• Like
  • Save
Gutell 015.nar.1988.16.r175
Upcoming SlideShare
Loading in...5
×
 

Gutell 015.nar.1988.16.r175

on

  • 121 views

 

Statistics

Views

Total Views
121
Views on SlideShare
121
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Gutell 015.nar.1988.16.r175 Gutell 015.nar.1988.16.r175 Document Transcript

    • Volume 16, Supplement Nucleic Acids ResearchA compilation of large subunit RNA sequences presented inaastructural formatRobin R.Gutell* and George E.FoxDepartment of Microbiology, University of Illinois, Urbana, IL 61801 and Department ofBiochemical and Biophysical Sciences, University of Houston, TX 77004, USAINTRODUCTIONThe present review provides a summary of all the publishedlarge subunit rRNAs as of December 1987. Instead of the usuallinear alignment the sequences are tabulated here as a series ofsecondary structure diagrams in which individual nucleotides areindicated. The reasons for this departure from past practice areseveral. The foremost is simply that in our experience thisformat is more useful. For example, considerable effort is nowbeing expended to study the higher order structure of the largerRNAs. Thus it is common to be reading a paper only to findreference to position X in Sequence Y. With diagrams such asthose provided here the reader will be able to readily identifysuch statements in the context of the known major outline of thesecondary structure of Sequence Y or for that matter any otherpublished sequence. Secondarily this collection, as istraditional, tabulates all the currently known sequences in oneplace. Finally we believe the collection as a whole iseducational in that it will make the reader aware of the extentof secondary structure variation in the large subunit RNAs andthe magnitude of work that still could be done to further refinethe secondary structures by collection of appropriate additionaldata.ORIGIN OF THE STRUCTUREAll of the structure diagrams are drawn in a format thatcoincides with that used for Escherichia coli. The E. colistructure itself is based on a seconda-y structure model firstpublished in 1981 (1). The present version contains importantunpublished modifications made by Gutell, Noller and Woese (2)and further unpublished refinements (Gutell, Noller and Woese,unpublished results; Jurka and Fox, unpublished results). All ofthe structures shown were established by comparative sequenceanalysis as discussed below. Due to data limitations someregions of some of the sequences are best regarded as of unknownstructural content at this time. No attempt has been made hereto compare the structures presented to the various sequencespecific secondary structures that frequently accompany thepublication of each sequence, though excellent agreement existswith one recently published general model (3). Likewise noputative tertiary interactions have been indicated on thefigures though a few are known (Gutell, unpublished results andref (3). In many cases there is evidence for a pseudoknot in the©) IRL Press Limited, Oxford, England. rl 75
    • Nucleic Acids Researchvicinity of E. coli position 2350 (Gutell, unpublished resultsand ref (3)) and when that evidence is favorable the interactionis indicated on the f igures.COMPARATIVE SEQUENCE ANALYSISFor pragmatic reasons the primary tool used in constructingthe individual structures has been comparative (or phylogenetic)analysis. This approach had its origin in the discovery of thecloverleaf structure for tRNA (4). It first began to reach itsmodern form with the analysis of 5S rRNA (5) and has emerged asa well documented procedure (2,6-8) The underlying assumption isthat functionally equivalent regions of the large rRNAs fromphylogentically diverse sources will have biologicallyequivalent structures. The procedure begins by aligning theprimary sequences using conserved sequence segments as a guide.Next the various columns of bases are individually intercomparedto detect compensating base changes that maintain Watson-Crickcomplementarity between the potential pairing regions. If anindividual helical element is independently tested several timesit is considered phylogenetically proven.The comparative method has certain limitations that thereader should appreciate in perusing the figures presented here.First and foremost is the need for sequences that exhibit thestructure being studied. For highly conserved features this maybe the entire data base. In other cases features may beextremely variable so that particular versions are only found inindividual phylogenetic groups, mammamalian mitochondria forexample. Secondly the feature must exhibit sequence variationwithin the subset of sequences that contain the feature. Withoutsuch variation a region can not be structured. Thirdly it shouldbe recognized that the approach necessarily produces minimalstructures. It is the nature of the method to allow theidentification of additional features as the data base grows.Thus, for example, the continuing refinement of the E. colistructure discussed above. Finally it should be appreciated thatit is very difficult to assess the significance of base pairsthat that can extend a particular helix in some organisms butnot all. Such base pairs are strongly supported by thermodynamicarguements but conflict with the comparative concept. The properresolution in such circumstances may have to wait until suchtime that more high resolution structure data is available.CURRENT DATA BASEAs of late in 1987 there were 40 distinct complete largesubunit RNA sequences published and at least five extensivepartial sequences in which at least 500 bases of the largesubunit RNA have been sequenced (We have not exhaustivelysearched for these). In addition in some instances sequenceinformation is available from more than one large subunit RNAgene from the same organism. Multiple rRNA genes frequentlyexhibit heterogeneity in sequence and this phenomenona may be ofmore than academic interest. The present collection does notaddress this matter however and in those few instances whereinformation from more than one large subunit rRNA gene isavailable we have arbitrarily picked one sequence for inclusionr176
