Rivière? Al respecto, él afirma sobre la dialéctica en el aprendizaje lo siguiente: “Se logra por sumación de información de los integrantes del grupo, cumpliéndose en un momento dado la ley de la dialéctica de transformación de la cantidad en calidad. Se produce un cambio cualitativo en el grupo, que se traduce en términos de resolución de ansiedades, adaptación activa a la realidad, creatividad, proyectos, etc.” 61 61 Pichón Rivière, Enrique. Diccionario de términos y conceptos de psicología y psicología social. Buenos Aires: Nueva Visión, 1988. Págs. 53−54.
  • 119 Entonces, para Pichón, la dialéctica es un producto, un resultado de una serie de conocimientos que se ponen en juego en el grupo, pero que en determinado momento se anudan. Es decir, no son una serie de S2, no es una metonimia infinita lo que caracteriza la dialéctica, sino la construcción de un sentido que nunca cierra las puertas a lo nuevo. No es, pues, la cantidad de palabras, sino los efectos que ellas producen, lo que importa en un grupo operativo. Entre estos efectos, él señala la palabra como pacificadora de la ansiedad, la palabra como un medio para comprender la realidad y transformarla, la palabra como medio para la creación y el potenciamiento de deseos. Para la concepción pichoniana, las palabras están relacionadas con la creación; para la concepción de la dialéctica en los inicios de la filosofía, como lo hemos señalado hasta ahora, las palabras están relacionadas con la destrucción. Quizás ésta sea una de las grandes diferencias, las cuales se deben traducir en la posición que asume un coordinador en un grupo operativo. Digamos que un coordinador escéptico frente a un saber que trabaja el grupo, puede conducirlo a descalificar y destruir las premisas o tesis estudiadas, casi convertirlas en cenizas. Esto es bien alejado de un grupo operativo que logra comprender la tesis o teoría de la que se ocupa y develar sus falencias y sus aciertos. De igual modo, un coordinador de grupo operativo que tenga en el lugar de la verdad cierto saber, va a descalificar cualquier interpelación que le haga el grupo a ese cuerpo de conocimiento. El coordinador no dejará tocar lo que se constituye para él en una verdad. Lo anterior quizás nos señale la necesidad de eclipsar los saberes, las preferencias, cuando de un coordinador de grupo operativo se trata. Esta es una indicación que hace Pichón Rivière frente al quehacer del coordinador de los grupos operativos. Él estará en falta desde el inicio de las sesiones, él no sabe cuál va a ser la ruta, cuál va a ser el producto específico, no sabe con qué obstáculos se va a encontrar y tampoco cuál es la técnica precisa para cada situación. Es un sujeto que de entrada está en falta y con esa falta puede autorizarse para la escucha y la invención; o, por el contrario, quedarse paralizado por la angustia. En conclusión, existen múltiples rostros del coordinador en el lugar del agente del discurso histérico: uno nos muestra su dimensión creadora, que puede favorecer el cumplimiento de la tarea explícita e implícita de un grupo operativo. El otro rostro, por el contrario, está movido por una intención destructiva. Éste produce en el grupo una desesperanza que puede ir apagando su deseo de saber. Si nos sirviéramos del cuadro inicialmente expuesto podríamos graficar este discurso así: Agente:Agente:Agente:Agente: coordinadorcoordinadorcoordinadorcoordinador GruGruGruGrupopopopo ProductoProductoProductoProducto VerdadVerdadVerdadVerdad Discurso histéricoDiscurso histéricoDiscurso histéricoDiscurso histérico S: Sujeto en falta: Creador de sentido vs. Devastador de sentido S1: conocimiento acabado vs. Metáforas transitorias S2: nuevo conocimiento/ metonimia sin sentido a: el goce de crear o de destruir
  • 120 Para terminar, digamos que si bien los discursos no se soportan únicamente en los diálogos, estos son una de las expresiones de ellos. Y es precisamente el diálogo el medio como el grupo operativo discurre en su búsqueda de sentidos inéditos. Lo que hasta ahora hemos podido vislumbrar, no sólo en este capítulo, es que cualquier tipo de vínculo está soportado por unas verdades que subyacen tras el modo como se relaciona el agente con el otro. Esas verdades o intenciones tienen unos efectos o productos. No parece, entonces, tan evidente que el vínculo social en sí mismo sea la garantía de una voluntad creadora en la cultura. También puede subyacer en él una voluntad de poder que impide a toda costa la producción de un nuevo saber. Borges nos propone un modo particular de conversar y construir conocimiento, en el cual prevalece, sobre todo, un apetito de saber más que de poder: “Nuestra vida, como estos diálogos y como todas las cosas, ha sido prefijada. También los temas a los que nos hemos acercado. Con el correr de la conversación he advertido que el diálogo es un género literario, una forma indirecta de escribir. El deber de todas las cosas es ser una felicidad; si no son una felicidad son inútiles o perjudiciales. A esta altura de mi vida siento estos diálogos como una felicidad. Las polémicas son inútiles, estar de antemano de un lado o de otro es un error, sobre todo si se oye la conversación como una polémica, si se la ve como un juego en el cual alguien gana y alguien pierde”. 62 El diálogo tiene que ser una investigación y poco importa que la verdad salga de uno o de boca de otro. Yo he tratado de pensar al conversar que es indiferente que yo tenga la razón o que tenga razón usted; lo importante es llegar a una conclusión, y de qué lado de la mesa llega eso, o de qué boca, o de qué rostro, o de qué nombre, es lo de menos. 44444444........44444444........ EEEEEEEELLLLLLLL CCCCCCCCOOOOOOOOOOOOOOOORRRRRRRRDDDDDDDDIIIIIIIINNNNNNNNAAAAAAAADDDDDDDDOOOOOOOORRRRRRRR EEEEEEEENNNNNNNN EEEEEEEELLLLLLLL LLLLLLLLUUUUUUUUGGGGGGGGAAAAAAAARRRRRRRR DDDDDDDDEEEEEEEELLLLLLLL AAAAAAAAGGGGGGGGEEEEEEEENNNNNNNNTTTTTTTTEEEEEEEE DDDDDDDDEEEEEEEELLLLLLLL DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOO AAAAAAAANNNNNNNNAAAAAAAALLLLLLLLÍÍÍÍÍÍÍÍTTTTTTTTIIIIIIIICCCCCCCCOOOOOOOO Si bien la fórmula del discurso analítico ya ha sido referida en otros capítulos, no deja de ser útil mencionarla nuevamente con el fin de tener a la mano el esquema por el cual nos vamos a ir deslizando en la reflexión que haremos en este capítulo. ¿Qué sucede cuando el coordinador ocupa el lugar del agente en el discurso analítico’ Esta pregunta supone de entrada romper la idea según la cual este discurso sólo opera en los consultorios. Vamos a transportar esta modalidad del vínculo que propone Lacan a otro escenario: la relación entre el coordinador y el grupo, trabajando bajo la técnica de grupos operativos. Este deslizamiento se hace posible, pues los discursos son, sobre todo, un modo de formalizar lo que puede suceder en los encuentros humanos si ellos son agenciados desde diversas posiciones. Es así como el discurso analítico nos propone que quien se sitúe en el lugar del agente encarnará el a con minúscula; y como consecuencia de esta posición, el 62 http://www.fundlitterae.org.ar/recomen_caplavoz.html
  • 121 otro será un sujeto dividido ($). De igual forma, esta modalidad de vínculo arrojará un producto, el S1, y será soportado por una verdad relativa a un saber (S2). a_ S S2 S1 Digamos en principio que el objeto a se constituye en el objeto del deseo. Para que alguien se constituya en objeto del deseo es preciso que se le represente como portador de un agalma o rasgo valioso, por lo cual, el otro será atraído por aquel que porte un signo que le haga creer que tiene eso que a él le falta. Ello, entonces, se constituye, a su vez, en el principio del amor, ya que en el plano imaginario se supone que alguien tiene eso que a uno le falta. Y si el otro lo tiene, esto se puede constituir en un resorte del deseo. Vemos pues, cómo el ser objeto de deseo trae a su vez adherida la dimensión del amor. El otro será un sujeto dividido por un agente que se constituye para él en objeto causa y objeto de amor. Esta división del ser supone que el otro no aparece completo, no estará en la fase del autoerotismo o narcisismo, en la cual él se basta a sí mismo; por el contrario, se reconoce en falta y ello lo aliena irremediablemente al vínculo social. El S1, en este discurso, toma una connotación bien distinta a la que tenía en los otros, pues será el producto de un modo de vínculo que se supone va a colmar a quien está en el lugar del otro; pero que genera algo que seguramente él no buscaba y es un saber sobre el modo particular como él goza, el cual es el resultado de unos significantes unarios que no se dejan dialectizar ni por la buena voluntad ni por la razón. Son como unas certezas sobre el ser y el Otro, que enmarcan y definen la tendencia que tienen los sujetos en su modo de hacer vínculo social. Esas tendencias o S1, si bien van apareciendo en los dichos, también encuentran como escenario privilegiado la transferencia, es decir la relación del analista con el analizante, en donde este último termina repitiendo un modo de relación primordial. Lo anterior significa que cualquier modalidad de vínculo que se enmarque en el discurso analítico debe producir un saber sobre el goce, afirmación que deriva necesariamente en la pregunta sobre si el dispositivo de grupo operativo permite la construcción de este tipo de producto, asunto del cual nos ocuparemos más adelante. Por último, en el lugar de la verdad que subyace al agente está el saber (S2). Pero ¿de qué saber se trata? Digamos que el agente será portador de un saber hacer y de un saber que como referencia le sirve para realizar un diagnóstico diferencial, que en el terreno de la clínica es referido a las estructuras, diagnóstico necesario para poder maniobrar en las intervenciones. Pero existe otro saber que sólo podrá ser construido en el transcurso del trabajo analítico y que será el que realmente devele la posición del sujeto frente al goce. Digamos que este es el saber fundamental que se traduce en los S1 que el analizante va develando en su
  • 122 proceso. Sin embargo, quien llega a consulta supone que el analista ya sabe la causa última de su sufrimiento. Aquí podemos hablar del agente como sujeto supuesto saber, suposición necesaria para que se abra la transferencia y tras ella un deseo de saber. En otras palabras, el S2 en este discurso representa una paradoja. En primer lugar representa un saber sobre la condición humana y, por qué no decirlo, sobre el propio goce. Pero de otro lado, el S2 representa un vacío de saber, un agujero sobre lo que impide que algo marche en el vínculo social. Ese vacío, desde el discurso analítico, no será cubierto con teoría. Es preciso que se opere una especie de olvido de lo sabido para que se realice una cierta apertura en la escucha que facilite la emergencia de lo nuevo, es decir, sobre el modo particular como el sujeto goza. Ahora, el agente sabrá soportar ese vacío, esa falta de saber gracias a que no está en el lugar ni del S1, ni del S2. Está, por el contrario representado por una a, y ello implica un saber sobre la castración. Cuando el agente del discurso es unCuando el agente del discurso es unCuando el agente del discurso es unCuando el agente del discurso es un coordinador de grupo operativocoordinador de grupo operativocoordinador de grupo operativocoordinador de grupo operativo Bien, pero pensemos qué sucede con el discurso analítico cuando un coordinador se sitúa en el lugar del agente. Empecemos con una recomendación que hace Lacan en su texto El reverso del psicoanálisis, en el cual dice que el analista “debe encontrarse en lo opuesto a toda voluntad declarada de dominio”. Entonces el agente no será ni un amo ni un maestro, es decir, su hacer no buscará someter al otro a sus creencias, normas o juicios. Su hacer buscará la producción de unos significantes de goce muy particulares al grupo, y este saber es irrepetible. Cada grupo en su experiencia deberá encontrar eso que lo empuja a la repetición y que le impide trabajar: es lo que Pichón ha denominado como la tarea implícita de todo grupo operativo. La afirmación anterior supone que el dispositivo grupal puede ser una vía para saber sobre el goce. Detengámonos un momento en esta premisa. Freud nos dio noticia en el texto La psicología de las masas sobre la necesidad de un artificio que permitiera la cohesión grupal, ésta fue nombrada como el ideal del yo. Ahora, si el yo tiene ideales es porque hay algo que falta en su representación para sentirse completo. En otras palabras, quien tiene ideales está en falta. Un proyecto puede constituirse en el ideal que cohesiona a un grupo, en aquello que lo causa. Pero, también Freud nos advierte que los vínculos no se soportan o crean sólo bajo la adherencia que produce el Eros; hay otro aspecto que cohesiona fuertemente, el síntoma. Dicho en palabras de Lacan, se podría afirmar que el goce también genera vínculo social, tanto a nivel de pareja, de familia, de amistades como de grupos a mayor escala. Las barras bravas son un ejemplo de ello. Es llamativo que los integrantes de este tipo de grupos se dediquen durante el partido a insultar a los contrincantes la mayor parte del tiempo y de espaldas a la tribuna hagan arengas y canciones. Pareciera que lo de menos importancia es lo que sucede en la cancha. Se despliega, por tanto, en estos grupos un goce muy particular al que no se adhieren todos los hinchas. Otros prefieren sentarse en la tribuna con su radio para escuchar y asistir al espectáculo. En la misma dirección, se puede