    • Nucleic Acids Researchhere. The 40 known sequences provide a diverse sample coveringthe three major urkingdoms; eubacteria, archaebacteria andeukaryotes as well as the organelles. Table 1 lists thesequences, the common name of the RNAs involved, the totallength of the large subunit RNA inclusive of fragments such as5.8S and 4.5S rRNAs, at least one relevant GENBANK/EMBLaccession numbers if the sequence is in the data bases, a highlyabbreviated reference and a key to the complete references thataccompany this text.HOW TO READ THE DIAGRAMSThe structure diagrams were drawn to a single scale so thatthey may be readily superimposed or intercompared. This wasaccomplished by a computer program described elsewhere (6). Eachdiagram encompasses two pages with a crossover point to the nextpage indicated. In most bacterial cases a possible helicalstructure exists between the 5and 3 termini of the molecule.It is uncertain whether this helix is present in the functionalRNA or is simply a remnant of processing. In any event thereader needs to be aware that when it is possibly present itappears on both halves of the figure. Extensive base numberingoccurs on the E. coli diagram. On the other sequence diagramsonly occasional numbers are included. These occasional numbersrefer to the specific sequence on which they appear. In thosecases in which more than one molecule is include (eg 5.8S and28S RNAs) each is numbered separately.When a region contains no known structure it is drawn bythe computer program as a circular loop. In order to maintainthe scale and layout of the drawings it is not always possibleto draw large uncharacterized regions as unstructured loops.When this occurs the region of unknown structure is included asa detached linear array listed from 5 to 3. The Homo sapiensand other eukaryotic cytoplasmic sequences contain many examplesof this, though the same phenomenon will also be seen onmitochondrial and chloroplast diagrams. These linear arrays arelabeled with a bold letter and the positions included in thearray indicated. A second bold letter specifies where in thesequence the linear array belongs. These bold letters are usedin a consistent fashion so that a large unstructured area at thesame location in several diagrams always receives the same boldletter. In a few instances the uncharacterized array is smallenough to be shown as a loop in some but not all the diagrams.In those instances a bold letter is used to label the loops sothat it is obvious that an equivalent unstructured region ispresent.The reader should not conclude that the regions assignedbold letters are the only unstructured regions. Whenever roomexists the computer program draws the unstructured regions as alarge loop. A letter has only been assigned if the computer hasused the linear array display in at least one case. Many of theunlabeled unstructured regions are rather large. Obviousexamples can be seen by examining any of the mammalianmitochondria structures. Thus in many of the sequences presentedhere local regions which are often substantial in size are shownas unstructured. These regions clearly have a differentr177
    • Nucleic Acids ResearchTable 1. Listing of Large Subunit RWA Sequences that have been campletely or extensively sequenced.ORGANISMA: EUBACrERIA1. Escherichia coli2. Pseucasonas ae.ruginosa3. Bacillus subtilis4. Bacillus stearothermDphilus5. Anacystis nidulansChloroplasts6. Zea mays7. Nicotiana tabacum8. Marchantia polymorpha9. Chlorella ellipsoideaMitochondria10. Zea mays11. Oenothera berteriana12. Aspergillus nidulans13. Sacchar-anyces cerevisiae14. Schizo. pambe15. Paranecium primaurelia16. Paramecium tetraurelia17. Haso sapiens18. Mouse19. Rat20. Bovine21. Xenopus laevis22. Drosophila yakuba23. Aedes albopictus (mosquito)24. Crithidia fasciculata25. Trypanosas brucei26. Leisthania tarentolaeB: A}HAEBWrERIA27. Halococcus morrhuae28. Halobacterius halobiun29. Methanoooccus vanniellii30. Methanobacteriumtheoautotrophicum31. Desulfurococcus mobilis32. Thermoproteus tenaxC: EUKARYOTIC CYTOPLASMIC33. Saccharauyces cerevisiae34. S. carlsbergensis35. Hcao sapiens36. Mouse37. Rat38. Xenopus laevis39. Oriza sativa40. Caenohbsditis elegans41. Physarus polycephalum42. Crithidia fasciculataMajor Partial Sequences43. Mycoplasma PG5044. Apis mellifera mito.45. Dictylostellium discoidiun46. Lytechinus variegatus47. ChiapanzeeRMA TYPE LENGHT SHORT REFERENCE ACCESSICN # FIGURE # REFERENCE #23S 2904 PNAS 77: 201 198023S 2893 NMAR 15:7182 198723S 2927 GENE 37: 261 198523S 2928 DNA 3: 347 198423S 2876 GENE 24: 219 1983NAR 12: 3373 198423S & 4.5S23S & 4.5S23S & 4.5S23SJ01695Y00432K00637, M10606X00512X003432981 NAR 9: 2853 1981 X013652907 EJB 124: 13 1982 J01446, J014472914 Nature 322:572 1986 X04465, X016473207 Cur.Gen. 11:347 1987 --26S 3549 PLASMID 11: 198426S 3265 Cur.Gen. 9: 19852768 MR 10: 4795 198221S 3273 NAR 11: 339 1983-- 2705 EJB 169: 527 19877S & 20S 2634 NAR 9: 6391 19817S & 20S 2631 JBC 259: 5173 198416S 1559 Nature 290: 457 198116S 1582 Cell 22:157 198016S 1559 NMR 9:4139 198116S 1571 JMB 156: 683 198216S 1640 JBC 260: 9759 1985-- 1326 MAR 13: 4029 1985-- 1335 NAR 12: 7771 198412S 1141 NAR 13: 4171 198512S 1152 NAR 13: 4171 198512S 1157 MAR 13: 2337 198523S 2927 JMB 195: 43 198723S 2905 MOG 202: 152 198623S 2958 M3G 200: 305 198523S 3019 3MB 195: 43 198723S 3077 JMB 195: 43 198723S 3031 MAR 15: 4821 1987K01868J01527K00634K01749J01415J01420J01438J01394M10217,X00136X01078X02548X02547X03047,X00872Y003465.8S & 25S 3549 NAR 9: 6953 1981 J01355JBC 248: 3860 19735.8S & 26S 3550 NAR 9: 6935 1981 V012855.8S & 28S 5184 RNAS 82: 7666 1985 K03433,K03434MAR 4: 2495 19775.8S & 28S 4869 NAR 12: 3563 1984 X00525NAR 10: 5273 19825.8S & 28S 4943 NAR 11: 7819 1983 X01069,K01591MR 12: 3677 1984 X00521RIBOSCMES 86: 3915.8S & 28S 4270 MAR 11: 7795 1983 X00136JBC 260: 9759 19855.8S & 25S 3541 GENE 37: 255 1985 M115855.8S & 266 3662 NAR 14: 2345 1986 X036805.8S & 26S 3943 PNAS 80:3163 1983 V01159NAR 10: 2379 19825.8S & frag. 4085 EMBO J. 6: 1063 198723S 86912675.8S & 28S 34715.8S & 28S 66428S 1429NAR 15: 1327 1987MAR 15: 2388 1987MAR 12: 4171 1984NAR 12: 1737 1984PNAS 82: 766 1985X00601X00350K03433*Lengths indicated represent the portion of the molecule for which sequence has been published.r1781 172 183 194 205 21136 227 238 249 1411 2512 2613 2714 28- 2915 303117 3218 3319 3420 3521 3622 3723 3825 3926 3927 4029 330 4131 4232 333 34335 4445- 4636 474837 495038 51521639 535440 5541 5642 575843 12-- 59-- 60- 61-- 62__ 475