  • 123 observar cómo ciertas amistades se sostienen sobre adicciones muy precisas. Así el alcohol, por ejemplo, los congrega noches enteras; pero si alguno del grupo deja de beber es muy probable que ese vínculo se rompa; igual sucede con otras sustancias psicoactivas. Por lo tanto también el goce agrupa. De igual modo, un grupo reunido bajo una tarea explícita puede ir creando alianzas alrededor de ciertos goces compartidos, como por ejemplo estar siempre en función de burlarse de sus compañeros. En otros grupos prima la desconfianza, como si hubiese en ellos una especie de paranoia colectiva. Es extraño, estos goces interrumpen la productividad sobre ciertas tareas explícitas de corte laboral por ejemplo, pero a su vez cohesionan el grupo, como si el odio también creara lazos. En este sentido, un coordinador de grupo operativo debe posibilitar con sus intervenciones que el grupo se disponga a hablar sobre esos rasgos unarios que merman la creatividad. Ello está en consonancia con una de las funciones que le asigna Pichón al coordinador, quien debe interpretar los emergentes horizontales, es decir, aquellos que son comunes al grupo. Por el contrario, la verticalidad, lo más singular, no es objeto de intervención bajo ese dispositivo de grupo operativo. Esto significa que si bien la singularidad se remueve, sólo de ella será abordado aquello que hizo grupo, aquello que hace parte de la dinámica grupal por ser compartido por sus miembros. Pero bien, volviendo a la cita de Lacan sobre el quehacer del analista, llama la atención que nos diga “voluntad declarada de dominio”. Esta nos puede indicar que quien está en el lugar del agente debe saber que en él existe una tendencia subjetiva a comportarse como un amo, voluntad que no cesará de insistir en cualquier vínculo que establezca. En consecuencia, aunque un coordinador se situé en el discurso analítico, ello no lo librará de querer subyugar al grupo, de querer someterlo a sus creencias, pensamientos y concepciones; es decir, dirigir las construcciones grupales, no hacia un saber inédito, sino hacia un saber que el coordinador ya tenía. Si todos los grupos que acompaña un coordinador terminan produciendo el mismo saber, quizás podamos decir que ellos han funcionado bajo la modalidad del discurso del amo. Por el contrario, un indicador de una cierta cercanía de la experiencia de un grupo operativo al discurso analítico es la producción de un saber inédito, tanto sobre la tarea explícita como sobre la tarea implícita. Es así como el coordinador le pedirá al grupo que hable y hable, para que se pueda topar con un saber que no esperaba ninguno de los dos y que tendrá para ambos un carácter de sorpresa. Ese saber se va configurando gracias a la repetición de dichos, posiciones y actitudes del grupo en el transcurrir de las sesiones. Aquello que se repite es denominado por Pichón como lo implícito de todo grupo, lo cual está en estrecha relación con las ansiedades básicas, las cuales se manifiestan como dos tipos de fantasías: el otro me ataca, el otro me quita. Estas ansiedades son el resultado de la construcción de una representación del otro y de sí mismo, en la cual parece que primara una de las modalidades de
  • 124 aparición de la pulsión ordenada a partir de esta lógica gramatical: el otro me hace daño. Es como si en todo vínculo existiese velado lo que Freud ha denominado en el texto Pulsiones y destino de pulsiones, el primer modo de vínculo social. En otras palabras, lo primero que vincula al sujeto con el otro no es el amor sino el odio, pues éste supone que todo lo malo que le sucede es producido por un agente externo y, en consecuencia, tratará de defenderse y de atacarlo. En un grupo operativo, el odio puede ser depositado tanto en los miembros del grupo como en el coordinador, y cualquier mirada o cualquier dicho pueden ser interpretados como la corroboración de las ansiedades básicas. Digamos que en los inicios de la conformación de un grupo operativo estas ansiedades pueden abundar, pues el otro es un extraño sobre el que se depositan las fantasías más dañinas. Quizás es por esto que al principio los silencios son tan amenazantes y el coordinador debe hacer más presencia para evitar que esas fantasías se tomen la dinámica grupal. El prevalecer de las ansiedades básicas en los grupos como unos S1 que modulan su relación entre sus miembros y con el coordinador, nos acerca a una de las posibles vertientes del coordinador situado en el lugar del a; esta es el coordinador como objeto parcial de las pulsiones. Habíamos dicho que el agente puede ser objeto causa de deseo y de amor -modalidades en las que nos detendremos más adelante-. Ahora decimos que éste también soporta una dimensión de objeto parcial. Decir que soporta significa que permite ser el blanco del desprecio del grupo en determinados momentos del proceso. Ello ocurre, sobre todo, en la primera fase de constitución del grupo, como bien lo ha indicado la licenciada Adamson. En esta fase, prima la heterogeneidad y un modelo oral al estilo de un chupo y escupo. El grupo le demanda al coordinador que le entregue todo su saber, pero a su vez nada de lo que él dice le sirve. Valdría suponer que ello ocurre especialmente en aquellos grupos que se conforman artificialmente bajo tareas institucionales y con un coordinador que ellos no eligieron. Distinto sería aquel grupo que se reúne porque requiere trabajar un asunto muy preciso y para tal fin le demanda a un coordinador en especial su asistencia. Ahora, estos grupos tampoco están libres de desplegar en su transcurrir una transferencia de odio hacia quien los acompaña. Como ya lo dijimos, un coordinador bajo la modalidad del discurso analítico soportará ser el blanco de la pulsión, lo que no significa que asuma una posición masoquista y heroica, dándole licencia a cualquier agresión. Se trata de que el coordinador igual tome el odio en su dimensión de dicho, y así le pedirá al grupo que hable sobre ese asunto. Es muy claro Freud cuando nos indica que las verdades fundamentales generalmente se acercan cuando hay un despliegue de la transferencia negativa. Es como si fuese más productivo el odio que el amor, en términos del tropezarse con una verdad relativa a como está gozando el grupo. No se trata de que el coordinador tome el dicho como un insulto y responda en consecuencia, se trata de que lo tome como otro elemento significante de la trama discursiva del grupo. Como puede observarse, ésta será una de las dimensiones del coordinador en el lugar del a, que fácilmente puede desencadenar en él esa voluntad de amo a la
  • 125 que hacía alusión Lacan. No sucumbir a esa tentación supone que el coordinador no responda desde sus fantasmas a lo que es un asunto netamente transferencial. De igual modo, un coordinador que suponga que su función radica en tener al grupo en armonía permanente y bajo un amor incondicional hacia él, seguramente responderá intentando colmar cualquier demanda que le haga el grupo. Así, le da un estatuto real a algo que debe ser tomado como significantes que develan algo de la fantasmática grupal que se está instalando. Pero, no sólo el coordinador será objeto parcial, también bajo la modalidad del vínculo analítico será objeto causa del deseo, lo que supone que el coordinador será quien ponga en movimiento el deseo del grupo, esa es una de sus funciones fundamentales. Si es preciso que lo ponga en movimiento es porque existe una tendencia a la inercia que habita en los seres humanos, es porque el trabajo va en contravía de la tendencia a la quietud. Son precisamente los S1 que se producen en este discurso los que operan como obstáculo al trabajo grupal y que deberán ser identificados en el proceso. Al ser el coordinador causa del deseo, el grupo será un sujeto dividido, en falta, causado por eso que no tiene, por eso que no sabe. Y es aquí donde el enigma cobra su dimensión benigna, pues es un medio decir que despierta la curiosidad. Por el contrario, el decirlo todo puede provocar en los participantes una falsa completud e ilusión de que ya nada les falta. Entonces, el coordinador será causa del deseo, lo que supone que su función no se sostiene bajo la lógica de hacer que el grupo se pliegue al deber, a la normatividad, a los ideales, tendencia actual en las instituciones que quieren estandarizar todos los procesos, saberes y productos. El deseo, por el contrario, busca lo inédito y se opone a la repetición, lo que significa que un coordinador en el lugar del agente del discurso analítico no pretenderá que los participantes repitan una teoría, sino, que la pongan a prueba, que la dialecticen, la signifiquen y la interroguen. Es como promover en el grupo cierta insatisfacción inherente a la naturaleza del deseo, pero no una insatisfacción que paralice sino que se convierte en causa, en razón para querer saber. El discurso analítico civiliza la relación con la falta, en cuanto tanto la pone al servicio de la producción de saberes útiles a la cultura. De igual modo, el grupo al suponerle un deseo al coordinador, intenta descifrarlo por todos los medios, con el fin de obtener de él cierto nivel de reconocimiento. Es como si cada uno de los miembros quisiera ser el elegido de su coordinador; para tal fin intenta decir y hacer lo que se supone quiere éste. Si bien esta adhesión es totalmente válida desde otras modalidades del discurso, desde el analítico es preciso que el coordinador se abstenga de dar sus apreciaciones personales sobre un tema, pues, ubicado como está en el lugar de objeto, el grupo fácilmente se homogenizará en el pensamiento de su coordinador. Esto ocurre sobre todo en la segunda fase de funcionamiento de los grupos señalada por la licenciada Adamson, en la cual el grupo funciona bajo la fantasía de un todos somos iguales. No saber qué piensa el coordinador, puede dejar siempre en el grupo un agujero que si bien en principio puede ser un poco angustiante, se irá convirtiendo en una especie de libertad grupal para la creación.
  • 126 También habíamos anunciado que el agente del discurso analítico es objeto de amor. Al respecto Lacan nos dice que “lo único que hacemos en el discurso psicoanalítico es hablar sobre el amor”63 . Esto significa que el discurso analítico pone en marcha el amor en la relación transferencial, en este caso entre coordinador y grupo; pero no será el único discurso en el cual se despliegue tal afecto, la diferencia es lo que se hace con éste en cada uno de ellos. Digamos que el coordinador trabajando desde el discurso analítico se sirve del amor, el cual recae en principio sobre su persona. Sin embargo, él no responde a las solicitudes de reciprocidad, sino que, a nombre de ese amor insta al grupo al trabajo, al discurrir significante. Este actuar que el coordinador se abstiene de gozar de modo narcisista al ser situado en el lugar de objeto de amor y no intenta alimentar ese vínculo a expensas del trabajo. Es fundamental que el coordinador esté habitado por un deseo muy claro con relación a su quehacer, para que no pretenda sostenerse en el lugar del ideal para el grupo. Es sabido que el amor va en contravía del deseo: el primero es metafórico, condensa, aquieta, detiene; el segundo es metonímico, inquieto, curioso. Así un grupo fijado en la segunda fase referida por Gladys Adamson en la que prima el amor grupal y la homogeneidad, es un grupo quieto, que no produce más que un sosiego ficticio. Es preciso entonces que el grupo se vaya enamorando de la tarea, que sea causado por ella más que por la presencia del coordinador, que el amor al saber y la curiosidad que de éste se deriva sea el motor. Cuando esto sucede, el coordinador parece casi inoperante, pues el grupo ha logrado construir un deseo propio que va más allá de la satisfacción narcisista que procura el reconocimiento del coordinador. 63 EVANS, Dylan. Diccionario introductorio de Psicoanálisis Lacaniano. Buenos Aires: Paidós, 1997. p. 36
  • 127 55555555........ EEEEEEEELLLLLLLL GGGGGGGGRRRRRRRRUUUUUUUUPPPPPPPPOOOOOOOO CCCCCCCCOOOOOOOOMMMMMMMMOOOOOOOO AAAAAAAAGGGGGGGGEEEEEEEENNNNNNNNTTTTTTTTEEEEEEEE EEEEEEEENNNNNNNN LLLLLLLLOOOOOOOOSSSSSSSS CCCCCCCCUUUUUUUUAAAAAAAATTTTTTTTRRRRRRRROOOOOOOO DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOOSSSSSSSS Por: Hernando BernalPor: Hernando BernalPor: Hernando BernalPor: Hernando Bernal 55555555........11111111........ EEEEEEEELLLLLLLL GGGGGGGGRRRRRRRRUUUUUUUUPPPPPPPPOOOOOOOO EEEEEEEENNNNNNNN EEEEEEEELLLLLLLL LLLLLLLLUUUUUUUUGGGGGGGGAAAAAAAARRRRRRRR DDDDDDDDEEEEEEEELLLLLLLL AAAAAAAAGGGGGGGGEEEEEEEENNNNNNNNTTTTTTTTEEEEEEEE EEEEEEEENNNNNNNN EEEEEEEELLLLLLLL DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOO DDDDDDDDEEEEEEEELLLLLLLL AAAAAAAAMMMMMMMMOOOOOOOO El grupo que nos interesa pensar en esta investigación es específicamente el grupo operativo, lo cual no quiere decir que no podamos hacer reflexiones sobre los grupos en general a partir de lo que elaboremos sobre este grupo en particular. El mismo Pichón−Rivière nos da tanto una definición de grupo, como de grupo operativo, y se puede decir, sin lugar a dudas, que la primera contiene a la segunda, es decir, que un grupo operativo cabe dentro de la definición de grupo que da Pichón. Ésta dice así: “todo conjunto de personas, ligadas entre sí por constantes de tiempo y espacio y articuladas por su mutua representación interna, [que] se plantea explícita e implícitamente una tarea, que constituye su finalidad”.64 Es una definición que tiene como punto de partida el grupo familiar, el cual es para Pichón, el modelo natural de toda situación grupal. En términos muy generales, el grupo, para Pichón, es una unidad básica de interacción y de sostén de la estructura social. El grupo operativo no difiere demasiado de esta definición de grupo; Pichón dice de él que es una técnica que: “…se caracteriza por estar centrada en forma explícita en una tarea que puede ser el aprendizaje, la curación (en este sentido abarca a los grupos terapéuticos), el diagnóstico de las dificultades de una organización laboral, la creación publicitaria, etcétera. Bajo esta tarea explícita subyace otra implícita, que apunta a la ruptura, a través del esclarecimiento, de las pautas estereotipadas que dificultan el aprendizaje y la comunicación, significando un obstáculo frente a toda situación de progreso o cambio”. 65 Es decir, que el grupo operativo designa tanto a la técnica como al grupo en el que se aplica. Preguntarse por los efectos del grupo en el lugar del agente, en el discurso del Amo de Lacan, implica pensar al grupo como significante amo, en correlación con otro elemento o sujeto en el lugar del otro en dicho discurso. Este otro con el que se relaciona el grupo operativo es necesariamente el coordinador del grupo, es decir, que el coordinador es el partenaire del grupo como tal. Junto al coordinador se puede pensar que está también, en ese mismo lugar, el observador, el cual recoge el material expresado verbal y preverbalmente en el grupo, con el fin de realimentar al coordinador en un reajuste de las técnicas de conducción del grupo. Pero, fundamentalmente, pondremos en interacción al grupo y al coordinador, para pensarlos en los lugares del agente y del otro en el discurso del Amo, respectivamente: 64 Pichón Rivière, Enrique. “Estructura de una escuela destinada a la formación de psicólogos sociales”. En: El proceso grupal. Del psicoanálisis a la psicología social (1). Buenos Aires: Nueva Visión. 1985. Pág. 152. 65 Ibíd. Pág. 152-153.