    • Nucleic Acids Researchstructure than is seen in E. coli or some of the other moleculesbut we do not as yet know what it is.This should not be seen as bothersome but rather asdefining an opportunity to obtain data from additional organismsin order to allow resolution of the problem area. In many casesthe difficulty stems from the fact that too few sequences areavailable or too little sequence variation has been displayed inthe known sequences to deduce a structure. In a few cases timedid not permit a though analysis and a recognizeable structulralfeature may have been overlooked. Also the reader should realizethat the comparative approach is a convergent one. The currentmodel should at best be perceived as a minimal one awaiting thediscovery of additional interactions. Thus small two and threebase helices may ultimately be found even in regions in whichconsiderable structure has already been identified as more dataaccumulates.5.8S RNA, 4.5S RNA AND OTHER LARGE SUBUNIT FRAGMENTSIt is one of the pecularities of the large subunit RNA thatit is sometimes genetically fragmented. The most well knownexample is the 5.8S rRNA and its equivalents that are found inmost eukaryotic o.ganisms. This RNA has been shown (9,10) to behomologous to approximately the first 150 positions of the E.coli 23S rRNA. Although genetically distinct it interacts withthe large subunit RNA through base pairing. In effect then thetwo together form a single RNA with a backbone nick in one ofits loops. The same phenomenon is also seen at the 3 end ofseveral chloroplast large subunit RNAs where the last 100 or sobases are separately encoded as a 4.5S RNA (11). In this casethe homology to the E. coli 3 terminus is obvious but the themechanism by which the 4.5S rRNA and the main large subunit RNAcomponent are held together is not. The most extreme case ofthis fragmentation phenomenon that is known is in Crithidiafasciculata where the large subunit RNA is actually assembledfrom six f-ragments plus a 5.8S rRNA (12). These variousfragmentation phenomenon are indicated on the diagram by labelsthat indicate where the respective 5 and 3 ends are located.The Crithidia fragments are labeled with the same lower caseletters that were used in the original publication (12) andnumbered as if they were a single large RNA.OVERLAY DIAGRAMS AND COLLECTION ARRANGEMENTIt is very useful in comparing structures to produceoverlay diagrams that display one structure relative to another.Several such diagrams are included here. In each case theunderlying structure is that of E. coli. Where the E. coli isunique it can be seen as a light gray. The bold structure isthat of the other organism indicated in the legend. Base numberson these diagrams always refer to E. coli. These overlay figuresshow immediately where the sites of structural variation betweenthe two RNAs are located. The overlay figures are used tointroduce the various sections of the collection. In each case aparticularly representative overlay is chosen so that the majorvariations in the group relative to E. coli can be seen.The collection begins with the five eubacterial sequences.r179
    • Nucleic Acids ResearchThese are virtually identical structurally and therefore nooverlay figure is included. They are followed by the fourchloroplast figures which again follow the virtually identicalstructural pattern. The Anacystis sequence used was arbitrarilythat of Douglas and Doolittle (13). The plant chloroplasts allhave a detached 4.5S at the 3 terminus but the alga, Chlorellaellipsoidea does not. The C. ellipsoidea sequence also is unusalin that it is claimed to contain an intron (14). We believe thatthis assertion is not convincingly established and thus theputative intron is shown on Figure 9a as an insertion region ofclass D. Several large subunit sequences have an insertion atthis location. If the C. ellipsoidea insertion is in fact anintron this would be very atypical as none of the known largesubunit introns correspond with common insertion regions. It ispossibile that experimental difficulties may have arisen due tothe propensity of large subunit RNAs such as E. coli 23S rRNA(15) to readily fragment. The location of this fragmentationsite has been localized in E. coli (1) to the region of the RNAthat corresponds to that which contains the putative intron inC. ellipsoidea.The largest portion of the collection contains themitochondrial sequences. These are assembled into three groupseach prefaced by a separate overlay figure. The first and mostinternally variable gLoup are those with large mitochondrialRNAs as typified by the overlay of Zea mays, Fig. 10. Thesemitochondrial RNAs resemble the eubacterial ones in size andstructure more than any of the other mitochondria do.Nevertheless they are marked by considerable varibility evenwithin the group. One unifying feature is the presence of anunstructured region H in the vicinity of E. coli position 1400in all cases. Structures are provided for all of these RNAsexcept Paramecium tetraaurelia which is virtually identical toP. primaurelia, Fig. 15. and Schizosaccharomyces pombe which waspublished after the structures were completed. The second majormitochondrial group are the rather small 16S RNAs that are foundin most higher organisms. Although much smaller, as the humanoverlay shows, Fig. 16, considerable structural similarity withthe eubacterial RNAs continues to exist. Finally the threekinetoplast mitochondrial 12S rRNAs follow. Here as is indicatedby the overlay, Fig. 