  • 128 Si ponemos en interacción al grupo operativo y al coordinador, es porque todo vínculo social implica la existencia de al menos dos términos, de los cuales, el que está en el lugar del agente, interpela o se dirige al que está en el lugar del otro; en nuestro caso, quien está en el lugar del agente es entonces el grupo operativo y a quien colocamos en el lugar del otro, es su partenaire, el coordinador. Quedan dos lugares por dilucidar: el lugar de la verdad, que en la estructura cuatripartita de Lacan, está debajo del lugar del agente al lado izquierdo de la estructura de los discursos, y el lugar de la producción, al lado derecho y debajo del lugar del otro. Por eso, en el esquema anterior, nos preguntamos por cuál es la verdad del grupo operativo en el lugar del agente en el discurso del amo, y cuál es el producto de la incidencia del grupo operativo sobre el coordinador en el lugar de la producción de dicho discurso. Lo que caracteriza al discurso del amo en Lacan, es que en el lugar del agente se sitúa un amo que, como tal, necesariamente va a tener una relación de tirano con el otro, con aquel que se sitúe en el lugar del otro, es decir, que el otro necesariamente, a su vez, será esclavo del amo. Cuando el grupo ocupa el lugar del amo en el discurso del amo, es decir, opera como un significante amo, se trata de un grupo que necesariamente tiraniza a aquel que está o se sitúa en el lugar del otro, y sucede igual así se trate del grupo operativo. En efecto, un grupo operativo puede pasar por ciertos momentos de una sesión o por ciertos períodos en los que tiraniza al coordinador, situado éste en el lugar del otro. Se trata de un coordinador dominado por el grupo en el lugar del amo, en una posición equivalente a la del padre humillado de la familia moderna o al profesor que tiene una posición de siervo en los colegios de niños terribles, los En el lugar del agente: el Grupo operativo En el lugar del otro: el coordinador [y el observador] ¿Cuál es la verdad del grupo en el discurso del Amo? ¿Qué producto se origina de esta relación? Discurso del Amo: S1 S2 $ a
  • 129 cuales, como grupos, tienen una clara conciencia de su lugar y una indeclinable vocación de amos. El coordinador que consciente este rol de siervo del grupo tirano, es aquel que por temor a perder su lugar o su rol, se deja someter como el esclavo; un coordinador así, le reconoce una superioridad absoluta al grupo y se dedica a tratar de complacerlo, a recrearlo y a adularlo, y a su vez, el grupo lo manosea y lo angustia. El producto de esta operación, en la que el grupo está como amo del otro, es un goce inútil. Las familias con un padre humillado se vuelven gozosas y los establecimientos educativos para niños terribles son campos de recreo permanente. Al igual, cuando un grupo se yergue como un amo, no quiere aprender, quiere gozar. Un grupo operativo que sistemáticamente lo cuestiona todo, lo boicotea todo, se burla de todo o convierte todo en juego, es un grupo que está en el lugar del amo y que produce una forma de servidumbre en el coordinador, cuando éste consiente esta situación. El grupo en el lugar del amo, puede perfectamente pasar por diferentes grados: desde el grupo boicoteador o el grupo de miembros renegados, que ya no esperan nada ni tienen nada que perder, un grupo que tendría por causa el hacer daño o destruir al otro, hasta el grupo en recreo o en carnaval, menos mortífero pero que tiraniza por igual al coordinador. El grupo operativo en el lugar del agente es un grupo que trabaja contra sí mismo. Es un grupo que no es agente de su propia causa, de su propio proyecto; es un grupo que difícilmente se va a apropiar de su propio destino, de su propio deseo y, por lo tanto, no va a trabajar para llevarlo a cabo. Este alcanzar una finalidad es, en términos de Pichón, lo que hace lo común al grupo, lo homogéneo del grupo. Pero la homogeneidad de un grupo−amo está en esa contra−tarea que consiste en tiranizar al coordinador. Digo contra−tarea en la medida en que un grupo así se constituye en un grupo boicoteador de la tarea, la cual tendría como propósito que el grupo se haga cargo de su propio cambio, de su aprendizaje y de sus comunicaciones efectivas; un grupo que logre, en conjunto, una adaptación activa a la realidad, objetivos estos que hacen parte de la intervención de la técnica de grupos operativos y que no sería posible cumplir cuando el grupo es un amo boicoteador y tirano. Los amos no suelen cambiar, ni aprenden cosas nuevas; más bien permanecen idénticos a sí mismos. Es inevitable no pensar también en el coordinador y su función dentro del grupo operativo cuando éste está en el lugar del agente en el discurso del amo. Un coordinador en el lugar del otro como esclavo del grupo, será un coordinador que no colabore para que el grupo pueda llegar a tomar las riendas de su destino, de su proyecto o su tarea. Esta es una finalidad que el grupo sólo empieza a alcanzar en la segunda de las instancias que distingue Pichón Rivière en su teoría del grupo operativo, es decir, en la tarea; y se alcanza plenamente en la tercera de las instancias, la que él denominó proyecto. Al respecto dice Pichón:
  • 130 “En términos de trabajo grupal podemos distinguir tres instancias: la pretarea, en la que se ponen en juego las técnicas defensivas del grupo movilizadas por la resistencia al cambio y destinadas a postergar la elaboración de las ansiedades que funcionan como obstáculo epistemológico. La tarea consiste precisamente en este abordaje donde el objeto de conocimiento se hace penetrable a través de una elaboración que implica la ruptura de la pauta estereotipada que funciona como estancamiento del aprendizaje y deterioro de la comunicación. El proyecto surge cuando se ha logrado una pertenencia de los miembros; se concreta entonces una planificación”. 66 Es claro, entonces, que sólo en la tarea el grupo empieza a hacerse cargo de sí, pero no sin ayuda del coordinador; pero cuando éste, por temor a perder su estatus como tal, se deja tiranizar por el grupo−amo, el producto de esta relación es, como ya se indicó, un goce inútil. Desde otra perspectiva, pensar que el grupo alcanza los objetivos propuestos por Pichón para el grupo operativo, es decir, pertenencia, pertinencia, cooperación, aprendizaje, una buena comunicación y telé positiva entre todos los miembros del grupo −vectores éstos del cono invertido, con los que se puede evaluar la producción del mismo−, ¿significa acaso que el grupo es un tirano con el coordinador? Este es un riesgo del trabajo en torno a una tarea común: pudiera suceder que el grupo pase a tiranizar al coordinador del grupo operativo. Si el grupo está como significante amo en el lugar del agente, ¿qué nos garantiza que no se comporte como un tirano? La tiranía surgiría allí donde el grupo se cree excepcional por cumplir con los ideales que se propone alcanzar y que alcanza. Pero este riesgo, aunque puede existir, no tiene por qué presentarse si el coordinador cumple con su función y sabe lo que hace. Además, un grupo tirano, sólo se constituye como tal cuando uno de sus miembros, asumiendo el rol de líder, logra movilizarlo y masificarlo, y si algo caracteriza al grupo operativo de Pichón, es que éste no es una masa, no es un grupo completamente homogeneizado en el que sus miembros piensan igual y se identifican entre sí a los mismos ideales. Si bien Le Bon dice de la masa que “es un ente provisional que consta de elementos heterogéneos”, y que en ella “desaparecen las adquisiciones de los individuos y, por tanto, su peculiaridad”,67 el grupo propuesto por Pichón no se asemeja a aquélla. El grupo operativo de Pichón, si bien es homogéneo en la tarea, es heterogéneo en la composición de sus miembros, es decir, que se trata de un grupo muy particular, o excepcional si se quiere, en la medida en que busca que sus miembros se diferencien entre sí, fundamentalmente en sus roles, y conquisten un respeto por la diferencia, la cual se refleja en las contribuciones que cada miembro aporta al grupo. El grupo operativo es un grupo donde la heterogeneidad de sus miembros se constituye en uno de sus objetivos y en uno de sus rasgos fundamentales, es 66 Ibíd. Pág. 159. 67 Le Bon citado por Freud en Psicología de las masas y análisis del yo. En: Obras Completas, tomo XVIII, Amorrortu editores, Buenos Aires, 1979. Pág. 69−70.
  • 131 decir, que si en un grupo operativo no se le da relevancia o no existe en su interior dicha heterogeneidad, no podemos decir de él que es un grupo operativo como tal; lo más que se podría decir de dicho grupo cuando no hay tal heterogeneidad, es que no fue operativo, porque la operatividad de un grupo tiene que ver también con esto, con que cada miembro manifieste dentro del grupo su singularidad, su particularidad, y que ésta sea respetada por todos los demás. Es, en verdad, un grupo excepcional, que hace la excepción a lo que caracteriza a la mayoría de los grupos, de tal manera que el vínculo social que implica el grupo operativo al nivel de su experiencia, es un vínculo que podríamos llamar inédito, o si se quiere, antigrupal. Es algo absolutamente paradójico, ya que en el grupo operativo hay un vínculo que es social, pero es un vínculo que no hace grupo, es un vínculo que se funda de tal modo que no está regido por la lógica de cualquier lazo, porque resiste a la lógica de la homogenización del grupo convertido en una masa. Decíamos más arriba que se necesita de un coordinador que sepa lo que hace, que no se deje intimidar por ese empuje que tiene todo grupo de ser un amo y que lo dejaría, al coordinador, en el lugar del esclavo tiranizado. Un coordinador que se deja colocar en el lugar del siervo, que no se corre de ese lugar de esclavo, será gobernado por el grupo, y es muy probable que la respuesta a esta situación por parte del coordinador, sea colocarse en el lugar de profesor y dedicarse a enseñar al grupo un saber formal o establecido, es decir, se coloca como educador que le dice al grupo cómo comportarse y qué conductas debe corregir. Él mismo se coloca en el lugar de agente del discurso universitario, el cual es una versión del discurso del amo, y si responde en esa posición, en la medida en que deja de ser humillado y tiranizado por el grupo, la situación se volverá insostenible, ya que habrá dos amos enfrentados uno contra el otro, midiendo sus fuerzas e intentando dominarse entre sí. Es un caso que se presenta con frecuencia en los grupos operativos. Así pues, dependerá en gran medida del coordinador, de la conducción que haga del grupo y de la manera como cumpla sus funciones como tal, que el grupo no llegue a creerse un grupo privilegiado, un grupo excepcional, amo que pasará a tiranizar, no sólo al coordinador, sino también y muy probablemente, al grupo mismo, a sus miembros, en la medida en que, una vez entrado en esta posición de excepción y en esa lógica de grupo ideal, pasará a sacrificar a sus miembros por el cumplimiento y sostenimiento de los ideales que lo hacen un grupo−amo colocado en el lugar de la excepción. El grupo−amo−tiránico es aquel que se presenta en la segunda fase −“yo soy vos”− de las fases que Gladys Adamson distingue en su texto Fases y mitos en grupo operativo. Esta es una fase en la que los miembros del grupo son todos iguales, se uniforman perdiendo la individualidad de sus miembros, se hacen masa, manifestando una resistencia al cambio, como grupo unido en la semejanza, y un temor al conflicto dentro del grupo. En esta segunda fase, el grupo no tolera la diferencia y el coordinador del grupo, “el diferente”, pasa a ser objeto de la tiranía de ese grupo−amo uniformado. Es precisamente la fase donde
  • 132 se presenta ese mito que Adamson llama “mejor grupo o del grupo excepcional”.68 El paso que hace el grupo de la segunda fase a la tercera, es el paso del grupo−amo tirano, que no tolera la diferencia, al grupo−amo autónomo, dueño de sí mismo, grupo que alcanza una diferenciación y una independencia entre sus miembros y el coordinador. La primera fase del grupo operativo −“yo no soy vos”−, que contiene el mito que Adamson denomina de “autoabastecimiento” o “self made man”, no se podría pensar como una fase donde el grupo es un grupo−amo, ya que lo que prima aquí es la verticalidad de los individuos; “aparece el sujeto centrado en la propia necesidad no pudiendo reconocer las necesidades del otro”;69 es una fase en la que no hay grupo todavía, no hay un grupo unificado y lo que prima es una defensa de la individualidad. Con respecto al producto o la producción que se espera del grupo cuando ocupa el lugar del agente en el discurso del amo, hay que decir que debe ser un producto equivalente al objeto a, objeto que ocupa el lugar del producto en el discurso del amo y que representa a un objeto radicalmente perdido para el sujeto y, que por estar perdido, él intentará, a partir de su deseo, recuperarlo. Lo que recupera el grupo−amo como producto en este discurso del amo es precisamente “goce”. Por ocupar el grupo el lugar del agente como significante amo, hay que pensar en un producto que, como se vio, es un goce inútil, un goce boicoteador, una tiranía que tiene como único fin sostenerse ella misma y seguir haciendo del grupo, un grupo−amo embelesado en su poder de tiranizar al otro. También se podría pensar que el producto de este discurso del amo, en el que el grupo ocupa el lugar del agente, es un resto identificado al coordinador mismo, es decir, que el coordinador quedaría aquí como resto, como un desecho humillado de esa operación que ejerce el grupo−amo sobre él. ¿Y qué decir del lugar de la verdad cuando el grupo ocupa el lugar del agente en el discurso del amo? La verdad de todo amo es… que él está castrado, que él está en falta, que está dividido por su deseo, y sus dudas y sus síntomas; en palabras de Pichón, que el grupo, si bien pone en juego toda una serie de contenidos explícitos, detrás de ellos hay siempre algo implícito, y lo implícito del grupo es el sujeto del inconsciente, el sujeto dividido. Se puede decir, entonces, que la división se da entre lo manifiesto y lo latente del grupo, así como también hay división subjetiva en cada uno de los sujetos que conforman el grupo; es una división que nos indica que el grupo no deja de estar determinado por lo latente, por lo inconsciente del grupo y de los sujetos; es la agenda oculta del grupo. Esto es algo que el grupo operativo puede llegar a saber si renuncia al goce de ser un grupo−amo: que lo latente lo determina, que lo inconsciente lo acecha, que el deseo lo divide. Este nivel latente siempre está presente en el grupo y se constituye en uno de los objetivos del trabajo en grupos operativos: «hacer 68 Ibíd. Pág. 31. 69 Ibíd. Pág. 28.
  • 133 explícito lo implícito»; y lo implícito está representado en el discurso del amo, por ese sujeto dividido en el lugar de la verdad. La dimensión de la verdad es esencial en toda experiencia que se apoye en el psicoanálisis, como lo es el grupo operativo, en la medida en que con ella se busca el reconocimiento de una causalidad, de una realidad psíquica por parte del sujeto. Tener en cuenta esta dimensión del grupo y del sujeto, es lo que hace llegar al grupo a esa tercera fase con una “postura crítica y evaluativa de los propios marcos referenciales”.70 En otras palabras, que el sujeto dividido se encuentre en el lugar de la verdad, que sea la verdad del grupo-amo, es lo que hace posible que dicho grupo conquiste para sí, no sólo una autonomía y una independencia, sino una heterogeneidad entre sus miembros, ya que lo que introduce ésta es el sujeto dividido en su singularidad y con sus particularidades. Sin el develamiento de esta verdad, que la verdad de todo amo es que es un sujeto en falta, castrado, el grupo en el lugar del amo estaría destinado a hacerse una masa homogénea que rechazaría lo heterogéneo de los miembros del grupo. Sería, pues, un grupo sin operatividad. 55555555........22222222........ EEEEEEEELLLLLLLL GGGGGGGGRRRRRRRRUUUUUUUUPPPPPPPPOOOOOOOO EEEEEEEENNNNNNNN EEEEEEEELLLLLLLL LLLLLLLLUUUUUUUUGGGGGGGGAAAAAAAARRRRRRRR DDDDDDDDEEEEEEEELLLLLLLL AAAAAAAAGGGGGGGGEEEEEEEENNNNNNNNTTTTTTTTEEEEEEEE EEEEEEEENNNNNNNN EEEEEEEELLLLLLLL DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOO UUUUUUUUNNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEERRRRRRRRSSSSSSSSIIIIIIIITTTTTTTTAAAAAAAARRRRRRRRIIIIIIIIOOOOOOOO El discurso universitario se caracteriza por tener al saber en el lugar del agente. El saber (S2) ocupa aquí el lugar dominante, el lugar del orden, el mismo lugar que ocupa el significante amo S1 en el discurso del amo, por tanto, aquí el saber es un saber de amo, un saber−amo; «puro saber de amo», dice Lacan. En el lugar del otro, el lugar que ocupa el esclavo en el discurso del amo, se sitúa el objeto causa del deseo, el a, que aquí representa, con respecto al saber y en este discurso llamado universitario, al estudiante o al material humano, al recurso humano, tal y como lo señala Lacan en El reverso del psicoanálisis.71 El saber es probablemente uno de los elementos más difíciles de pensar en su relación con el sujeto, o de otra manera, la relación del sujeto con el saber es siempre compleja. Esto porque el saber tiene diferentes rostros, diferentes caras; hay, por ejemplo, un saber que es semblante: es lo que Lacan llamó Sujeto−supuesto−Saber. Es fundamentalmente un saber que se supone, un saber que el sujeto supone que está... en cualquier parte, en cualquier lugar o sujeto. Pero cuando este saber supuesto se localiza en algún lugar, ese lugar o persona toma el lugar de amo, de significante amo, es decir que pasa a encarnar al discurso universitario. Es el saber del agente, cualquiera que éste sea, y en el lugar del amo se tratará siempre de un saber que domina al otro; otro al que se le imparte ese saber. Es por esto que la universidad representa claramente la hegemonía del saber en la modernidad. La universidad encarna un saber de amo moderno, un saber que gobierna, gracias al discurso de la ciencia −el saber que se imparte en la universidad es el saber científico− a todos los sujetos en la 70 Adamson, Gladys. Ibíd. Pág. 33. 71 Lacan, Jacques. Seminario 11. los cuatro conceptos fundamentales del psicoanálisis. Paidós. Buenos Aires.