24, virtually none of the structure in the5 half of the molecule is preserved, though considerablestructural conservation does exist in the 3 half of themolecule.The remaining figures are devoted to the archaebacteria andeucaryotic cytoplasm. As indicated by the Halococcus morrhuaestructural overlay, Fig. 28, the archaebacteria exhibitsignificant variation that exceeds anything that is seen amongthe eubacteria alone. Close examination of the archaebacterialfigures also reveals that unlike the eubacteria, thearchaebacteria, do exhibit some variation within the group as awhole. A figure is not included for Thermoproteus tenax becausethis sequence was inadvertantly overlooked. The main theme fromthe eucaryotic cytoplasmic sequences sems to be growth in size.Although not all the RNAs exhibit the effect to the same extentit is clear that several regions seem to be favored formacroscopic insertions of new material. As indicated by theSaccharomyces cerevisiae overlay, Fig. 34, the main theme ofrl 80
    • Nucleic Acids Researchsecondary structure is again repeated in the eukaryoticcytoplasmic RNAs. Excluding the large insertions, the eukaryoticRNA structure is remarkably like that of the eubacteria andarchaebacteria. The sequence of S. carlsbergenesis 26S rRNA isvery similar to that of S. cerevislae and thus is not shown as aseparate figure. In the case of rat, the corrected sequence (16)has been chosen for the figure presented here.AVAILABILITY AND ACCURACY OF THE DATAThe sequences presented here are maintained in aligned databases according to phylogenetic type. Due to the numerousmacroscopic insertions and deletions no attempt is made tomaintain a single aligned data base of all the sequences. Wetherefore cannot provide such an alignment on electronic medium.We can however provide individual sequences. Alternatively theinterested reader may get sequences directly from the electronicdatabases. When base ambiguity existed the IUPAC nomenclaturerecommendations were followed. Post-transcriptionalmodifications have not been indicated since these have not beendetermined in most cases. The reader should be aware howeverthat the large rRNAs do have a number of such modifiednucleotides. In the case of the 5.8S rRNAs which mostly havebeen sequenced at the RNA level the post-transcriptionalmodifications are frequently known, though not indicated here.The sequences presented here and the position number labels havebeen extensively checked but nevertheless may contain anoccasional error. The structures themselves are the best wecurrently have available. Although occasionally a helixindicated may be in error it is far more likely that one willhave been overlooked. Readers are invited to inform us abouterrors and ommissions of published sequences.ACKNOWLEDGEMENTSDr. Robin Gutells efforts in this undertaking weresupported by NIH grant #GM-17129 to Dr. Harry F. Noller of theUniversity of Santa Cruz and NASA grant NSG-7044 to Dr. Carl R..Woese at the University of Illinois. Dr. George E. Foxs effortswere supported by NASA grant NSG-7440 and NIH grant GM-37655.*Present address: GENPROBE Inc., 9880 Campus Point Drive, San Diego, CA 92121, USARE FERENCES1. Noller,H.F., Kop,J.A., Wheaton,V., Brosius,J., Gutell,R.R.,Kopylov,A.M., Dohme,F., and Herr,W. (1981) Nucl. Acids Res.9,6167-6189.2. Noller,H.F. (1984) Ann. Rev. Biochem. 53, 119-162.3. Leffers,H., Kjems,J., Ostergaard,L., Larsen,N., andGarrett,R.A. (1987) J. Mol. Biol. 195,43-61.4. Holley,R.W., Apgar,J., Everett,G.A., Madison,J.T.,Marquise,M., Merrill,S.H., Penswick ,J.R., and Zamir,A.,(1965) Science 147, 1462-1465.5. Fox,G.E. and Woese,C.R. (1975) J.Mol.Evol. 6, 61-76.6. Gutell,R., Weiser,B., Woese,C.R., and Noller,H.F. (1985)Prog. Nucl. Acids Res. & Mol. Biol. 32,155-216.7. Fox,G.E., (1985) in The Bacteria" (C.R. Woese and R.S.Wolfe, eds.) 9,257-310.r1 81
    • Nucleic Acids Research8. Olsen,G.J. (1983) Ph.D. thesis, Univ. Colorado9. Nazar,R.N. (1980) FEBS Lett. 119,212-214.10. Walker,W.F. (1981) FEBS Lett. 126,150-151.11. MacKay,R.M. (1981) FEBS Lett. 123,17-18.12. Spencer,D.F., Collings,J.C., Schnare,M.N., and Gray, M.W.,(1987) EMBO J. 6,1063-1071.13. Douglas,S.E. and Doolittle,W.F. (1984) Nucleic Acids Res.12,3373-3386.14. Yamada,T.,and Shimaji,M. (1987) Curr.Genet. 11, 347-352.15. Allet,B., and Rochaix,J.D., (1979) Cell 18,55-6016. Wool,I.G. (1986) in Hardesty,B. and Kramer,G. (eds.),Structure, Function and Genetics of Ribosomes,Springer-Verlag, pp.391-412.17. Brosius,J., Dull,T.J., and Noller,H.F. (1980) Proc. Natl.Acad. Sci. USA 77,201-204.18. Toschka,H.Y., Hopfl,P., Ludwig,W., Schleifer,K.H., Ulbrich,N. and Erdmann,V.A. (1987) Nucleic Acids Res. 15,7182.19. Green, C.J., Stewart, G.C., Hollis, M.A., Vold, B.S. andBott, K.F. (1985) Gene 37,261-266.20. Kop, J., Wheaton, V., Gupta, R., Woese, C.R. and Noller,H.F. (1984) DNA 3:347-357.21. Kumano,M., Tomioka,N. and Sugiura,M. (1983) Gene 24,219-225.22. Edwards,K. and Kossel,H. (1981) Nucleic Acids Res.9,2853-2860.23. Takaiwa,F. and Sugiura,M. (1982) Eur.J.Biochem. 124,13-19.24. Ohyama,K., Fukuzawa,H., Kohchi,T., Shirai,H., Sano,T.,Sano,S., Umesono,K., Shiki,Y., Takeuchi,M., Chang,Z.,Aota,S., Inokuchi,H., Ozeki,H. (1986) Nature 322, 572-574.25. Dale,R.M.K., Mendu,N., Ginsburg,H. and Kridl,J.C. (1984)Plasmid 11,141-150.26. Manna,E. and Brennicke,A. (1985) Curr. Genet. 9,505-515.27. Kochel,H.G. and Kuntzel,H. (1982) Nucleic Acids Res. 10,4795-4801.28. Sor,F. and Fukuhara,H. (1983) Nucleic Acids Res. 11,339-34829. Lang,B.F., Cedergren,R., and Gray,M.W. (1987) Eur. J.Biochem. 169, 527-537.30. Seilhamer,J.J. and Cummings,D.J. (1981) Nucleic Acids Res.9,6391-6406.31. Seilhamer,J.J., Gutell,R.R., and Cummings,D.J., (1984) J.Biol. Chem. 259, 5173-5181.32. Anderson,S., Bankier,A.T., Barrell,B.G., de Bruijn,M.H.L.,Coulson,A.R., Drouin,J., Eperon,I.C., Nierlich,D.P., Roe,B.A., Sanger,F., Schreier,P.H., Smith,A.J., Staden,R. andYoung,I.G. (1981) Nature 290, 457-465.33. van Etten,R.A., Walberg,M.W., and Clayton,D.A. (1980) Cell22, 157-170.34. Saccone,C., Cantatore,P., Gadaleta,G., Gallerani,R., Lanave,C., Pepe,G. and Kroon,A.M. (1981) Nucleic Acids Res.9,4139-4148.35. Anderson,A., de Bruijn,M.H.L., Coulson,A.R., Eperon,I.C.,Sanger,F. and Young,I.G. (1982) J. Mol. Biol. 156, 683-717.36. Roe, B.A., Ma, D-P., Wilson, R.K., and Wong, J.F-H. (1985)J. Biol. Chem. 260,9759-9774.37. Clary,D.O. and Wolstenholme,D.R. (1985) Nucleic Acids Res.13,4029-4045.38. HsuChen,C-C., Kotin,R.M. and Dubin,D.T. (1984) Nucleic AcidsRes. 12,7771-7785.rl 82
    • Nucleic Acids Research39. Sloof,P., Van den Burg,J., Voogd,A., Benne,R., Agostinelli,M., Borst,P., Gutell,R., and Noller,H. (1985) Nucleic AcidsRes. 13,4171-4190.40. de la Cruz, V.F., Simpson, A.M., Lake, J.A. and Simpson, L.(1985) Nucleic Acids Res. 13,2337-2354.41. Mankin, A.S. and Kagramanova, V.K. (1986) Mol. Gen. Genet.202,152-161.42. Jarsch,M. and Bock,A. (1985) Mol. Gen. Genet. 200, 305-312.43. Kjems,J., Leffers,H., Garrett,R.A., Wich,G., Leinfelder,W.,and Bock,A. (1987) Nucleic Acids Res. 15,4821-4835.44. Georgiev,O.I., Nikolaev,N., Hadjiolov,A.A., Skryabin,K.G.,Zakharyev,V.M. and Bayev,A.A. (1981) Nucleic Acids Res. 9,6953-6958.45. Rubin,G.M. (1973) J. Biol. Chem. 248,3860-3875.46. Veldman,G.M., Klootwijk,J., de Regt,V., Planta,R.J.,Branlant,C., Krol,A. and Ebel,J-P. (1981) Nucleic Acids Res.9,6935-6952.47. Gonzalez,I.L., Gorski,J.L., Campen,T.J., Dorney,D.J.,Erickson,J.M., Sylvester,J.E. and Schmickel,R.D. (1985)Proc. Natl. Acad. Sci. USA 82,7666-7670.48. Khan,M.S.N. and Maden,B.E.H. (1977) Nucleic Acids Res.4,2495-2505.49. Hassouna,N., Michot,B. and Bachellerie,J-P. (1984) NucleicAcids Res. 12,3563-3583.50. Michot,B., Bachellerie,J.P., and Raynal,F. (1982) NucleicAcids Res. 10,5273-5283.51. Chan,Y.L., Olvera,J.,and Wool,I.G. (1983) Nucleic Acids Res.11, 7819-7831.52. Hadjiolov,A.A., Georgiev,O.I., Nosikov,V.V., andYavachev,L.P., (1984) Nucleic Acids Res. 12, 3677-3693.53. Ware,V.C., Tague,B.W., Clark,C.G., Gourse,R.L., Brand,R.C.and Gerbi,S.A. (1983) Nucleic Acids Res. 11,7795-7817.54. Roe,B.A., Ma,D.-P., Wilson,R.K., and Wong,J.F.H. (1985) J.Biol. Chem. 260, 9759-9774.55. Takaiwa,F., Oono,K., Iida,Y. and Sugiura,M. (1985) Gene 37,255-259.56. Ellis,R.E., Sulston,J.E. and Coulson,A.R. (1986) NucleicAcids Res. 14,2345-2364.57. Otsuka,T., Nomiyama,H., Yoshida,H., Kukita,T., Kuhara,S.,and Sakaki,Y. (1983) Proc. Natl. Acad. Sci. USA 80,3163-3167.58. Otsuka,T. Nomiyama,H., Sakaki,Y., and Takagi,Y. (1982)Nucleic Acids Res. 10, 2379-2385.59. Rasmussen,O.F. and Christiansen (1987) Nucleic Acids Res.15, 1327.60. Vlasak,I., Burgshwaiger,S. and Kreil,G. (1987) Nucleic AcidsRes. 15,2388.61. Ozaki,T., Hoshikawa,Y., Iida,Y. and Iwabuchi,M. (1984)Nucleic Acids Res. 12,4171-4184.62. Hindenach,B.R. and Stafford,D.W. (1984) Nucleic Acids Res.12, 1737-1747.rl 83
    • Nucleic Acids ResearchSecondary Structure of eubacterial 23S Ribosomal RNA: Escherichia coliAAA tAACCAuCCAUCAu GAA^C ACC A A %CGCC GuGAUCGGUAGUA%XCIof IAtCCG AAAUI IC GGAc G5cA ... I. CACAC CA01 AA,0A IUG*oxo^C-C~~~~~~~~~~~~~~~g-CC AA CG CUACCC Gu C GCC Cu u CCu G C C C ^ <o G COWGw .wACA8 AA UCG~~~~~~~~~~~~~~~~~~~~~~~GoeU^uc .GxcGGc&s,ACC AG`A A GAAAA :A~~~~~~~~~aAA~~~~~~~~~~~~~~~~~~~~~~A AAjA AA ACA.AAAAAC AAC AA AAAAAC GA cA A ~~~~~~~~~~~~~~~~~~~~~~~~~ACA:CC AACAAAAAAAAUC2:EGAA cAWAAGAAA AAAAG AAAGA 3 A A0 UA "OGA-AAAA A C UAfA AGCCUCC AGUGGUC .Gv A AAI¼AA AAAAG*GCJGAAAcc AACUCA uGA%A A A9CCrGAAAjGF 31 AACCAAAAAACAA- A-A ~~~~~~~~~~~~~~GAFig. IcaEsclwr,ch/o coilrir84
    • Nucleic Acids Research1870GC AAuGAU GG *UUGCGAc GC-G*fu A-C 2 e-G210G 2 8i0A-,gAG UGAG-C G GG AC UU -ACUu GGAkU 2 20 Ai GA6TU-AA GU.A UA A G GAGC AGG GGUGG CUE : U CCACC UJ^GC 2110t- GAUG CGAA AGUU C 9130 U UU- UAAUUCC A C -GA UUA u GGAAC2100 G C C%ACGUGCCA2% Y-GU-AU A C~~~~A 8 22CCGGCU AGA G 220 C^^UGAA:.AI GC CCGAGGGUGCCGUCU_~CGCCCCUI <1.l4--66161 A UAGCUUGGGGCU A G8GAG ACUUi8A AGAGUU-AGGA AAUC U- A-4.auG :8UCUGG GC20,0A-AA C--GA0 GU G^A-uu ~~~~GGG__ U~~~~~A~ AAUUAGA2G7UA-GAA GCAA20MGAAA%UAGU %G UA %UAAc~~~~GGCUGA UA CC GCC/I AUL CG%UUGUGGCGG CC 262 2610 A l CAG,G CACAC-USA CAUGA " AGGCC G.v>G §UGGC .G G- AC CUGGGCUGUCj,A U AAG?UU8fAUGG(GAA(?CCUGGA0276 C A 2120 tA C8I?GAG GAACC 2260220A GmkCG AA 0-G A G27010 8 AuAX%%% A ~ ~ AA N~~~~~~AFig.Ib£scherichic co/irl85
    • Nucleic Acids ResearchSecondary Structure of eubacterial 23S Ribosomal RNA: 5halfFig.2aPseudomonas aeruginosar186
    • Nucleic Acids ResearchSecondary Structure of eubacterial 23S Ribosomal RNA: 3halfaca2300C0Fig.2bPseudomonas aeruginosa,187
    • Nucleic Acids ResearchSecondary Structure of eubacteral 23S Ribosomal RNA: 5half1000Fig.3oBacillus subtilisrl88
    • Nucleic Acids ResearchSecondary Structure of eubacterial 23S Ribosomal RNA: 3halfcc2730Fig.3bBacillus subtilisrl89
    • Nucleic Acids ResearchSecondary Structure of eubacterial 23S Ribosomal RNA: 5halfFig.4oBacillus stearothermophilusri90
    • Nucleic Acids ResearchSecondary Structure of eubactenal 23S Ribosomal RNA: 3halfFig.4bBacillus stearothermophilusri 91
    • Nucleic Acids ResearchSecondary Structure of eubacterial 23S Ribosomal RNA: 5half-100Fig. SaAnacystis nidulansrl92
    • Nucleic Acids ResearchSecondary Structure of eubacterial 23S Ribosomal RNA: 3half%AXAG C - GAle a-CACGGGUAoUA11111 AC U AUUGCCCACA3 c-^ 2800G-UA UUG CC U GA^AAAGU: UAGAUA- uG^ cGAFig.5bAnacystis nidulansrl 93
    • Nucleic Acids ResearchSecondary Structure of chloroplast 23S Ribosomal RNA: 5halfFig.6oZea maysr094
    • Nucleic Acids ResearchSecondary Structure of chloroplast 23S Ribosomal RNA: 3halfAC-G%o CC*gUA0 UGAA GA1895-C-C AcU8 CAGA AG 6SPG AGGCGACGG A AUAUACU a#X0 G AGGUGG C:1C2 OCACIIIIIIII I OACAAUCUCC G UAGC-a tl A2O&C UAGAGUO ^°4 ^sAAG CCUU UGCGG A ACA 0A*u U UAG auAGC A A U A GUGeCAA-C A 1L10(;AcA%~~~~~~~~~~~~~~~~~~~~~=A~~-A ACGCCCA ,a8 GU u 00-G~~~~ZamayUA U-AA 230020tU4 A~~.~CGCAGUGACCAG4:2 G CUdGUCAGAC S8ikoAGoeau~~A oi *llc111ccUCAAUGCCCCGAUACGCUCAI c U- GAA4ACGGGCGC C- c1800 1c AGU 8SUG A A u .GGAC-u.GGa U-AU-A VSAGAC-G C ~~~~~~~AG-: UA AAAUGG GAuu ACUGCAAGAUU=A A c ~ ~~~~~~~~~~~ACGAGCUGCCGAAAUAG GCAGC20C CGGCGCA= U-AAJGACAGACAUAUA A UIU CCCUIGCACc!GGACAGAAAGGGGUGUGGCCUACI.*ltl It CU9 CG%bUUGGAAGGG CU ACCAGAU ~~~~~GCACG%%eAGAC A",A AGGca CuUGuGau 26004.5S CUCU"% aUG&ACG,6GA5CU3AAtGUC% %GCAAUO 23S $,UC.4CC.GAC- CAG AGAACCC9%ACCUU%%AGG Aj. U9G 1 11AA345SGtC AU CACCUGGAGCUGUSA A cUAAA~CAG A A C C~~~~~~~, A C lllIU.AGCA_ U C O C C UUGUM1CUGUU = G C A A GAUcAC U G~~ ~~~~AACA UGG CCOA AG AAAU,e.CU-A-50 2QUZea maysr195