  • 134 modernidad. El discurso universitario es la manifestación de lo que la ciencia ha asegurado como saber. Se podría decir sin reparos que el saber siempre es semblante,72 es decir, que es algo que se le supone a alguien, así este alguien lo exprese o no. Hay personas que permanecen mudas y se piensa de ellas que saben mucho, y hasta tienen sus seguidores. Y hay quienes hablan mucho, exhiben su saber, erudito o no, saber de enciclopedia o saber “callejero” y también se dice de ellas que “saben”. Esta atribución de un saber a un sujeto es lo que Freud llamó «transferencia». “En cuanto el sujeto que se supone que sabe existe en algún lado, hay transferencia”.73 Se puede decir, entonces, que hay varios tipos de saber en el lugar del amo. Por un lado, está el saber científico, un saber que domina todo el espectro de los vínculos humanos en el mundo de hoy. Hay su reverso: el saber religioso, tan imperioso o superyoico como el saber científico, es decir, son saberes−amo; aquí también cabría el saber filosófico. También hay un saber de la experiencia y de la tradición, o el saber que se denomina de sentido común. Estos saberes pueden estar encarnados por individuos o por instituciones, no importa, igual, desde el momento mismo en que alguien o algo lo encarna, estamos dentro de la lógica del saber universitario. Por ejemplo, el saber científico es el saber que se imparte en la universidad y es encarnado por los docentes y catedráticos, quienes en su tarea de enseñar, lo que hacen en realidad es un ejercicio de poder sobre los alumnos. Es lo que devela Lacan con la estructura misma del discurso universitario. Igualmente, el saber religioso es encarnado por la iglesia y sus obispos, y el saber de la experiencia y la tradición lo es por cada sujeto que habita una cultura, y por el hecho de encarnarlo ya pasan a ser amos, amos que pueden o no hacer un ejercicio de poder con ese saber. El saber parece estar por todos lados, por eso podemos decir que el saber está en el lugar del Otro (con mayúscula), lugar simbólico que caracteriza en el lacanismo al tesoro de los significantes, a la ley −toda ley es simbólica−, al lenguaje, al inconsciente −“el inconsciente es el discurso del Otro”74 − a la cultura, a Dios si se quiere y, por supuesto, al saber, al saber en general, a todo saber constituido hasta el día de hoy. El Otro es la encarnación de todo−saber, de todo el saber. Se trata del Otro que determina al sujeto, o como decía Pichón, los determinantes histórico−sociales que determinan los vínculos del sujeto. El saber ocupa el lugar del Otro y el Otro a su vez encarna un saber, un saber que puede ser también inconsciente. El Otro es, entonces, en este sentido, un Amo; ¡el inconsciente mismo es un amo! Freud decía que el yo no es amo de su propia 72 De hecho, Lacan llamó también semblante al lugar del agente en su teoría de los discursos. 73 Op. Cit. 74 Ibíd. Seminario 5. Las formaciones del inconsciente. Paidós. Buenos Aires.
  • 135 casa... ¡porque lo es el inconsciente! El discurso del inconsciente es el discurso del amo.75 A partir de aquí podemos proponer que a todo grupo se le puede suponer un saber y, en esa medida, un grupo así es un grupo amo. Las instituciones, cualquiera que éstas sean, son grupos macro que encarnan un saber sobre ellas mismas; igual sucede con los pequeños grupos. Todo grupo al que se le supone un saber sobre cualquier asunto, está en el lugar de amo; ocupa el lugar del agente en el discurso universitario. Igual sucede con el grupo operativo: es un grupo al que se le supone un saber... o no. Puede suceder que no se le suponga ningún saber al grupo, lo cual significa que el que sabe es el coordinador. El grupo no sabe, el coordinador sí y por tanto éste último es el que le va a enseñar al grupo lo que le falta por saber. Es lo que sucede con el docente en el aula de clase, lo cual ejemplifica bastante bien al discurso universitario: el docente como amo del saber haciendo uso de su poder y gobernando a los estudiantes que están localizados en el lugar del otro: Éste no debe ser el caso del grupo operativo, es decir, en él no se debe reproducir la clase y el coordinador no asume el rol de profesor; lo mejor que le puede pasar al grupo en el grupo operativo es que se le suponga un saber, que el coordinador le suponga un saber al grupo, es decir, que el grupo, durante su trabajo de interacción, llegue a construir una mutua representación interna y obtenga un saber respecto al cumplimiento de su tarea. La operatividad de un grupo está dada por la tarea. Pichón dice que no hay grupo sin tarea y ésta, a su vez, habla de que hay un saber en el grupo, digamos, un saber por conquistar o esclarecer con respecto a una tarea. Por ejemplo, si un grupo se reúne alrededor de la tarea de resolver un problema de una comunidad, primero que todo, el coordinador no les va a dar la respuesta, sino que los miembros de ese grupo operativo, van a buscar, van a proponer, entre todos, la solución a dicho problema. Es decir que, si el problema está bien planteado, de cierta manera la solución ya está desde un comienzo, latente, en el grupo operativo. Se puede decir entonces que el grupo ya sabía, sólo que no sabía que sabía; igual sucede con un sujeto en análisis: no es el analista el que sabe, así éste se encuentre, en un comienzo, en el lugar del Sujeto−supuesto−Saber; el que sabe es el paciente, sólo que no sabe que sabe. Al 75 “...por más boludo que sea el discurso del inconsciente responde a algo que corresponde muy precisamente a la institución del discurso mismo del Amo. Y es eso que se llama Inconsciente”. [Lacan en “El reverso del psicoanálisis”. Seminario 17] Discurso Universitario: S2 a S1 $
  • 136 comienzo de todo análisis personal, el analista le transmite la idea a su analizante de que quien sabe, quien tiene la respuesta a sus preguntas, es el Otro, es decir, su propio saber inconsciente; en última instancia, el sujeto mismo. ¿Qué pasa entonces con este grupo al que se le supone un saber, que sabe o que llega a saber que sabe? Este es el meollo del asunto, porque un grupo que llega a saber que sabe, un grupo que conquista un saber o extrae un saber sobre la tarea, es un grupo−amo, es un grupo que pasa a encarnar el saber en el lugar del agente en el discurso universitario. Se trata de un grupo que encarna al Otro, que encarna al Sujeto−supuesto−Saber, que se identifica con él y que gobierna al otro, es decir, a su partenaire, el coordinador. Es un retorno del grupo al discurso del amo bajo el semblante del saber. Un grupo así, un grupo “sabiondo”, puede llegar a ser problemático y a hacer fracasar la experiencia del grupo operativo, ya que se constituiría en un grupo con un saber formal, a diferencia de un grupo con un saber dialéctico, que es el objetivo del grupo operativo: desarrollar un pensamiento abierto, dialéctico. Un grupo “sentado” en el saber, es un grupo que se estereotipa, que se cierra, que se completa o se cree completo y en esta posición, puede llegar a tiranizar con su saber al coordinador, a sabotear cualquier intento del coordinador por dialectizarlo o a abandonar y rechazar al coordinador dejándolo en el lugar del desecho. Este es un riesgo que se corre en todo grupo operativo y muy probablemente en la tercera fase del grupo −"yo soy como vos"−, momento en el que se pasa de la tarea al proyecto. Es un riesgo que se corre en un momento en el que el grupo, habiendo trabajado sobre la tarea, trabajo eminentemente productivo y operativo, se hace a un saber hacer, a un saber que rompe con las pautas estereotipadas en las que se encontraba el grupo y que estancaban el aprendizaje. Es claro que si un grupo reduce las ansiedades básicas a un nivel no sólo tolerable, sino también óptimo para el pleno funcionamiento productivo del grupo, es un grupo que ha aprendido algo, que ya sabe cómo hacer con esos obstáculos y ansiedades. Si el grupo se queda en esta posición, se va a constituir en un grupo “sabiondo”, que se va a cerrar sobre sí mismo y que va a tiranizar con su saber al otro, al coordinador y, muy probablemente, a cualquier miembro del grupo que intente romper con ese saber: un grupo que tiraniza a sus propios miembros, como sucede, por ejemplo, con las sectas y ciertos grupos religiosos, donde el saber encarna una verdad definitiva, incuestionable. En el grupo operativo se necesita de un paso más, se necesita que el grupo avance hacia delante, que no se quede identificado al Sujeto−supuesto−Saber sino que pase al planteamiento de un proyecto, al planteamiento de objetivos que vayan más allá del aquí y el ahora del saber conquistado. Si hay proyectos, si hay objetivos a alcanzar, es porque el grupo está en falta, no está completo. Así pues, el grupo aprende y con ese saber aprendido se hace amo, a menos que no se detenga ahí y dé un paso más allá de esta identificación al saber. ¿Qué se necesita para que el grupo avance más allá de esta posición de amo del saber? Se necesita el discurso histérico, es decir, se necesita que el grupo pueda
  • 137 histerizarse, que pueda dividirse y que sus miembros se histericen. ¿Por qué se necesita de la intervención del discurso histérico en este momento? Porque es el que se opone al discurso universitario por su posición opuesta a la del amo. El discurso histérico es el discurso que cuestiona al amo, que muestra dónde éste desfallece; es el discurso que le muestra la castración al amo. Por eso decíamos, en otro lugar, que el discurso histérico es el que probablemente más le conviene al grupo operativo, es decir, le conviene tanto al grupo como tal, como al coordinador, y muy especialmente a este último. En efecto, no se trata de que el grupo se fortalezca con un saber, sino que se plantee que, por más que sepa, por más que aprenda, más ignorante se va a sentir, más le faltará por saber, por aprender, pudiendo así plantearse un proyecto que se trace unas estrategias para alcanzar unos objetivos propuestos −paso de la tarea al proyecto−. En este sentido, así como el discurso histérico es el síntoma del amo, el grupo operativo puede llegar a constituirse en el síntoma del amo, amo que se presenta con un semblante de saber. Es decir, que el discurso histérico es el reverso del discurso universitario; el sujeto dividido en el lugar del agente en el discurso histérico está llamado a interrogar al amo del saber que constituye al discurso universitario cuando se lo encuentra, a ese amo, en el lugar del agente. El discurso histérico es síntoma del amo porque al saber como amo no le interesa ser interrogado por ningún sujeto y, cuando esto sucede, el sujeto se establece como un problema para el amo, como síntoma, un estorbo con el que el amo−saber se encarta. Así pues, el discurso universitario resultaría incompatible con el grupo operativo. Ahora bien, ¿qué se puede decir con respecto al lugar de la verdad y del producto en el discurso universitario? En el lugar de la verdad en el discurso universitario está el significante amo, S1, que, como ya lo indicamos, nos muestra claramente que lo que hay detrás de todos los intentos de impartir un saber al otro, lo que pareciera ser muy loable y meritorio, es un dominio del otro al que se le imparte ese saber. Esto es claro en la educación tradicional, en la que el docente no hace sino transmitir los discursos y saberes que imperan en una sociedad, los discursos amos del Otro institucional, con sus valores y tradiciones, dominando y adormeciendo así las mentes de los alumnos, los cuales quedan “domesticados” por el discurso que, justamente, le conviene transmitir al amo para su propia reproducción y supervivencia. Esto es muy claro cuando se habla de las bondades de la ciencia o del neoliberalismo para las sociedades en desarrollo y todos los miembros de una comunidad terminan recitando o repitiendo dichas bondades sin pensar para nada en las consecuencias de la aplicación en el mundo de dichos discursos. Es la reproducción del sistema en el ejercicio de adoctrinar al otro −esta vez con minúscula−, el material humano. Pero para observar claramente cuáles son las consecuencias de la imposición de saberes en una sociedad o en un grupo operativo que funciona con un saber que ocupa la posición dominante, podemos apoyarnos en el lugar del producto. En él encontramos al sujeto dividido, $, es decir, a la cifra que representa el malestar sintomático del sujeto, al síntoma como tal. El producto del discurso de la
  • 138 universidad es un sujeto dividido, un sujeto que, por saber, por aprender un sinnúmero de conocimientos, se siente en falta, se siente insatisfecho cada vez más. Mientras más sabe un sujeto, más se da cuenta de todo lo que le falta por saber; se trata de un sujeto que siempre se encontrará en falta y dividido entre lo que sabe y lo que le falta por saber. El sujeto que produce el discurso universitario es un sujeto que quiere saber, en la medida en que él está separado de ese saber. Es un sujeto ávido de saber que, por inscribirse en la institución universitaria, recibe un saber organizado por la verdad del amo, lo que produce un sujeto deseoso de aprender. En el grupo operativo ese sujeto dividido puede estar encarnado por el coordinador, el cual, sometido a la tiranía del grupo “sabiondo”, se debe preguntar por lo que sucede en el grupo, grupo que él como coordinador no logra dividir para operar sobre él. ¿El grupo le transmite un saber al coordinador? Sí, pero se trata no de un saber constituido o formal como el que se transmite en la universidad, sino más bien de un saber conquistado o constituyente que, en cierto momento, como lo indicamos, cierra al grupo en su propio narcisismo bajo ese semblante de saber: “ya sabemos cómo hacer con respecto a la tarea”, “ya controlamos nuestras ansiedades básicas y hemos aprendido a manejarlas”. Allí hay una especie de caída del coordinador de su lugar de Sujeto−supuesto−Saber y la pregunta que le dirige el grupo es: “¿qué puede usted ahora enseñarnos?”. Esta pregunta indudablemente divide al coordinador, que queda como resto de esta operación del discurso universitario: un sujeto dividido que encarna el síntoma de la ignorancia. En el lugar del otro también puede colocarse a cada integrante del grupo como sujeto particular, cuyos miembros pueden ser sujetos divididos en el lugar del producto cuando su saber, conquistado en el proceso del grupo operativo, produce un sujeto ávido de saber. Es decir, que el propio saber del grupo, en la medida en que ocupa el lugar de la posición dominante en el discurso universitario, puede llegar a producir sujetos deseosos de aprender más de lo que ya saben, efecto que se produciría en los miembros del grupo operativo, en cada uno de ellos, uno por uno. Si esto sucede, el grupo pasa entonces de la tarea al proyecto. ¿Y del goce qué se puede decir en este discurso? El discurso universitario encarna el saber, encarna al Otro como saber, y dice Lacan en su seminario XVII: “...di en llamar saber al goce del Otro”76 . Tengamos en cuenta que el saber es, en última instancia, la articulación de los significantes en el orden simbólico, es decir, la cadena significante. El inconsciente es también un saber, otro nombre del saber, sólo que es un saber no sabido por el sujeto, un saber reprimido. En una cura analítica se trata de llegar a saber la verdad sobre el propio deseo del sujeto, el cual es inconsciente. Es en este sentido que Lacan dice que el saber es el goce del Otro −un Otro que goza sólo con su propio saber−, teniendo en cuenta que el saber simbólico no se encuentra en algún sujeto en particular; el saber se encuentra en el lugar del Otro y en este sentido es intersubjetivo. Pero ese goce del Otro también remite al sentido que produce el encadenamiento significante. 76 Lacan, Jacques. Seminario 17. El reverso del psicoanálisis. Buenos Aires: Paidós, 1992. Pág. 12.