    • Nucleic Acids ResearchSecondary Structure of chloroplast 23S Ribosomal RNA: 5halfA~A0A c1100 AACACA C CC A tCA AA~~UcCAUAUAAA%?CACAAAC~~~~~~GGAACGACCA C,AGGCGtACCCA A CAAAUAACG GUACUCo,A A oIl-fill fiA AGCA,CGUUUGGAu cuc~~~~~~~~~~~~~~~AAA0 eCLCCA AAA CAGA~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~50A tICAIA C.ACA a1400 -GAG ~~~~~~~~~A ACAic-dk~~ ~ ~ ~ ~ G A C C. A CG AA AAGCAGAC GA GCCCAAAA C A -UA G ACA A A"~~~~~~~~~~~~~~~~~~~~~~~~~CA A ~~~~~~~~~ AGAA U-AG-U ACC~~~~~~~~ACCA U C 160A G u2:CGGACAGGAAcRcP GAC AAA0~ ~ ~ ~ ~ ~Ad3~~~~~~GA AGAG A-UA GA- ACAeAA-CGGACGIA AACCG GAAACA A-A~~~~~~~~~~CA eCOUAHAaCAAAACA 16007Fig.7atobaccorl96c4
    • Nucleic Acids ResearchSecondary Structure of chloroplast 23S Ribosomal RNA: 3halfAUGAG-CC-AAC-G00p8-tAe U SC uC CcA "A U Ga CU A G CG A A a c7oC- 0 A AAA CA A AAG CA u AG-CCA6- AC-GA AU a. Ug AG . AUU A U GCUU AMAUU:.A A A A Au. toCGCGUCACCG-CUGCAGC P.. G oilI A18OO- 6. C UCACC cG G *AA CA Ga U Cu UAG UAGAGUA AAACA ACGCC uAAGGU AC U - AC .... 11CG U-ACACUUUGUUGCCA U G CACC 2A C LA A G GGGAGCA C U 7uGCUGGC ACGCA^ %760 G^UGUA A AU~~~~~~~~~..G50 ^cu UuG-0 220078UA~~~~UCUGCGCAGUGA UGGU~A A j .G BCCAGSCCUU,?GUCAG)5CAG CUU1111-10 G A1700GCUA 27GA Ad Au-2000 C§CAC G -U U A5G A- GAGU C8170A-U U-AL A U7 AGAC ~~~~~~~-ALAu GFGcig. 7 AAGACGAuLG%Uoa8-A A A-:UUAAACCA GACAG-G G C 25004.5SCUCU~~~~~~~~A~UUGGUG cC GU C1AC/UsCUUCG§A~~~~ U~~~ %.uG U~~~~~ a U0-CAu5~G~100~:S 23S~CAAUAuG AU~ UA GAMGGAG-ACGGGA GA:ACGCA.7111 CCA U(A3A4.5SA L~~ ~ ~~~~~~ACCA A *iG-iuc %~C G U:U AUa GCAU A U :uAA%.G C cA C -GAU %UAGCL U IF~~CA C G A0 A A G ~ ~~ ~~~A UUU 0 C A 2760LUGGAAC U GAL C0~~~oLIGUGUCUCC GA 0 AA~~~~~~~J. CCACG*ALG cu C 2 600 u~AC. 271u AGUUG/G ig. lA~~C%% tobaccrl97
    • Nucleic Acids ResearchSecondary Structure of chloroplast 23S Ribosomal RNA: 5half-,00Fig.&oMarchantiapolymorpha: liverwortrl 98
    • Nucleic Acids ResearchSecondary Structure of chloroplast 23S Ribosomal RNA: 3half54.5S4.5S 3Fig.8bMarchantia polymorpha: liverwortrl 99
    • Nucleic Acids ResearchSecondary Structure of chloroplast 23S Ribosomal RNA: 5halfintron!?D: 1197 .1445UUUuuACA UAOAA@ACUuAACUUaUGCUCAA C:,AA,GUUAACOCACUGAAUUAUACCOUAAAUUUAUUUUU OUUCU C :gAUU^CUUCUGCoacouoouucuucoAC uuCA GFig.9aChlorella elllpsoidear200
    • Nucleic Acids ResearchSecondary Structure of chloroplast 23S Ribosomal RNA: 3halfC AAC-2CAAAuu A2100C ° .uu *7uGAA AAAACAC ACC 11111IICAUUUGU UGcA AA-CC-,AAu 3200 U aA~ ~ ~AA A AUGS GA AAcG - ACAGUAAA 11111 AC fGUCAAuCAG-CA UA AU Gb CC U Ga abACo , AuU0-CAGAU-Fig.9bChlorella ellipsoidear201
    • Nucleic Acids ResearchSecondary Structure of mitochondinal 23S Ribosomal RNA: 5halfFig.1OaZee mays overEscherichia coir202
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfFig.lObZea mays overEscherichia colir2030*noI
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfCOAUGOGUACACOAAAGuACOAAGUUGCUUUCUACUAACCAUGCCUGOAUCOUCG"GCGAAUUGGAUOAUCGGGCCOAGOOCUGCCCCCUCUUCCCCUCoCUCUCCUUUCCUUAAUAUUCACCoUCoAGuC AUCAA GCCGuCAACUAAUUCOGAGGOOCUCOOCUGOCCCGUCOCCCUACOCUACUGOCGCUUCCAAAGCOAACOUCUCOUCUUUGGCGACCAOCAAAOCAAACCOAGOGAOGoCUAAAACCUUUCGUUUUGAAoCAAGGoAUGAGCocoAAACGuuocGCUUCCoUACACOCoCAUACUCUUUGCCG UCOCOCGUoUAUUAMGU UAUACUUAGUACUUAACUUAGUACAAUAACOCGCAOCCGUUUUMGGCUACACGOUUCUCUAAAGOCOAAGACUCU"AGUUOOCOAACACUCOCC AGUGGOCOAACAUMCCGGCUCCCGGCUCCOCOCACCUGCUUACACCUUUCGMAGCACUUUCACOUGUMAACCOAAGUCOUCUUGUCCUUCCUUUCUCAUUUCAGUCCUCOCCUUUUUCAUCUUCCOUAMGGMCCUUUAGUCUUUUGAUUAOAOUAGAGUUCoC""oAaCAGAGcGUACCcCCCU CAUAMUCocooGGAUCUUAAUAGUCOGUCGCOACUGUUGUCAUAGUCAACOACGGUUUAAACUUCCAOGAAAAAACUuCGUUUUGMGAGGGCAUCCUCCCoGUGAACuGAF: 1559-23032351Fig.IIoZea maysr204
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfOUGAAAGG u2495.UAA A OGA G02AA: aC A2A CA CAA"AA8:8 ~~~%AAAA...1 ACCUo--C^CCU8~~~~~~~~-Ca^CAU 0GAI:G U~AAA A A:8-e U-A ~A-20UA 0 AeVcA-2600 AAOGUGOcu:A -c^ ^c ^ccc ^o -eo8,6 Al-iCU UCACCUU GAAA°A C eAeCUUUUUA C A UA AAAACA ACACC AA U:8UAUUUGUC UGUOG SlC A U uACC AA UU AAy A UUA GUa- AC-UC A%0CGCACC GAUema ayU2400=CGG~~~~~~~~AAGGGGU UGA C~~~~~~~~~ACC uOAA ~~A A0*GUSCCA UGA ALAAC~~~~~t~. GAu 3124W-A&AGQGGU1GI G~~~~~~~~AuG2f95 A ~~~~~~~~~~~aGCAC UAAUeCCCGUAAAAAUU ~~~~~~A- U=AiAAGO AAGI JA AU A A AAUGAC 2700A A C2 A8-c A~~~~~~~~~~~~~~~~~~~~~~~~~~~~G-GUGAUUCCAJG Ue :ACAA 7 COU GAC43A I-U~~~~~~G A GACACdIA a 3100*GC_AAAACCCAACGJUAGACAAGG =AA G ~~~~~~AC Ca :A G ~~~~~~~~~CA A3AA 200- U AA GU AGua CGk GCAGA CA%JAGAUAG~~JACAG% A ~~~~~~;S~*aGta A A%AAGA C~~~~~uA lA G-32AA ~ ~ JAU~i~GSCAACGSRAA~CG 2AACAACCAGCA CC~~~~~~~fiCA ill ,1"U U2 GGGUCAC AUGIAA~~~~~~~~~~~~~ AuU a c~~Za ayr205
    • Nucleic Acids ResearchSecondary Structure of mitochondral 23S Ribosomal RNA: 5halfF: 1619-2022LA GoG GA GC FA II, .,GCccA AGGACAGcc1600 AU - G&GA CAU AAUCU ACOCAOG cA ....IsI- AAUGA UGCGUCUGU AO GA AC AAU^ALA AMA AGUA GA-ACGAA 20c6° 2070,100Fig.12aOenothera berterianar 206COAUG"UACACGAAAGUGACOAAGUUGCUUUGACUACAOAACCAUGCCUoucuouuo"ocaAAUUG"UGGUCG"CC"CUCUCGUCGCCUCUUCCCCUCACUCUCCUUUCCCUAAUAUGAACCUUGAGUCAUCAAAGCCUUUCUGACUCOOCCUG"CCGGUCGCCCUAC"GACUGOCOCUUCAAAAGOCOAAACUCUCOUCOUAGUUUG"CUUUUGAAUCOACUGUUCUAGGGGG"CUAACGUCUUUU"AACOAGUAGG"UCGCGA"GAGCAGGCGUACC"CCUGCCAUAGUC"GAGUCUGUUUAUAGUCOCOACUGUUGUCAUAGUCAACAA4%GUU"AACUUCUAGOAAAAAACUUCOAAUUGGGAGC4CC.AUCCUCCCGGUGAA
    • Nucleic Acids ResearchSecondary Structure of mitochondfial 23S Ribosomal RNA: 3half311Fig.12bOenothera berterianar207a3 ,ACAAA%~ A39 A
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfA-UUa-GaUAU AC GAUUUUGAUGUUAUUU UJ 9U I I ll ll I- rGUAAAACUAAUUAUAAA UGU1250Au - u oUAUAUAAUACUCUUAAAUAAUAAAUAAUAAAAAAUUU AAAAACC UUAAAAAuaU ; UAUAAAAGGUUCUGGUAAAAUUUUUA A A CAAUAAUVAUAUAUAUAUUAUUAUUUA AAGCCAUUAGGAAUCAAUUAUAUAAA U UCUUAuUAAAAGUUUUCAAGAUuUAUUAAUUAUUUAUUAAUAUUUAUAAAAUAAUAAUAUUAUAUAUAAUUAl A AC F: 1299-1512:a AAUUAUAaUAUACAUAAAAU"_Caa-FSu99tS^_.CG 1561Fig. 13aAspergillus nidulansr208
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfA UUAA CGUAGUAGCG11IfAAOCAUCACA3,,2605Aspergillus nidulansFig. 13br209
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfF: 1409 -154359Fig.14aSaccharomyces cerevisiaer210
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfI: 2438-2558AAAUUGUAAGGAAAACAAUAAUAACUUUCUCCUCUCUCGGUGGGOGUUCACACCUAUUUUUA AU A OGU GUGAA CCCCUCUUCCGCCGUUCCGOAACUUAAAUAAAAAUCGAAAGAAUUAAAUAUA AFig.14bSaccharomces cerev,siaer21 1u39
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfF: 1027- 1116Fig. 15aParamecium primaureliar21 2u5u20afi20S8gAu
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfcGAAUUA A uu A- Uc U-A AAU A-U UUUAG GU A AUA UUAAAUCAUCuUA-UA-UA A .GU U-AU U-AA u -G3 UUC UUuc GCx cGO C-GG- GUUAG-CAU0UU2300Fig.15bParamecium primaureliar213uA
    • Nucleic Acids ResearchSecondary Structure of mitochondral 23S Ribosomal RNA: 5halfFig.16aHomo saplens overEscherichia cofir214
    • Nucleic Acids ResearchSecondary Structure of mitochondral 23S Ribosomal RNA: 3half0..........:Fig.16bHMO sa s overEscherichia colir215
    • Nucleic Acids ResearchSecondary Structure of mitochondral 23S Ribosomal RNA: 5halfoC4cocU GA AGAACoUAGCAGcCACCAA AUUA AGUAAACCGAUAU AACU CGAASOOC cCAcAA CAC Ccc~~~~~~~~~~fcAAAUAAU CAUAUCUACAA^UCAU A AAcAAAC AA ACA 70fA u~~~~~~~~~~~UAc~~~~~~~~~~~~~~*U A- CAU U ~ cs cAAG CAGC AA ~A-UU AAAAAAAAA60AAAAUGUA|C UC AAAUAAACUU AGAGGAA U~~~G UucUcC 8-AUUACU^^ u^scCc^^GA AAAA Ac c~~GcccXA G c0 0G UcA 2 C~~~~~~~~~~~~~~~~~~~~~-AU A U ACACU-A cc GUAAACCCCCAAUcUcIlk c A C CU400 A LAcLceAU-A-A43 GCUA A CU CCAC GAuGAc U A~~~UuAAC WAU GAACAACA CA ACUGA78AGAUA AeAAGAA AG~~~~~~~~~~~~~~~AUAu u UU~~~~~~~~~~~~CUGAu C, U~~~~~~~~~~~ACuc A A~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~A a~~~~~~~~~~~~~~~AAA~~~ ~ ~ ~ ~ ~ ~ ~~CAA_-UCOAA100 % CCAGAFig.17aHWomo sapiensr216
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfcACCA CAC ACCAUAA -UU C-GC2-UA G *UX AC%CC- C AG CAAAAACA CACCGCCU 91 CAAGC C C AAG6CCAUU GU*U C CO COOCCAC U-UUACA G-CCACucC-G UAA iC cG - ^ c8^:o 3AA alAAAAACA C 900 AAAGG A/GCc~~ ~ ~ ~ ~ ~ ^CIcI1I*aA 0 CCAUUUGU~ ~~~~~CcCG UCUCGUuCACACAGU800-CA A CUAAACCCZCaA AGU G AA C A-CA- CUUAAU0oA-U U A 00 0 COCAC~~uAGA - A UA-U U-AAA 6- AAUUc C CCCA-U U-ACUACGAA A UCAA0-1U00UACCA cUAACC80 A 0 0 U-A A G0C A UA-C CGA CU A AUA AG 0 U CA-U UA-A GGGcAA AA c U AAGA UA C cCOA6-AA u u AU CAAu U A G~~~~~~~~~~:S UZ~GCA UCC AG U CUAG UAAA~ ~ ~ C~-CUU6AUA U0 C 1G3000A_ CA~~Uc1000 ~ C A~G U-AUOCG-C AU:CCAA0 ACGUAAG C-G A cAAUU AAA CA3,A GA U-AAGUAA~A-UA CAC U UAGUGA 0A AA:A AACJ -8AAt U~~~~~~~~~GCGtAA A ~~~A CCA~~~~~~~~~~~~~~ A AG AC AUUCIIII1UG6AUUACGCAACCUU0 GC Ulluc GC UGGGiUU6AU CC 1500~~~~~~~~u U AA ACAACUCUACUAUAGUA ~ ~ L- % Au 40UUFig.17bHomo sapiensr217
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfAGA.OCACCAA AAAAAUCCGAIUGUA ACU CGAAPc AC CAA Au Au A500-A uA UOCAAUAAUCACACC UCs 44A UAUU A C AA Ac u AAUcuuAuA^^A-600795Fig.18aMouser218unCcAAUCACCcUCuu
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfACA 900cOU^a-ux^^^^^C^ucu VA cAC^Ul u C-.Co uA .Ut UgXCcAt.o10-c^"uA AUc=UoU CU gA g -A aA.JA9UCA Ot UUCACC00 A A AAACBCAAAAAACA^AA AAUAAACAAUUUGIA UUCACUAA UAAU%AoAUfUO1 _UO- %C CO C"¢sUACOAU.1 tiOOUCU ACza A AAAA{~~~~10 C°40u^uou^uua^A A A A 1200A UUAtAAAA~~~ ~ ~ ~ ~ ~~~~~~~~~d CUUCA 0 CUA -UA~~% U-A UAAA U=A AAA8000AAUA C-u 9-8 u A~ ~~~~~~~~~~u AA5U0 A AA AAA A- UAGCAUAGUA-U UU 1^C OCA%CUAA=U u~C Ac A~~AAAA au U-A AAA-u :iAC A AAA-U AU U111 I CCAUCUAU AA aAAA-U ICluU~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~SIItII Iu U-A CAGUU-IJ~UCC UUGOUA C AU U ~~~~~~~UACAU UCA AU AAioUGA~ ~ ~ A ACUUG UA c ACAAAA AC AA d,AC,U/ ~~~~~~~~~~k AA =AU~CCUUCAOUGaOA 1UGUUACAu%Be ~ ~ ig18UUAAoAA As0 AUUG ~ ~ C aA/ A1550AA%AAAUCUAA~~~~~~~A~zAl/a c~Fg.8uK% Gcu ousr219
    • Nucleic Acids ResearchSecondary Structure of mitochondral 23S Ribosomal RNA: 5halfpCAAGCCAUCAA A AAkIt C aA^^ *ucu AAtCAUA AAA UI"GAUSU A Aoc^A u50u AucuuAAA cc Ac c AUSC 0A AAAA cuA SU U CV _ C°u u Avooc^ AAACCAA AAA .uuc AAAAA AAA AAG0a^@u V20XC A up.c t c6u~~ ~uA Ag ACIAA A A A.A ACAA A AAACOUAAA C A ~ ~~~A UUACA AG CGGAAA AA AA:c A&-AA ~ ~~~~~~AA.ACA A- AAcAAA-A AAA A iAACA AAA AVA u ~ ~ ~ ~ ~ ~ ~ ~~~~~~~A-600A GA ~~~~~~~A AGAA A A 780~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~AOCUCI AACCCO u~~~~~~~~~~~~~~~~~UuAAocuao, uCAAUUAl ~ ~ ~ ~ ~ ~ ~ ~ AcCOARA,:Uu c~~~~~~~~~~COABFAg. 1c9aRAUatr220
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfACAUA Auu A-A u a^^^CG. uA oc R- ooUo^? l loCCAA U S AG.UAa uAAAACA CCCAUUUGU~ ~ A eA02 1100lcCocuauo^UuCG U UU CC~~~ ~~~A I^UUAC UCUAA4^yuC0 A A AA§AAAACAAGAUCA. COA AAA-9c25cIIfI11AA00~~~~~~~~~~~AAc A lUCA UU UO(ICA ACA cAAQACCA CC AeCA^u Au A~~~AUAt-U U-AUAC C AuA- U AU ACA too~~~~~~CGG2C A A%CUA ~~~~~~AC UAU ~ LAA.0 XLIUC~~ U~AAUOAt~UlAAA AAU A AUU-A UA AAU U- AG_CC UA-C U.A UU0 AC AAGUQ CThJUA A:UAUUU CU1000 A ~ QG CA AAUGaAU u~~~~~~~A0 UAA A toC%CUU-A u~~~~ac U-A CAG-IIICOCO CU AUUA UUA CU UUAA AA CAGUGAA i-UAUU U CAB AACAA CUA UU3 C ACA~~UCAA C%CoAosAGG AaA C-0UGAUUUGAA A-UAU ~~~~~~AUAU GCAaUA GAUAAUUA 1500olIICGOACCAU GFig.19bRatr221
    • Nucleic Acids ResearchSecondary Structure of mitochondral 23S Ribosomal RNA: 5halfAGCACCCAUCAAA GA A uA..h It AAAUCGAGAGAU ACU CG.,AACCCAC aA A A500-c uAAA AUAAAAAU CCAUAOPCAtU UUGAA AU A OO-t Au ~~~~AA C C UAA A~~~~~~GU A-CCc600A AC AUCAAAA A<"A,.A°Cu793Ftg.20a o00Boviner222
    • Nucleic Acids ResearchSecondary Structure of mitochondral 23S Ribosomal RNA: 3half900U A A CUU 0 AUcA u C-G G*C UA A-UU0 U 0UU AU%U_cU-8 1000U-AAC-C-GAGCA- U- 2 G- u CC-GCA CAAAAAACAU U C GA1CUUGCC~~ ~ AOUAOC I GA^CU^U GAUCilIIIIIAICAUUUGU GCCGG UGGU CCOCAUAAco-c~~ ~ACUA CUA CCUUAAACCAU A A A Ac~~IA-U U-C AUA A A CAACAC uA A U Ac c £_GCUCA 1 00AGA /Ci00G AAACC2-s-1000 C-G AAAA-UC A A AA C A-U AF 1200A-UAICA-U C U GA0-CC AAGACUAG-u -~~~~~~~~C UGA:A- A U UA LeCA: U:A~~~~~~~~~AC8 UU CU A aCU- ACG8 0AAA CUU IIc AA~~~~~A0CU80A- A CU A1U-ACA00-C U0AA-CC U C CA AGUo S. A U U-AUU UAU AAAAA A UA 03 ACAAA UCUCACuuCA~UA ACU 0 A 1300l1111 CGCAAUCCUAUUCAGA0UCUAUCU CU III*1II1 I CAUU OCUOOUACUUAU U A AUCAAO CO CA C UC AG0Gk% oCA %% 0C CUAUGUAU A0 UACC0UA U-AUUC,~A 8JG:C/~~~~~~~~~~~~~~~~~~~AU A AAUu%%At? 1400 A:Ai AG AUC CUGAUGGUGCA-U~~~~~C UACUCUACAAUAOUAACCAACA ~ ~ U GG CU UCCA/~~~~~~~~~~~~~~~~~~~~~~~~A AA 2:U Fg.20Boviner223