  • 139 Cuando se produce sentido en el lugar del Otro como saber −es el efecto de relacionar un significante con otro (S1 − S2)−, hay un goce que Lacan denominó «goce del sentido», es decir, que el sujeto goza de hacer uso del significante, goza de hablar, goza de darle sentido a todo, a su existencia, a su ser, a sus padecimientos, a su vida, etc. “Nosotros, seres débiles, (...) tenemos necesidad de sentido”,77 dice Lacan. El saber, entonces, se puede reducir a la articulación significante, articulación que, a su vez, produce sentido y, por lo tanto, goce, goce del sentido; por esto es que el saber es medio de goce, porque trabaja para producir sentido. La tiranía del saber en el discurso universitario, o sea, el saber como amo, es lo que Lacan llamó burocracia. El grupo sabiondo es un grupo burócrata, dedicado a gozar de administrar su propio saber. Indudablemente esto es contrario a los objetivos que se buscan en un grupo operativo. 55..33.. EELL GGRRUUPPOO EENN EELL LLUUGGAARR DDEELL AAGGEENNTTEE EENN EELL DDIISSCCUURRSSOO HHIISSTTÉÉRRIICCOO El grupo operativo en el lugar del agente... ¿No es éste acaso el objetivo de todo grupo operativo?: que el grupo sea agente de su propia causa, de su proyecto; que se apropie de su propio destino, de su propio deseo y que trabaje para llevarlo a cabo, para alcanzar una finalidad que hace lo común al grupo, lo homogéneo del grupo. Desde esta perspectiva, sería un ideal que el grupo pase a ser amo de sí mismo; un grupo−agente de su propio cambio, de su aprendizaje y de sus comunicaciones efectivas y, en particular, un grupo que se haga cargo de sus propios síntomas y malestares; que haga de ellos una ocasión de trabajo y de aprendizaje; un grupo que logre, en conjunto, una adaptación activa a la realidad, objetivos estos que hacen parte de la intervención de la técnica de grupos operativos. Un grupo que logra por sí mismo resolver sus dificultades de comunicación, que hace posible hacer explícito lo implícito, que logra elaborar sus ansiedades básicas −miedo a la pérdida y al ataque−, que adquiere una buena capacidad de adaptación a la realidad, que es consciente de los roles que cumplen los miembros del grupo, que aprende y, por lo tanto, hay en él modificaciones estructurales y profundas del esquema referencial de sus miembros, es un grupo verdaderamente operativo, que cumple a cabalidad con los objetivos que Pichón ha propuesto para éste. El problema aquí es, ¿cómo logra el grupo esto?, es decir, ¿cómo lo logra por sí mismo? ¿Cómo logra el grupo hacerse agente de su propio cambio y producción y llega −tal vez se podría decir así− a ser amo de sí mismo? Además, un grupo así, ubicado en el lugar del agente, ¿en qué discurso se inscribiría? ¿En el del amo, en el universitario, en el histérico o en el del analista? ¿O en los cuatro de manera alternada? 77 Ibíd. Pág. 14.
  • 140 Ya hemos visto lo problemático que es que el grupo se sitúe en el lugar del agente en el discurso del amo y en el discurso universitario. Veamos ahora qué pasa con el grupo situado en el lugar del agente en el discurso histérico. El significante que se encuentra en este discurso en el lugar del agente es el significante del sujeto dividido [$]. La barra que divide al sujeto representa la acción del lenguaje que lo constituye como deseante, como sujeto en falta; el $ barrado representa al sujeto atravesado por el lenguaje, lo cual introduce en él una falta: falta de ser, en la medida en que él, el sujeto, sólo aparece como representado, por un significante para otro significante; y si el sujeto aparece representado por un significante, es porque no es o no está. ¿Se podría entonces hablar de un “grupo dividido” o un “grupo en falta”? En efecto, aquí la $ barrada está representando al grupo en el lugar del agente, a un grupo que, si se dirige a un amo [S1, el cual situamos en el lugar del otro en el discurso histérico], es porque se encuentra en falta, algo lo divide, lo hace carente. En efecto, todo grupo operativo que encara una tarea, es porque adolece de algo, y si algo le hace falta, busca a un amo que le de respuesta a esa falta. Por eso también podemos decir que se trata de un grupo deseante, de un conjunto de personas que desean algo. A veces ni ellos mismos saben qué es lo que desean, pero como grupo deseante, es un grupo en falta, y, por lo tanto, desea lo que le falta. La estructura del deseo humano es tal que sólo se desea lo que falta. La $ también representa al sujeto sintomático, al sujeto que padece de un síntoma, que sufre por algo o que se pregunta algo relacionado con su ser o su existencia. Al estar así, histerizado o “sintomatizado”, él busca un amo [S1] que le de respuesta a su pregunta, un amo a quien se dirige o a quien dirige su queja. El síntoma se puede definir como lo que no marcha en el sujeto, lo que le causa malestar a él. Estando así, el sujeto entonces puede ir a buscar a alguien que le resuelva su malestar, alguien que le de respuesta a su sufrimiento, y ese alguien a quien se dirige, necesariamente, es un amo que se supone tiene la respuesta a ese malestar. Por el sólo hecho de suponerle a un sujeto la respuesta al sufrimiento que se padece, ese sujeto es colocado en el lugar del amo. Como grupo le supone un saber al coordinador −el cual se sitúa aquí en el lugar del Sujeto−supuesto−Saber−, le dirige su queja o su demanda a él. El problema va a ser aquí, al igual que en el dispositivo analítico, pensar en cómo va a responder el coordinador a esa demanda; si va a responder como amo o como aquel que sabe la respuesta al problema del grupo. Pero con respecto al grupo podemos entonces preguntar si se puede hablar también de un grupo−síntoma. Un grupo en falta, y por tanto deseante, y un grupo−síntoma que padece algún malestar, pueden en efecto estar representados por este significante $ [S dividido], en la medida en que haya consenso entre los miembros del grupo con respecto a lo que les hace falta o lo que les causa algún malestar −el síntoma del grupo−. En ambos casos, la tarea para cada grupo será diferente. Para un grupo en falta y que desea, por ejemplo, construir un acueducto comunal o hacer una cancha de fútbol para el barrio, la tarea apunta a cubrir esa falta realizando las obras que su comunidad necesita. Para un grupo−síntoma, la tarea apuntará a darle solución a
  • 141 esos aspectos de la vida del grupo que no marchan, como sería el caso de un grupo de adictos, un grupo en el que sus miembros sostienen unas rivalidades feroces, un grupo de obesos, de hipertensos, de bulímicos, con dificultades en el aprendizaje, o con dificultades para relacionarse con los demás, etc. Lo importante aquí es que haya consenso en el grupo con respecto a la falta o al síntoma para que el grupo sea representado por el significante del sujeto dividido. ¿Qué pasa entonces cuando un grupo−dividido está en el lugar del agente? En principio, digamos, que es un buen comienzo para todo grupo que él esté dividido, ya sea porque le hace falta algo, o porque padece de algún malestar. Un grupo así es un grupo dispuesto para el trabajo, para la tarea, en la búsqueda de una solución a su división. Lo mejor que le puede pasar a un grupo es que esté “histerizado”, dividido; que esté inscrito en el discurso histérico. El discurso histérico conviene al grupo mucho más que el discurso del amo o el discurso universitario; un grupo en falta o histerizado, es un grupo dispuesto a encarar una tarea, dispuesto a trabajar y producir. Hemos dicho que un grupo−dividido se dirige a un amo en el lugar del otro −en el discurso histérico− y allí encontramos necesariamente al coordinador, partenaire del grupo. En efecto, el coordinador aquí está en el lugar del amo, haciendo de semblante de amo, de alguien que puede venir a dar respuesta a la división del grupo, pero es muy importante que el coordinador no se sitúe como amo; que si bien el coordinador está llamado a ser un amo en el discurso histérico, él no debe responder como tal, porque si así lo hace, el grupo deja de ser un grupo operativo y pasa a ser un grupo vasallo en manos de un líder o un amo que da respuesta a su división. Taponarle la falta al grupo sería su fin como grupo operativo. Depende en gran medida del coordinador que el grupo conserve su división subjetiva para que haya un trabajo sobre la tarea. Por lo anterior, se hace inevitable hablar del coordinador y su función dentro del grupo operativo en el marco del discurso histérico, ya que depende de él que un grupo sea operativo o no, de tal manera que, para que el grupo sea operativo, se necesita que el coordinador renuncie a ser un amo que gobierne al grupo o un profesor que le enseñe cómo hacer las cosas. Esto significa, como ya se dijo, que es muy importante que el coordinador mantenga al grupo en su división, que no tapone u obture la división del grupo con sus intervenciones o respuestas, por lo menos hasta que alcance, él mismo, a realizar la tarea. Se podría pensar entonces que sólo en esa segunda instancia que Pichón distingue en su teoría del grupo operativo, la instancia de la tarea, el grupo empieza a hacerse cargo de sí, no sin la ayuda del coordinador, el cual tiene como función fundamental facilitar la elaboración de la tarea por parte del grupo y hacer una lectura de los existentes y emergentes que se presentan en él. La elaboración que haga un grupo de sus obstáculos, que lo lleva a la ruptura de comportamientos estereotipados, es un índice de que el grupo se ha hecho cargo de sí mismo y que ha conquistado una mutua representación interna. Se trata entonces de un grupo que se ha apropiado de su propia división, que le ha dado respuesta a su falta o a
  • 142 su malestar, o por lo menos, que se ha hecho cargo de ella, convirtiéndola en una ocasión de trabajo, lo que implica abandonar la posición de la queja o la reivindicación; pero se trata, en todo caso, de una respuesta proveniente del propio grupo, y nunca del coordinador; una respuesta que responde al trabajo y elaboración que ha hecho el grupo sobre su propia división, su propia falta o su propio malestar. Cuando la división del grupo es productiva, se tratará de un grupo que alcanza los objetivos propuestos por Pichón para el grupo operativo, es decir, pertenencia, pertinencia, cooperación, aprendizaje, una buena comunicación y telé positiva entre todos los miembros del grupo; y esto sólo parece posible cuando el grupo ocupa el lugar de agente en el discurso histérico. Estos objetivos sólo se pueden lograr cuando el grupo se presenta como un grupo−dividido que trabaja desde su propia división y sobre su propia división; es un grupo que trabaja como un grupo que está en falta, un grupo que demanda la resolución de un problema, de una dificultad, un grupo sintomático que tiene malestares por resolver o una tarea que enfrentar. Decíamos más arriba que se necesita de un coordinador que sepa lo que hace, de tal manera que haga del grupo, un grupo verdaderamente operativo. Es, pues, un coordinador que renuncia a ser un amo, a gobernar al grupo y a enseñarle un saber formal o establecido, renuncia a ser educador. Si bien el grupo como grupo en falta o grupo−dividido, que se enfrenta a la realización de una tarea, demanda un amo que lo oriente, lo guíe, le enseñe o lo gobierne, el coordinador no debe caer en esta “trampa” que le tiende el grupo y no debe responder como amo a él, ni como gobernante, ni como maestro. Entonces podemos decir que, así como le sucede al grupo, el discurso del amo y el discurso universitario son discursos que tampoco convienen al coordinador. En correspondencia con el hecho de que el coordinador renuncia a ser un amo y un educador del grupo, en esa medida él se irá “borrando” como tal en el grupo, a tal punto que el mismo grupo podrá llegar, en un momento dado −momento del proyecto sin duda− a prescindir de él, alcanzando una autonomía e independencia con respecto al coordinador. En efecto, “el coordinador no debe “sobreproteger” al grupo y por lo tanto, en cierto sentido, debe abandonarlo para que “crezca””.78 Sólo así se puede completar la tercera fase que Gladys Adamson distingue en su texto Fases y mitos en grupo operativo. El coordinador en esta tercera fase pasa a estar “con” el grupo, como un miembro más del grupo y que “…está modificando los modelos internalizados de las figuras de autoridad de sus integrantes, ya que aparece como un líder distinto (líder democrático) que les solicita ser libres y autónomos.”79 Es decir, que tanto el coordinador como el grupo, y sólo en esta tercera fase, pueden aparecer como sujetos divididos, sujetos en falta, de tal forma que el grupo en esta tercera fase −“yo soy como vos”− pueda llega a reconocer la 78 Adamson, Gladys. Fases y mitos en grupo operativo. Documento de circulación interna en la Escuela de Psicología Social del Sur del Quilmes. 79 Ibíd. Pág. 32. (Los paréntesis son míos)
  • 143 diferencia en la semejanza, que los miembros se puedan identificar como integrantes del grupo a la vez que reconocen la individualidad de cada uno; es una fase en la que, nos dice Gladys Adamson, hay discriminación y reconocimiento de los límites propios y del otro. Esto no es otra cosa que el reconocimiento de que somos seres en falta, seres divididos. Existe un lado oscuro del grupo−síntoma o dividido cuando éste se dedica, no a trabajar sobre su falta, sino a denunciar y develar la falta en el otro, la falta en el coordinador. El sujeto histérico es un sujeto propenso, sensible a denunciar las faltas del otro. Pero un grupo así, un grupo dedicado a develar la castración del otro −sobretodo cuando el otro, es decir, el coordinador, se sitúa en el lugar de amo o maestro−, es un grupo que se puede dedicar más a gozar del señalamiento de la falta del otro que a trabajar a partir de su propia falta y sobre ella misma. Un grupo que no logra reconocer para sí mismo su propia falta, es un grupo histerizado que fácilmente se vuelve saboteador de la tarea, pues se dedica a reivindicar las faltas del coordinador. Se trataría aquí del típico grupo “quejoso”, al que no le gusta nada ni nada lo satisface; un grupo para el que no hay coordinador que sirva o que se la pasa señalando la falta del otro para demostrarle que sólo él tiene la razón. Un grupo así es un grupo que no tiene nada de operativo. Es muy importante estar atentos a estos grupos, porque cuando se trata de un síntoma histérico, llega el momento en que cede por la vía de la interpretación o la intervención del coordinador; pero puede ocurrir también que en el grupo se articule una voluntad de amo que quiera batirse en una rivalidad imaginaria con el coordinador hasta destituirlo, incluso al precio de disolverse. En el lugar del producto en el discurso histérico encontramos el saber, representado por el significante S2, significante del saber. Es decir que el grupo operativo que está inscrito en el discurso histérico, es un grupo que necesariamente va a producir un saber. En el lugar del otro en este discurso está el coordinador; este lugar es también el lugar del trabajo. El coordinador trabaja a causa de la división del grupo, trabaja sobre ella, y lo que produce su trabajo es saber, un saber que se le restituye al grupo en la medida en que era un saber latente. Es un saber que se hace explícito y que viene a dar cuenta de la división subjetiva del grupo. Igual si es una carencia o un síntoma del grupo, el saber conquistado, producto del trabajo sobre la tarea, sobre la división del grupo, es un saber producido tanto por el coordinador, como por el grupo mismo. O mejor, es un saber producido gracias al coordinador −a su posición que en todo caso no es la de un amo o un maestro− y conquistado por el grupo. Se podría decir que es un saber instituyente, un saber que tiene algo de novedoso, de inédito para el grupo. El objetivo de todo grupo operativo es la producción de un saber inédito y esto sólo parece posible en la medida en que él esté inscrito en el discurso histérico. Así pues, el producto o la producción que se espera del grupo cuando ocupa el lugar del agente en el discurso histérico, debe ser un producto equivalente a un saber, S2, un saber inédito, que nos indica que la relación con el coordinador ha sido productiva, que ha sido la construcción de saber, un saber que se define con respecto a la realización de la tarea y la proposición de un proyecto −tercer tiempo
  • 144 del grupo operativo−. El lugar del producto en el discurso histérico es también el lugar que corresponde al estatuto de la significación. La significación, o el efecto de significación, se produce por la asociación entre un significante y un significado. La significación es ese valor extra que tiene para el sujeto el significante, un valor que, como bien lo señala Pichón, es particular a cada sujeto. Se puede decir que el producto del grupo, colocado éste como sujeto dividido en el lugar del agente, son los significados que él produce a partir de la comunicación que se establece entre sus miembros; nuevos significados que vienen a cambiar los esquemas referenciales de los miembros del grupo, creándose en él una mutua representación interna, producto de esa labor. Esa nueva mutua representación interna y ese cambio en los esquemas referenciales de los miembros del grupo, hablan de la conquista de un nuevo saber, un saber que es constituyente, abierto en términos pichonianos, producto de la inscripción del grupo en el discurso histérico. Por ocupar el grupo el lugar del agente como sujeto dividido, representando a un conjunto de personas reunidas en torno a una tarea, hay que pensar en un producto que, como se ve, puede ser un nuevo significado, saber o esquema referencial, tanto a nivel individual como grupal, tanto para el grupo mismo como para el coordinador −lo que los pichonianos llaman “enseñaje”: el hecho de que el coordinador también aprende algo nuevo con cada grupo−. En efecto, el producto de un grupo operativo son las conquistas subjetivas, no sólo del grupo como tal, sino de cada uno de sus miembros, a nivel de la comunicación, el aprendizaje, la pertenencia, la pertinencia, la cooperación y la telé, así como la conquista de un pensamiento dialéctico y abierto, que deja de ser formal y cerrado; características éstas que hacen al grupo operativo un grupo independiente, que ha crecido y ha conquistado un esquema referencial que le permite una adaptación a la realidad, que deja atrás sus estereotipias, estancamientos, dependencias y dificultades de aprendizaje y comunicación. ¿Y qué decir del lugar de la verdad cuando el grupo ocupa el lugar del agente en el discurso histérico? La verdad del histérico, la verdad de su división, es el objeto que causa dicha división, que causa su falta y que lo hace desear, tener dudas o ser un grupo sintomático: es el objeto a, objeto que representa la causa del deseo y el plus de gozar. La división subjetiva del grupo se da entre lo manifiesto y lo latente del grupo, así como también hay división subjetiva en cada uno de los sujetos que lo conforman; es una división que nos indica que el grupo no deja de estar determinado por lo latente, por lo inconsciente del grupo y de los sujetos. Esto es algo que el grupo operativo puede llegar a saber y que se convertiría en una de sus fortalezas junto a su autonomía e independencia: que hay algo latente que determina su división y que eso latente es un objeto de satisfacción pulsional, el objeto a causa del deseo. Este nivel latente siempre está presente en el grupo y se constituye en uno de los objetivos del trabajo en grupos operativos: «hacer explícito lo implícito»; y lo
  • 145 implícito está representado en el discurso histérico, por ese objeto pulsional en el lugar de la verdad. La dimensión de la verdad es esencial en toda experiencia que se apoye en el psicoanálisis, como lo es el grupo operativo, en la medida en que con ella se busca el reconocimiento de una causalidad, de una realidad psíquica por parte del sujeto. Tener en cuenta esta dimensión del grupo y del sujeto, es lo que hace llegar al grupo a su tercera fase con una “postura crítica y evaluativa de los propios marcos referenciales”.80 Que el objeto a se encuentre en el lugar de la verdad, que este objeto sea la verdad del grupo−sujeto−dividido,81 es lo que hace posible que dicho grupo se sitúe como grupo−en−falta, como un grupo dispuesto a conquistar para sí, no sólo una autonomía y una independencia, sino una heterogeneidad entre sus miembros; lo único que introduce esta heterogeneidad es el sujeto dividido en su singularidad y con sus particularidades, particularidad que está determinada por ese objeto a. Sin el develamiento de esta verdad, que la verdad de todo sujeto es que existe un objeto que causa su deseo, un objeto perdido que el sujeto ahora busca reencontrar, el grupo en el lugar del agente en el discurso histérico estaría destinado a ignorar la verdad sobre su dificultad, sobre su problema, sobre su división o su sintomatología. Es muy probable que esto haga del grupo un grupo sin operatividad, un grupo que no sabe qué desea y de qué goza. En el lugar de la verdad en el discurso histérico, se halla el objeto a, representante de la causa del deseo o de la división del grupo, tanto como del goce que él puede extraer de su división. Por tanto, un grupo que haga productiva su división, ya se trate en un grupo en falta o un grupo−síntoma, es un grupo que tiene al objeto a como causa de su deseo de trabajar. Pero si lo que hace el grupo es “trabajar” exacerbadamente en denunciar la división del otro, el objeto a se sitúa aquí como objeto plus de goce, objeto productor de goce; el grupo entonces goza, disfruta y gusta de señalarle la falta al otro, goza de herir y dividir al otro, haciendo de esto su único objetivo. Es, como lo dijimos hace un momento, un grupo que obstaculiza la tarea y que nada tendría de operativo. Para terminar, hagamos una última reflexión. Habría que pensar que el grupo operativo pasa por los diferentes discursos dependiendo de la fase en que se encuentre. En la primera fase, “yo no soy vos”, prima la verticalidad de los miembros del grupo, y cada cual es un amo de sí mismo y en sí mismo, según el grado en que se defiende la individualidad. Mientras que los miembros se presentan como amos, el grupo aparece más bien histérico, es decir, dividido entre sus miembros. No es para nada un grupo compacto y homogéneo, sino más bien, un grupo fragmentado en individualidades. En la segunda fase, “yo soy vos”, los miembros del grupo se uniforman perdiendo la individualidad, se hacen masa, manifestando una resistencia al cambio y un temor al conflicto dentro del grupo. El grupo ahora parece inscribirse en el discurso del amo; es un S1 compacto y sin 80 Adamson, Gladys. Ibíd. Pág. 33. 81 En la medida en que se toma al grupo como un sujeto o en la medida en que el significante del sujeto dividido representa al grupo.
  • 146 división subjetiva. En la tercera fase, “yo soy como vos”, el grupo parece regresar al discurso histérico, ya que sólo bajo la égida de este discurso, es posible reconocer la diferencia en la semejanza, es decir, la propia falta y la falta del otro. Se trataría, en esta tercera fase, de un grupo que reconoce el rol que cumple cada uno de sus miembros en pos de una tarea, y si el grupo tiene una tarea que cumplir, es porque está en falta, está histerizado o dividido. Es un grupo que soporta su división y trabaja con ella. La primera fase del grupo operativo −“yo no soy vos”−, que contiene el mito que Adamson denomina de “autoabastecimiento” o “self−made man”, no se podría pensar como una fase donde el grupo es un grupo−amo, ya que lo que prima aquí es la verticalidad de los individuos; “aparece el sujeto centrado en la propia necesidad no pudiendo reconocer las necesidades del otro”;82 es una fase en la que no hay grupo todavía, no hay un grupo unificado y lo que prima es una defensa de la individualidad. Cada miembro del grupo se presenta en el lugar del agente en el discurso del amo y el grupo, como tal, se presenta fragmentado; pero esta división no es productiva, porque no hay consenso en el grupo sobre ella. 55555555........44444444........ EEEEEEEELLLLLLLL GGGGGGGGRRRRRRRRUUUUUUUUPPPPPPPPOOOOOOOO EEEEEEEENNNNNNNN EEEEEEEELLLLLLLL LLLLLLLLUUUUUUUUGGGGGGGGAAAAAAAARRRRRRRR DDDDDDDDEEEEEEEELLLLLLLL AAAAAAAAGGGGGGGGEEEEEEEENNNNNNNNTTTTTTTTEEEEEEEE EEEEEEEENNNNNNNN EEEEEEEELLLLLLLL DDDDDDDDIIIIIIIISSSSSSSSCCCCCCCCUUUUUUUURRRRRRRRSSSSSSSSOOOOOOOO AAAAAAAANNNNNNNNAAAAAAAALLLLLLLLÍÍÍÍÍÍÍÍTTTTTTTTIIIIIIIICCCCCCCCOOOOOOOO Pensar al grupo en el lugar del agente en el discurso psicoanalítico no deja de ser algo problemático. Las razones son dos: primero, hemos insistido en la conveniencia del discurso histérico para el funcionamiento del grupo operativo, tanto para el coordinador como para el grupo mismo, si bien cada uno de los cuatro discursos puede circular e imperar en determinados momentos o fases. Y segundo, tendríamos que sacar el discurso del psicoanálisis del contexto para el cual fue creado: el dispositivo analítico. ¿Qué nos autoriza a hacerlo? En el discurso analítico, recordémoslo, el analista ocupa el lugar del agente haciendo semblante del objeto a --objeto que representa en la teoría fundamentalmente la causa del deseo y el plus de goce−. El analista en el dispositivo, dirigiendo una cura, se constituye en la causa del deseo del analizante, de su deseo de analizarse. A su vez, como objeto, es objeto ––valga la redundancia− de la transferencia libidinal por parte del analizante; lo que quiere decir que el analista, en el lugar de objeto de la transferencia del sujeto, es capturado en la economía libidinal del sujeto como un objeto más de su pulsión. Si bien el discurso del amo es un discurso sobre el amo y el discurso analítico es un discurso sobre el analista como objeto a, tal vez lo que nos autoriza a hacer uso de este discurso por fuera de la escena analítica, es la coincidencia en los propósitos del discurso analítico y el grupo operativo: ambos tienen la intención de subvertir al amo. Para Lacan el discurso psicoanalítico es el reverso del discurso del amo y concibe al psicoanálisis como una práctica subversiva que quebranta las tentativas de dominación del otro y de dominio del saber; igual propósito tiene el grupo operativo para Pichón. 82 Ibíd. Pág. 28.
  • 147 Aunque el psicoanálisis y la psicología social de Pichón pueden coincidir en este propósito, es importante delimitar claramente el campo de intervención de uno y de otro. Se puede definir claramente al objeto de estudio de la psicología social como el estudio de “los efectos subjetivos que tiene el encuentro con el otro”83 , en cuanto a ese “otro” se lo toma como modelo o ideal, auxiliar o semejante, objeto de amor y deseo, y como rival o enemigo. Pichón mismo define el campo del psicoanálisis, campo interno, como aquel que tiene que ver con las relaciones de objeto internas del sujeto. En términos de Freud, el objeto de estudio del psicoanálisis lo podemos definir como la forma singular en que un sujeto “busca alcanzar la satisfacción de sus mociones pulsionales (léase goce)”.84 El campo externo, el de la psicología social, lo podemos definir como el campo de los vínculos del sujeto con el otro, donde este otro cuenta “como modelo, como objeto, como auxiliar y como enemigo”85 . Esta definición de los campos permite a su vez definir el tipo de tratamiento que el psicoanálisis y la psicología social, con su grupo operativo, proponen. Al tratamiento psicoanalítico lo podemos definir, con Lacan, como «el tratamiento de lo real (del goce) por lo simbólico (de la palabra)», y al tratamiento del dispositivo pichoniano lo podemos definir como «el tratamiento de lo imaginario (de las relaciones del sujeto con el otro) por lo simbólico (de la palabra)». Ambos dispositivos son dispositivos de palabra, que operan con la palabra y la escucha. Ahora bien, podemos preguntarnos: ¿puede el grupo operativo tratar lo real por lo simbólico? El tratamiento de lo imaginario por lo simbólico define bastante bien los propósitos de la intervención en el grupo operativo, pero, ¿y lo real? Lo real está presente en todo lazo social; está presente en el grupo operativo. ¿Cómo tratar a este real en él? ¿Y qué real? Es indudable que en todo grupo se ponen en juego ciertos goces compartidos, lo que Pichón plantea como la horizontalidad del grupo. De ahí que el grupo operativo sí tiene la posibilidad, según el discurso que promueva, de abordar por la vía de lo simbólico a lo real, pero eso de lo real que hace grupo. Lo que aquí hacemos al colocar el grupo en el lugar del agente en el discurso analítico es, si se quiere, un ejercicio de ficción, que no por ser una ficción deja de tener efectos en la comprensión del grupo operativo a partir del discurso del analista. No se trata, en nuestro caso, de colocar en el lugar del agente en el discurso analítico como objeto a al analista, incluso ni siquiera al coordinador. A quien colocamos como semblante de objeto a es al grupo operativo como tal, a todo un grupo. ¿Puede ser todo un grupo objeto causa del deseo de... el coordinador? Recordemos que al coordinador lo hemos presentado siempre como el partenaire del grupo. 83 Mejía, María Paulina. El ECRO y su concepción de sujeto en Enrique Pichón−Rivière. EN: Poiésis #5. Revista electrónica del Programa de Psicología con énfasis en Psicología Social de la Funlam. http://di.amigomed.edu.co/poiesis. 84 Ibíd. 85 Ibíd.
  • 148 En el lugar del agente o del semblante tenemos al grupo como objeto causa del deseo; en el lugar del otro está el coordinador como sujeto dividido, por el grupo. Este es probablemente uno de los signos de que el grupo operativo ha operado como tal: que el coordinador se divida, se histerice. Para Pichón siempre fue muy importante la mayéutica socrática; la espiral dialéctica es un elemento fundamental de su teoría y un aspecto importante del aprendizaje que se debe dar en todo grupo operativo. Según él, el sexto vector en juego en todo grupo operativo, el aprendizaje, sólo se alcanza en la medida en que se cumple la ley de la dialéctica, en la que hay transformación no solamente del grupo, sino también del coordinador; esto porque entre el coordinador y el grupo hay una relación bidireccional que hace posible que entre ambos haya una mutua afectación y aprendizaje. La división del coordinador es signo de que el grupo está ocupando el lugar del agente en el discurso analítico. Lo anterior implica que el producto de esta relación entre el grupo como semblante de objeto y el coordinador como sujeto dividido [a → $], sea, como lo es en el discurso del analista, un significante amo, un S1, el cual puede representar el proyecto del grupo, ese nuevo plan que surge cuando éste ha alcanzado una pertenencia de los miembros –-tercera instancia del grupo después de la pretarea y la tarea− y un cambio en el ECRO, tanto del grupo como del coordinador, fin último del trabajo en grupos operativos: que el ECRO pase de ser formal a ser dialéctico, deje de estar cerrado y pase a ser abierto. Se podría decir, entonces, que el producto de un grupo operativo, cuando éste está en el lugar del agente en el discurso psicoanalítico, es ese nuevo significante amo, S1, que rompe con las certezas y certidumbres tanto del coordinador ––por eso aparece dividido−, como del grupo mismo, el cual ha llegado a formarse una mutua representación interna que interroga todas sus certezas anteriores o su ECRO. Este S1 producido por el discurso analítico es un significante que interroga el saber del grupo y del coordinador, saber representado por su ECRO. El ECRO no es otra cosa que el saber constituido, S2, y el S1 es ese saber constituyente que interroga y cambia al saber constituido, es decir, el ECRO del grupo y del coordinador. Este S1, producto del discurso analítico, también puede representar un nuevo saber sobre el goce del grupo, ese goce que se comparte en el grupo y que genera lazo social. El objeto a representa también al objeto plus de goce, que en este caso es el objeto plus de goce del grupo, cuando el grupo está en el lugar del agente en el discurso analítico. Ese goce del grupo no es otra cosa que las formas como el grupo se satisface, independientemente de que esa satisfacción le convenga o no; el goce aquí tiene que ver con las relaciones que establece el grupo con un objeto deseado y el monto de satisfacción que él puede experimentar del usufructo de dicho objeto. Si el objeto a representa también el objeto de deseo del sujeto, lo hace en la medida en que se le sustrae al sujeto. En la medida en que dicho objeto falta, ese objeto es deseado por el sujeto, por lo tanto, el objeto a como objeto de deseo remite a la causa misma del deseo; esta es la razón por la que al objeto a se le denomina «objeto causa del deseo» y representa también
  • 149 dicha «falta de objeto», la cual, en el psicoanálisis lacaniano, se llama «falta de ser». En la estructura del discurso analítico, si el grupo ocupa el lugar de semblante de objeto a, el grupo mismo se constituye como deseante pues falta el objeto, pero como semblante de objeto le hace creer al otro que tiene lo que el otro desea, su agalma. El otro en juego es el coordinador, por lo que el grupo, en esta posición dominante en el discurso del analista, será objeto causa del deseo del coordinador. ¿Y qué desea el coordinador del grupo? O mejor, ¿qué debe desear el coordinador del grupo? Explícitamente, ayudarle a cumplir con la tarea propuesta por y en el grupo; implícitamente, colaborarle en el vencimiento de las ansiedades básicas y de los obstáculos epistemológicos y espitemofílicos que se presenten durante la realización de la tarea explícita. Este nuevo objetivo, que aparece para el grupo a partir de pensarlo desde el discurso analítico, es bien interesante: que el grupo pueda llegar a saber algo sobre su goce particular; que pueda llegar a ser consciente de la forma como se satisfacía en su relación con los objetos de deseo, los cuales son, entre otros, los mismos miembros del grupo y el coordinador. El grupo ha de conquistar un saber inédito y constituyente sobre la forma como establecía vínculos entre los miembros del grupo y con el coordinador, lo cual está representado por ese S1, ese significante amo, en el lugar del producto en dicho discurso. Es así como el grupo operativo sí le permite a los sujetos que hacen parte de él tener noticia sobre ciertos goces compartidos. Y es que la forma como un grupo establece vínculos entre sus miembros y el coordinador, dice sobre las formas de satisfacción del grupo, sobre su goce. Todo vínculo conlleva siempre un monto de goce, de satisfacción pulsional, si no, no se establecería vínculo alguno. Esto es muy importante tenerlo en cuenta, porque el goce del grupo es lo que vincula al grupo; si el goce se acaba, los vínculos se rompen. Entonces no se trata de eliminar o suprimir ese goce, que en ocasiones tiene una cualidad mortífera para el grupo, sino de que el grupo mismo llegue a saber algo sobre dicho goce, o por lo menos, del goce que se pone en juego en el grupo. No se trata aquí, para nada, de que cada miembro del grupo operativo llegue a saber de su propio goce, de su goce particular. Esto último sólo es posible en el dispositivo analítico, en un análisis personal. La característica que tendrá este saber inédito y constituyente sobre el goce del grupo, es que se tratará de una certeza del grupo sobre su propio goce, un significante amo irreductible, que transformará las certezas del ECRO grupal y del ECRO del coordinador, entendiendo dicho ECRO como el saber constituido [S2] de ambos elementos en juego en el grupo operativo. Este saber constituido lo encontramos en el discurso analítico precisamente en el lugar de la verdad. ¿Qué significa esto? Significa que el grupo es portador de un saber, se puede tratar de un saber no sabido por el grupo, un saber inconsciente; pero consciente o inconsciente, se trata de un saber que constituye el ECRO del grupo, su saber constituido, o si se quiere, la historia de cada uno de los miembros del grupo y del
  • 150 grupo mismo. Lo que Pichón va a llamar «inconsciente» es la historia de los vínculos acumulados en el sujeto, los cuales condicionan los vínculos personales con otros sujetos. “El inconsciente está pues constituido por una serie de pautas de conducta acumuladas en relaciones con vínculos y roles que el sujeto desempeña frente a determinados sujetos”.86 El hecho de que el grupo esté en el lugar del agente como semblante del objeto a, implica que ese grupo ha renunciado a ser un grupo-amo o un grupo sabiondo. Se podría pensar que para que un grupo llegue a renunciar a estas dos posiciones de amo y acceda al discurso del psicoanálisis, se necesita de un tiempo, un tiempo de elaboración y de constitución de la mutua representación interna del grupo; al parecer, un grupo como agente en el discurso analítico sólo sería posible en la tercera fase del grupo operativo, en la que el grupo acepta a sus miembros tal como son y el coordinador ha pasado a ser un miembro más del grupo sin perder su estatus. Se puede, por tanto, plantear la hipótesis de que la conquista del discurso analítico para el grupo operativo, sólo es posible en la tercera de las fases del grupo. Se trataría de un grupo que se constituye en causa de sí mismo y ocuparía en efecto el lugar de semblante de objeto a en el discurso analítico. Se trataría de un grupo que, como ya se dijo antes, se constituye en agente de su propia causa, de su proyecto; un grupo que se apropia de su propio deseo y que trabaja para llevarlo a cabo; un grupo−agente de su propio cambio, de su aprendizaje y de sus comunicaciones efectivas y, en particular, un grupo que se hace cargo de sus propios síntomas y malestares, de su propia manera de gozar. Recordemos que son objetivos propuestos por Pichón para el grupo operativo resolver las dificultades de comunicación, hacer explícito lo implícito, lograr elaborar las ansiedades básicas −miedo a la pérdida y al ataque−, adaptarse a la realidad, ser consciente de los roles que cumplen los miembros del grupo, el aprendizaje y las modificaciones estructurales y profundas del esquema referencial de los miembros. ¿Cómo llega el grupo a ser agente de su propio cambio y causa de sí mismo? Al parecer, la respuesta es que el grupo se ubique como conquista de trabajo sobre la tarea, en el lugar del agente en el discurso analítico. Se trata en el grupo, situado en el lugar del agente, de pasar de ser un grupo dividido, a ser un grupo objeto causa de sí mismo. Esta operatividad sólo se logra cuando en el lugar del otro está el coordinador, ya no como amo ni como maestro, sino como sujeto dividido, sujeto deseante causado por el grupo como objeto. El saber a develar estará en el lugar de la verdad y el producto de esta relación será ese significante amo que transformará el ECRO del grupo mismo. También se podría pensar, en términos pichonéanos, en el paso de la tarea al proyecto. 86 Pichón−Rivière. Ibíd. Pág. 49.
  • 151 66666666........ CCCCCCCCOOOOOOOONNNNNNNNCCCCCCCCLLLLLLLLUUUUUUUUSSSSSSSSIIIIIIIIOOOOOOOONNNNNNNNEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA IIIIIIIINNNNNNNNVVVVVVVVEEEEEEEESSSSSSSSTTTTTTTTIIIIIIIIGGGGGGGGAAAAAAAACCCCCCCCIIIIIIIIÓÓÓÓÓÓÓÓNNNNNNNN ««««««««PPPPPPPPIIIIIIIICCCCCCCCHHHHHHHHÓÓÓÓÓÓÓÓNNNNNNNN CCCCCCCCOOOOOOOONNNNNNNN LLLLLLLLAAAAAAAACCCCCCCCAAAAAAAANNNNNNNN:::::::: EEEEEEEELLLLLLLL VVVVVVVVÍÍÍÍÍÍÍÍNNNNNNNNCCCCCCCCUUUUUUUULLLLLLLLOOOOOOOO SSSSSSSSOOOOOOOOCCCCCCCCIIIIIIIIAAAAAAAALLLLLLLL»»»»»»»» El proyecto de investigación «Pichón con Lacan: el vínculo social», tuvo como objetivo fundamental estudiar el aporte que se puede hacer al dispositivo de los grupos operativos y al ECRO de Enrique Pichón Rivière desde los conceptos y formulaciones que Jacques Lacan introduce en el campo del psicoanálisis a partir del seminario XVII. Esta intención nos invitó a trasegar, en primer lugar, por los desarrollos que los autores citados tienen sobre el vínculo social. A partir de allí en esa medida se fueron construyendo unos capítulos que pusieran a operar tres elementos fundamentales del dispositivo de los grupos operativos: el coordinador, el grupo y la tarea, por cada uno de los cuatro discursos o modos de hacer vínculo social que propone Lacan: discurso del amo, discurso universitario, discurso histérico y discurso analítico. Digamos que construir este diálogo se constituye en un aporte novedoso para la psicología social, diálogo posible, pues el mismo Pichón Rivière advierte lo necesario de servirse de la teoría psicoanalítica para darle cuerpo y profundidad a sus planteamientos. Del mismo modo, nos advierte de lo crucial que resulta para el psicoanálisis verificar o aplicar su teoría a la realidad social. Fue así como este autor se sirvió de algunos conceptos freudianos y posfreudianos. Esta investigación, en particular, ha pretendido producir una conjunción con uno de los teóricos más importantes que le suceden a Freud: Lacan; y es en este aspecto en el cual se funda lo inédito de este trabajo. Vamos entonces a realizar unos nudos que nos permitan concluir el trabajo emprendido, sin que ellos no puedan ser desatados por otras personas que deseen avanzar en esta perspectiva de trabajo. Dichos nudos se centrarán en subrayar aquellas elaboraciones, producto de la presente investigación, que se constituyen en aportes que le hacen los planteamientos de Jacques Lacan al dispositivo y al ECRO que propone Enrique Pichón Rivière. 6666.1..1..1..1. Primera conclusión:Primera conclusión:Primera conclusión:Primera conclusión: En primer lugar, se puede decir que el objeto de estudio de la psicología social se centra en delimitar los efectos que tiene el encuentro del sujeto con el otro. Ello permite trasladar lo que ocurre en el dispositivo del grupo operativo a cada uno de los cuatro discursos, pues en la parte superior de cada uno de ellos encontramos un primer término: el agente. Éste es el que instaura un modo de hacer vínculo por las particularidades de la posición que ocupa. En otras palabras, el otro –segundo término– queda subordinado o afectado por la posición del agente. Se observa, entonces, cómo los discursos nos señalan los efectos subjetivos y sociales que tiene un sujeto sobre otro.
  • 152 Sin embargo, se tendría que agregar que a la psicología social que Pichón propone no sólo le interesa el modo como se relaciona un sujeto con otro, sino también el modo particular como cada sujeto ha construido el vínculo a nivel psíquico. Dicho de otro modo, cada ser humano, como consecuencia del encuentro con el otro, va urdiendo una trama, un conjunto de representaciones sobre sí mismo y sobre los otros; y es a partir de esta urdimbre que se posesiona y relaciona con el mundo. Esto significa que el deslizamiento de los sujetos por uno u otro lugar de los discursos, habla de sus vínculos internos. Así, alguien será particularmente sensible a ubicarse en el lugar del amo y otras personas en el lugar del esclavo, modalidad de vínculo que origina el discurso del amo. Entonces el vínculo tiene una doble connotación. De un lado, supone los efectos permanentes del encuentro con el otro, y, de otro lado, un conjunto de representaciones intrapsíquicas que dirigen la relación con el otro. Esta doble connotación acerca el ECRO de Pichón a la teoría psicoanalítica y abre un diálogo que le permite al dispositivo de los grupos operativos contar con herramientas conceptuales de la teoría psicoanalítica que facilitan la interpretación de los fenómenos. En esta oportunidad, la investigación se sirvió de conceptos como el significante unario, el saber, el sujeto dividido y el objeto pequeño a. Cada uno de ellos es soportado dentro de la teoría psicoanalítica por todo un desarrollo teórico sobre el lenguaje, el psiquismo y la pulsión. En suma, apoyar el dispositivo de los grupos operativos en los cuatro discursos supone contar, entre otras, con la polisemia del lenguaje, con un sujeto gobernado por la pulsión, y dividido de manera radical entre lo que quiere ser y lo que puede ser. 6666.2..2..2..2. Segunda conclusión:Segunda conclusión:Segunda conclusión:Segunda conclusión: Existen unos puntos de encuentro en el modo como el psicoanálisis y la psicología social intervienen el vínculo. El primero se centra fundamentalmente en tratar por lo simbólico a lo real, o sea que identifica aquellos puntos en los cuales se concentra la pulsión, aquellos en los cuales se instala un modo de goce particular. Para hacerlo, se centra en el análisis de las representaciones subjetivas que le permiten a la pulsión hacer estragos en el vínculo social. La psicología social también se sirve de lo simbólico, del discurrir significante, pero rodea con más insistencia esa dimensión imaginaria del vínculo, esa dimensión que hace presente el odio-enamoramiento y que aparece en los grupos bien sea frente al coordinador, frente a la tarea o frente a los integrantes. Esa doble valencia, potencia o frena los procesos colectivos. Se trata, entonces, desde el dispositivo pichoniano, de potenciar el amor a la tarea como el punto que nuclea y congrega, más allá de las rivalidades entre las personas. Sin embargo, esta investigación ha señalado cómo en un grupo operativo también hace presencia lo real bajo la figura del objeto pequeño “a” en cada uno de los cuatro discursos. Según el matiz que cobre este objeto, causará el deseo o, por el contrario, empujará a la repetición.
  • 153 En su dimensión de repetición se puede anotar que cada integrante, incluso el coordinador, llega con un modo particular de gozar. A medida que la experiencia grupal avanza se puede notar que algo de ese goce se colectiviza, se comparte y hace presencia a través de lo imaginario, incluso le da lugar a un modo particular de vínculo. La experiencia de grupo operativo debe posibilitar que ese modo particular de goce que se cristaliza en determinado grupo, pueda volverse explícito, pueda verbalizarse, modo privilegiado para esquivar el empuje a la repetición que obstaculiza el trabajo. Pero lo real no siempre es nombrado. Aparece en cada discurso de diferente manera y en diferentes lugares. En el discurso del amo, el otro tendrá un saber sobre el goce del agente; en el discurso universitario, el otro está representado por el a, en tanto lugar de la ignorancia, pues es el agente el que sabe; en el discurso histérico, la a subyace al agente, quien está en falta; y en el discurso psicoanalítico el agente es el objeto a. Digamos que es en esta última modalidad de vínculo en la cual el objeto pequeño a cobra una dimensión bien distinta, pues de alguna manera se constituye en una función que consiste en causar el deseo en el otro, para que pueda tener noticia de esas fijaciones de goce que le constituyen. Una de las grandes conclusiones de la presente investigación es que el dispositivo del grupo operativo sí puede abordar lo real por lo simbólico, pero se tratará de un real que evidencia un goce compartido por un grupo, lo que significa que no se detendrá en el análisis de modos particulares de goce, no se detendrá en la singularidad. Ese sería el objetivo de un trabajo clínico individual, mientras que a nivel del grupo operativo, importará develar sólo aquellos goces que obstaculicen el trabajo o tarea grupal. Ahora bien, el tratamiento de lo real en cada discurso será diferente, como ya se anotó. Desde el discurso analítico, el otro podrá tener noticia de los S1 que lo empujan a repetir modos estereotipados de relación con el coordinador, el grupo o la tarea. El tener noticia no implica que esos S1 sean disueltos, borrados; serán anunciados, visibles como puntos ciegos que caprichosamente retornarán al grupo bajo diferentes disfraces, obstaculizando el trabajo. Desde el discurso histérico, lo real está oculto debajo del agente como una verdad que lo hace sujeto dividido, en falta, sin posibilidad de armonía, de completud. Esta noticia convierte al agente en un ser sensible a los amos, a los no castrados. Su misión será develarle al otro su falta y es esto precisamente lo que acerca tanto a este discurso al analítico, pues aquí también se produce un saber cercano a lo real, y ese saber es la castración. Desde el discurso del amo y el universitario, lo real también hace presencia, pero ya no como un saber que se construye, sino como algo que se oculta, como un agujero o como un desecho. Lo simbólico no bordeará lo real, más bien será subordinado por éste, impidiendo el trabajo y tarea de un grupo operativo, el cual es la construcción de un saber inédito. 6666.3..3..3..3. TerceraTerceraTerceraTercera Conclusión:Conclusión:Conclusión:Conclusión:
  • 154 Hacer pasar los elementos grupo, tarea y coordinador por el lugar del agente en el discurso del amo, produjo una serie de elaboraciones. Si hay algo en común con el lugar del agente en este discurso, es que se presenta como un S1, como un amo, como un tirano del otro. Es así como el grupo es amo cuando se encuentra en la segunda fase: “yo soy vos”. Es amo porque busca la unidad, la monosemia, y ello lo convierte definitivamente en una masa con toda la lógica que le subyace a este tipo de vínculo, en el cual la verdad está en el grupo y todo lo diferente es desechado. Sin embargo, existe otro matiz en el que el grupo operativo se convierte en amo de su proyecto. Él es causado por un tercero que los congrega y ese tercero es la tarea. Cuando la tarea se sitúa en el lugar del agente, se producen varias consecuencias. En primer lugar, la tarea entendida como trabajo se puede constituir en un factor “tiranizador” del grupo, en un imperativo categórico al estilo de un superyó que ordena no cesar de trabajar y que genera en el grupo y su coordinador, efectos de angustia si hay sesiones en las cuales no se produjo ninguna conclusión importante. El grupo sentirá que si no dilucidó algo nuevo, entonces perdió el tiempo. Este modo de tiranía se conjuga a su vez con la tarea entendida como producto, lo cual en su versión amo se convierte en un exceso que obliga al grupo a tener siempre productos, no importa cuales sean. Casi lo de menos es lo que se produjo; lo importante es quitarse ese tirano de encima que los obliga a crear objetos. Igualmente el grupo puede ser tiranizado por los ideales, por la ilusión de encontrar la perfección, el producto sin falla, el grupo perfecto. En último lugar, cuando el coordinador se identifica con el S1, se convierte en un amo. En este caso, es el mismo coordinador quien se convierte en la figura superyoica, que termina apabullando al grupo y exacerbando las ansiedades paranoicas. El grupo, en consecuencia, estará siempre en función de agradar al coordinador para evitar su crítica implacable. Ya no es la tarea la que lo congrega, sino el aplacar las retaliaciones del amo. Como puede observarse, el vínculo social que promueve el agente del discurso del amo trasladado a un grupo operativo va en contravía de su objetivo principal, pues de un lado lo masifica, lo homogeniza y le impide construir un saber inédito sobre la tarea explícita e implícita. Este discurso pone a marchar al grupo, sí, pero bajo una voluntad ciega que los aliena al discurso del Otro, llamase éste trabajo, producto, ideales o voluntad del coordinador. 6666.4..4..4..4. Cuarta ConclusiónCuarta ConclusiónCuarta ConclusiónCuarta Conclusión En el discurso universitario, el saber está en el lugar del agente. Ello significa que toda representación del saber –la constitución, la Biblia, textos académicos, entre otros -, se convierte, en este discurso, en una especie de amo para el otro.
  • 155 ¿Qué pasa entonces cuando el grupo se sitúa en el lugar del agente (S2)? Se ha señalado en la investigación lo importante que le resulta a un grupo operativo que su coordinador le suponga un saber al grupo, conferimiento necesario para que éste se autorice progresivamente en sus elaboraciones y deje de esperar que el gran saber le venga de un texto o un ser excepcional. Sin embargo, hay otra faz que puede resultar problemática y ella ocurre cuando el grupo se sitúa como el que todo lo sabe. Esta situación es paralizante pues cualquier pregunta, sugerencia, intervención, que les venga del otro, será desechada como inservible. La tarea de un grupo operativo también puede ocupar el lugar del agente en el discurso universitario. Y este lugar, como ya se refirió, es una articulación significante relativamente estática. Un ejemplo son las tradiciones, las doctrinas, las morales y las ideologías. En tal sentido, quien participe de un grupo regido por esta lógica, estará en la posición de un recipiente vacío (“a”) presto a ser llenado con los significantes que hacen parte de ese saber sacralizado. De igual modo nos encontramos al coordinador ocupando el lugar del agente en este discurso, con varias consecuencias para el funcionamiento de un grupo operativo. Es así como la voluntad de amo del coordinador en el discurso universitario se esconde tras el saber que promueve, saber que podrá ser el texto mismo, bien sea éste un saber religioso, académico, filosófico o técnico. La cercanía de este tipo de discurso con el funcionamiento de ciertos grupos operativos se encuentra cuando el imperativo implícito que allí circula es la adoración y sacralización de los textos. Si el coordinador promueve en el grupo una relación de sometimiento a lo estudiado, si sanciona cualquier interpelación, el grupo se tornará en un grupo de feligreses frente a un amo disfrazado de erudito. 6666.5..5..5..5. Quinta conclusión:Quinta conclusión:Quinta conclusión:Quinta conclusión: Un grupo operativo bajo el discurso histérico tendrá consecuencias en su funcionamiento. Ya se anotaron las consecuencias adversas que supone el que el grupo se sitúe en el lugar del agente en el discurso del amo y en el universitario. La investigación igualmente permitió situar lo que pasa con el grupo situado en el lugar del agente en el discurso histérico. El significante que se encuentra en este discurso en el lugar del agente es el significante del sujeto dividido [$], lo cual significa que el lenguaje convierte al sujeto en deseante, en falta. Ello supone que un grupo ubicado en el lugar del agente es un grupo en falta que se dirige a un amo. La falta puede ser fundada por el compromiso que el grupo ha adquirido con la tarea, pues algo falta por saber y ningún S1 colmará esa falta. Pero de igual modo el grupo puede buscar en el otro respuesta a su malestar, ese malestar que lo divide entre lo que quiere y puede. La respuesta del coordinador frente a este tipo de demandas hará que el grupo se posicione en uno u otro
  • 156 discurso, pues puede responder como amo o como el que todo lo sabe. Sintetizando, un grupo que esté “histerizado”, será un grupo dispuesto a encarar una tarea, dispuesto a trabajar y producir. En segundo lugar, la tarea puede igualmente estar en el lugar del agente en el discurso histérico. Y la tarea en el lugar del sujeto dividido se constituye en algo del orden sintomático, en algo que no marcha, hecho que lógicamente interpela al otro, el cual puede ser el grupo, pone en cuestión la ilusión grupal de la omnipotencia y de la completud. El grupo operativo es un dispositivo, que a diferencia de otros, busca develar eso que no marcha, explicitar lo velado, lo oculto que obstaculiza el trabajo. Al grupo operativo no le interesa únicamente la construcción de un saber teórico, sino también y, sobre todo, la construcción de un saber sobre aquello que no marcha. Por esta razón el discurso histérico parece tener mucha cercanía con el objeto del grupo operativo. Cuando el coordinador agencia un modo de relación con el grupo bajo la modalidad del discurso histérico, igualmente se sitúa en el lugar del sujeto dividido ($). Esto significa que éste será un sujeto que tiene noticia de la inexistencia del individuo, de la unidad. Es así como el coordinador, al hacer evidente su división, hace que aparezca algo que oculta el grupo que está en el lugar de amo (S1), y ese algo es que él también es castrado. La intervención del coordinador se acentúa allí donde el desarrollo de la tarea del grupo esté amenazado por alguna forma de completud imaginaria, que los puede dejar bajo la ilusión de que ya todo se sabe. Como puede observarse, tanto el grupo y la tarea, como el coordinador en el lugar del agente del discurso histérico, favorecen la operatividad grupal, pues evitan la estereotipia, la quietud, los falsos remansos. Interpelan al grupo y al coordinador, lo enfrentan a su falta y lo alientan en el trabajo alrededor de la tarea que convoca al grupo. Esta modalidad del discurso le recuerda al grupo que no existe la última palabra, que no existen las certezas, y es precisamente esta característica lo que puede favorecer en un grupo operativo la creación, la subversión de lo establecido. De modo tal, que entre mayor urgencia exista en el agente por establecer la unidad, más terminará distanciándose del discurso histérico y a su vez del objeto del grupo operativo. 6666.6..6..6..6. Sexta conclusión:Sexta conclusión:Sexta conclusión:Sexta conclusión: Por último, la investigación se ocupó de pensar los efectos que tiene en un grupo operativo el funcionar bajo el discurso analítico. ¿Qué sucede cuando en el lugar del agente –objeto a – encontramos al grupo? Una de las afirmaciones más relevantes del texto que se ocupó de esta reflexión nos dice que el pasaje de un grupo operativo al discurso analítico se logra en la tercera fase de su funcionamiento. El grupo se convierte en causa de sí mismo, en
  • 157 promotor de sus proyectos, en un alienado de su propio deseo más que del deseo del Otro, lo que le posibilita no buscar más chivos expiatorios de aquello que no marcha, pues el se hará cargo de sus malestares y de sus propias maneras de gozar. Este pasaje al discurso analítico es facilitado por un coordinador que renuncia a su voluntad de amor y al goce narcisista de ser puesto en el lugar del falo. Este tipo de vínculo facilitará que el producto sea ese significante amo que transformará el ECRO del grupo mismo. De igual modo nos podemos preguntar qué sucede cuando la tarea esta en el lugar del agente. La tarea en el lugar del agente del discurso analítico puede tener varias connotaciones. Una de ellas supone concebir la tarea como objeto de amor, lo cual significa que ésta aparece como una representación meta que causa al grupo, que lo moviliza hacia el trabajo. La segunda connotación de la tarea en el lugar del agente en este discurso es como causa del deseo. Ésta será una tarea que siempre le recordará al grupo la falta y será la falta en cierta medida la que cause, la que empuje. Sin embargo, por el carácter metonímico del deseo se corre el riesgo de que el grupo nunca logre hacer condensaciones de los saberes que va construyendo y que la falta misma sea lo único visible y notable, asunto que va a restarle importancia a lo que construyan. Una tercera connotación de la tarea es la de objeto parcial, en la cual podemos vislumbrar a un grupo que ha convertido en causa los objetos de la pulsión relativos al hacerse maltratar, maltratar o descalificar permanentemente al otro, buscar siempre chivos expiatorios, quejarse porque se sienten exprimidos, materializar en alguna mirada un goce voyeurista que a su vez los paraliza, en fin, cualquier objeto que haga gozar al grupo y que por esa misma razón no le da espacio para la producción de saber. Quizás cada grupo vaya constituyendo una especie de goce en esta vía que de acuerdo a como se posicione el coordinador podrá ser nombrado y analizado por sus integrantes. Pasemos a señalar los efectos que fueron mencionados en la investigación, relativos a los que tiene en el grupo operativo el hecho de que el coordinador se sitúe en el lugar del agente del discurso analítico. Se partió, para tal fin, de una frase de Lacan relativa al quehacer del analista: “debe encontrarse en lo opuesto a toda voluntad declarada de dominio”. Esta recomendación permitió puntualizar cómo los discursos no se excluyen radicalmente y las posiciones del agente son oscilantes; por tanto, si se piensa la función de un coordinador que opere desde el discurso analítico, éste deberá cuidarse de esa voluntad de dominio que no cesa y de la que nadie parece curarse. Bajo esta advertencia que hace Lacan, tanto a nivel clínico como grupal, se señalaron luego tres versiones del agente similares a las trabajadas en el elemento tarea. Es así como el coordinador soportará una dimensión de objeto parcial. Decir que soporta significa que permite ser el blanco del desprecio del grupo en determinados momentos del proceso, sobre todo, en la primera fase, en la que
  • 158 prima el modelo de vínculo al estilo chupo y escupo. ¿Qué hace el coordinador con esa hostilidad del grupo? Procurar que el odio sea tratado en su dimensión significante para que de ello se derive un saber. A su vez, el coordinador bajo la modalidad del vínculo analítico será objeto causa del deseo. El coordinador será quien ponga en movimiento el deseo del grupo, en contravía a cierta tendencia a la inercia que habita en los seres humanos. Al ser el coordinador causa del deseo, el grupo será un sujeto dividido, en falta, causado por eso que no tiene, por eso que no sabe. Se trata, entonces, de promover en el grupo cierta insatisfacción inherente a la naturaleza del deseo, pero no una insatisfacción que paralice sino que, por el contrario, se convierta en causa, en razón para querer saber. El discurso analítico civiliza la relación con la falta, y la pone al servicio de la producción de saberes útiles a la cultura. También se pensó el coordinador como objeto de amor, ya que cualquier experiencia grupal pone en marcha el amor. La diferencia radica en lo que se haga con esta manifestación transferencial. Digamos que el coordinador, trabajando desde el discurso analítico, se sirve del amor, el cual recae en principio sobre su persona. Sin embargo, él no responde a las solicitudes de reciprocidad, por el contrario, a nombre de ese amor insta al grupo al trabajo, al discurrir significante, lo cual supone que el coordinador no intenta alimentar ese vínculo a expensas del trabajo; en este punto él se convierte en objeto que causa el deseo de saber y favorece el trabajo alrededor de la tarea. Para terminar, se puede notar cómo el dispositivo de grupo operativo puede ser pensado desde los cuatro discursos, incluyendo el analítico, que no tiene como territorio exclusivo los consultorios. Siendo los discurso modos de vínculo social, es posible pensar que tanto el grupo, como la tarea y el coordinador se sitúan en el lugar de objeto con sus múltiples acepciones, facilitando con ello, la producción de un saber sobre los significantes unarios que se van cristalizando en cualquier grupo humano. Es preciso entonces que el grupo se vaya enamorando de la tarea, que sea causado por ella más que por la presencia del coordinador. Que el amor al saber y la curiosidad que de éste se deriva sea el motor. Cuando ello ocurre, el coordinador parece casi inoperante, pues el grupo ha logrado construir un deseo propio que va más allá de la satisfacción narcisista que procura el reconocimiento del coordinador.
  • 159 BBBBBBBBIIIIIIIIBBBBBBBBLLLLLLLLIIIIIIIIOOOOOOOOGGGGGGGGRRRRRRRRAAAAAAAAFFFFFFFFÍÍÍÍÍÍÍÍAAAAAAAA Adamson, G. (1977). Fases y Mitos en grupo operativo. Buenos Aires: Nueva Visión. Badiou, A. (1990). Manifiesto por la filosofía. Madrid: Ediciones Borges, J. L. (1989). Obras Completas. Buenos Aires: Emecé Editores. Cátedra. Colli, G. (1994). El nacimiento de la filosofía. Barcelona: Tusquete editores.1 Dylan, E. (s.f.). Diccionario introductorio de psicoanálisis lacaniano. Buenos Aires: Paidós. Freire, P. (1969). Educación Liberadora. Bilbao: Editorial Zero. Freire, P. (1998). La Educación como práctica de la libertad. Barcelona: Siglo XXI. Freud, S. (1979) Más allá del principio del placer y otras obras (1920−22). Obras completas. Vol. XVIII. Buenos Aires: Amorrortu. Freud, S. (1979). El porvenir de una ilusión. El malestar en la cultura y otras obras. (1927−31) Obras Completas. Vol. XXI. Buenos Aires: Amorrortu. Gómez de Silva, G. (2001). Breve diccionario etimológico de la lengua española. México: Fondo de Cultura Económica. Heidegger, M. (2003). Carta sobre el humanismo. Madrid: Alianza. Hobbes, T. (1982) Leviatán. México: Fondo de Cultura Económica. Kojève, A. (s.f.) La Dialéctica del amo y el esclavo. Buenos Aires: Siglo veinte. Lacan, J. (1992). El Seminario, Libro XVII. El reverso del psicoanálisis. Barcelona: Paidós. Lacan, J. (s.f.). Seminario 11. Los cuatro conceptos fundamentales del psicoanálisis. Buenos Aires: Paidós. Lacan, J. (s.f.). Seminario 5. Las formaciones del inconsciente. Buenos Aires: Paidós. Mercado, P. & Vargas, W. (2004) Diccionario de equívocos (una poética del desvío). Buenos Aires: Alción Editora. Ospina, W. (2000). ¿Dónde está la franja amarilla? Santafé de Bogotá: Editorial Norma. Pichón, E. (1985). El Proceso Grupal. Del psicoanálisis a la psicología social (I). Buenos Aires: Editorial Nueva Visión. Pichón, E. (1995). Diccionario de términos y conceptos de psicología y psicología social. Argentina: Ediciones Nueva Visión.