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfA GCCACCUG AGACACCGUA ,,,II.,, i,,,AA CGGGUGACU ACU CGAAG cuAu~~~~~~~~~~~~~~~~CG AuA~~~~~~~~~UUG C500A AACU ^ UC~~~~~~~AC UAAU GA GA A AU^-A C A-AA Cu AAC U A AAAUUUA C CAu U AAC Au U-0 A cAAA C A CA A-AAU A-A A A uAC AGA A C U 8 2CAGACAA ACu^* C-C UACa ICUAACUU GACU^CA A A^G c U A2C tGCtAAU AA CCAC CAA C ACA.CCAA A C G AG~ A A CUAAUAUAAACC--A400A AA A A AA- A AAA A C U GGACC G AAU G A A~ AAGIA A G AG-C CA -AC AUCAAUAUUC- A CCACG AGA -AAAGAcGAGA AcAAG 2A CUAGC A;AUUGAA A GCUAUG A CU~~GAGA GCUGAGAG UFiC.AAAG . C AUAA?ZCCCU AC G~AAtCCA ACGAA40 00 CAAAAAUAAA,~~UAAAU Lf I AGAAAAUu c "uc 87UA u~~~~~~~~~AucAU A 00-A~~~~~~~~~A AA.~~~~~~~UAA~ ~ ~ AA4AUU G UU GC u~~~~~~~~~~~AUUiGACC~~~~~~~~~~~~~~~CAGAAAA U 5~~~~~~~~~~~~~~~~UAG UAUcUA u~~~~~~~~~~~CAACAAACC AGGAUCAAUUAAGC CUUACCU GUA~~~~~~0AiU.UAAXeou IaevAr224
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfG3 uFig.21bXenopus laevisr225
    • Nucleic Acids ResearchSecondary Structure of mitochondinal 23S Ribosomal RNA: 3half500UUAGCAAUUAUU AAAAAUGACUUCGUAUUA A AU UAUA AAuU uA AAA uU AuUAAUA uA A UA-A A AUUA U UAUUAAUA UUU U A-U U-AA A AGAAA62AA UUAAU /-0AUUU A AAI~~JUU ~ ~ ~ ~~~~~~~U U-U A Au-UGUAGGUAu U8- U Uu U_AuU X ^A AGA40 A AUAAGtU"A(AAAAUAAAAs>UUAAA?-% A uAAA U UAAAUU A60£AAA~~~~~~~A UUAU=A30AU A UA G AU-A uUUAUAUUUC U AcA UAU-A A Acze AJU A A_A AUiAU A%e UA CAUU A £-AAUU AuC A AU A u~~~~~~~~~A A G UA A u~~~~~~~~~~~AU_YWAAAa u~~~AAAAUU:A UUAUAUUAAUUUU~~GUA2-U Auuu AAuu~~~~~~~~~~~~~~~~AU:A~ ~ ~ uAU A~~~~~~~~~~~AUpDrosophila yakubar226
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3half700 AAUAUUUI A-UG u AAUUUU A CUAA G_uu_ Au uuUU AUU-A AU AC-GA AUCU C UcC^A0AAACAUAACC ACAAGGUAGCAAUUUGU GUUGG UU UC G u ACGA ACU65cu^ U~ A ,GUAAGGUC800A8 UU AGAUUAu~~~~UAAAA U - A ^^UU UUA AAU-A UA:U X- GU uAAU A U- U A%CUU~-^UC %U-A UCAUJ650O U U-A G.U A-UA-u A:~~~~U- AAAAio0 AAc ~~~ ~~~~~U-AUUA AA AU-^ C~~~~~~~-U AAU..AUUUU AU AA U- U-GUA-U C UAUUUAA_tA-u~ ~ Gcuu^^^^uoGuyA-U~ ~ ^ CU-A A-UU-A U-A G-CA CU-A C-GA U-AAAAAU U U A :UA:UUA AAU- AGA A-UA A U A.. uG UA A UC AAA %AAAQUAU UAJUAQuU U:AUCUCCCAUA U UA A UGAA GAAUAA A -U AA A CuAA CGAGG GGAGUIUUAIICGAAUUUUU GAu3 0AU0 A0 AuAA AU GCUGAAAACAU A AG AA AGdAUAUUAAGCGA AAACAGA11 L UACGUUUUU GGU3 U ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~UGAGUICUG AU A AU-AA aUak9b-C-GA~~~~~~~~~~~A AG A AGu ~~UUGAUUUAACUCAU~~~~~~~~~~~~~GGu A~CA UU% AeA1300 7UuGu % A CC C~~~Fig22A U A %%UA -AU DrsopAl yaubr227
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfAU AAGUUAUCAU A AA UUUA 1.1 A@AA CGAAUGUAA A U UAAUU500 A UU UUA UU~~~ ~ ~ ~ ~~~~~~A UUU UU UUUG AA UA AA uU uAA UUAU U U-UU U UUU A A-UAU AU UU7AUXU UA U5Fig.23aAedes albopictus: mosquitor228
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3half~UUUA -A700Q G U G -UA AUUU uU U-AA UU--A oAC-C-G -GU U GcGUACA AAACAU UAACC GA AU GCC II AU A UUUGU GUUGG AUGA UC .A A AUGACAA A CUCA-U A U A AA GAAUAAUUG AUGUUC%...,U AAUAAA^UUA-U ~ ~ AA~U uA UUCUU-O A-G A A;%A~UUA AAAAUXWGUAA UU C A AAAAUUAU u u~~~~UU AU65G A-UAUUU A-U U AU_ U-A U uCA-U U-A GAG u u /1000~~~~~UA-A5-U U- GAA-UUUA U- A U UUA U A AU UAAG U U:AUUU UG U AU UG A-UA U U A%UUA-A-U U-AU UGAUAUAGU Y1UA.CC-AUAGA UU A AC.UA^G^^ AC AAA UUU UU Us sUUAAUU-A UUAGAA~ ~ AAUA U-AAA A -CC AAA uA A C^ GA AC1100~AAUAAUUAAAGACGA G UUA GU1 1 1 11111 II CGUAAUUuUUUUU AGA UUAAUUUCU CU II* Ii I I CA AUU GCGUUGAAAAAAUCU-Uu A % A U A A CG AA G C%G G CACU GUA C UU AA~~~~~~~AA U A~~~~~~~AA CU10A u u G GUACGa G-UA AUA G1UA0GGlifilill1AUUAU GUAGGUGUU UU GUAA p^A^U-AUUAUUCCUU GUA AUU GCGUUAAUUUGAAAUUUGAUUAU UAA GUU U~~~~~ A0oG0 UUAUGFig.23bAee aloitsUACGuitor229
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfFig.24aCrithidla fascIculbEschenchia coli,,007,,- _ ~ ~ ~ ~ ~~~~N-. _~~~~~~~~~~~~~~~~~~~~~~~~~~o... .~~~~~~~~~~~~~~~~~~1,0~~~ ~ ~~~~~ 1..* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~._ .0....~~~~~~~~~~~~~~~~~~~~~~~7 gm300,.-......-.. ~ ~ 3.-~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~2etk.netoplast ovea,~~~~~~~~~~~~~~~~~~~~~~~~~~~30 ,,0,r230----------34014"1340 1.10 .jo........-,ON30 $70... ......mo13101030lvo
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfFig.24bCrithidla fasciculata kinetoplast overEscherichia colir231
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfuu uUAAUC U AuA UUAAAUUUUU US UAUAIII U ~ ~~~~I390A AAUUUUUGAA UACUUAUUUAUUUAAAUUGAAU UAAUUUAACUACA AUGCUAAA GUUGUGAUUUUUGUUUUUAGU UAUAUUUUUAGAUAUUUAAUU AAAAACAACGUUAAAUUUUAA AUAUUUAAUAUUUGUUAAAAU AAAAAGUGACGAAUUCUAGUA AAAAAAAAUUAUUUUUAUAAA AUUUAUUUUUAAAAAUACAUA AUAUAUUGUUAAUAAAAUUAA UUAu 592uAAAuuGUUUAUGAUuuuuUK Xc UUU^UGSUUUGUUUUUAUUU^CaS.^ AAUUUUAUUUAUACAUAUUAAG USGUUUASSAUUUSAUAUSUuU U SAUUAUA^ACSAUUGUC _UCUUGU GU 1 77U U-200U UA AUAU AUGUUG~AU U U U UUUsAGUUUUFig.25aCrithidia fasciculatar232
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3halfuuCuAUUUAAUUAA A AuCuuu uA CUUU A A700U- U UU -A GU AG UAA-UUA AUU AU-A AUA UuA A AUGCUU A UUCUu AUAAGUAGCU AUUUGC AAGAC UUUAAGUAA UA A G U600 A -UU ~C UUUAA ACA UUGU AA ACUUA A AGU UuAUUAU AA- UUAC- UAC_G UU AA-U 900ooA UA UGGG C AGG_c U-AG U-A A_AA-U -A U-AA A UU:~A .AA- U ACU.GAc GUU G A,A A - Uu u AA U -A AA U-A AUAAAUu~C-GU U A/-800 U U UAAGUUAA C GCU U -AA AA C GA UU A _CAAUUU AA U-AAA% AA C GUU A G AA A cAAAAUUAAAUA G A111111111 ~~GCAUUAAUGAUUAAUUUAUA Au I I AU Au U UGUAAAUCU U GA G U1100 A U UU UU UU AGAU% UAUG G-CA UA UUGUA G CA U A-UG G-CuUUA AG UGUU UA %U-AA uC-G9UG-CUAA3 AAU AAA A UA AA-C-UC uU UGFig.25bCrithidia fasciculatar233
    • Nucleic Acids ResearchSecondary Structure of mitochondral 23S Ribosomal RNA: 5halfAUU AAUCUGUUU AUAhUA if llio touAAAUUUAACAA AAU AUA UAuUuA AAAuuauuuuuuuuuUAuuuA -UuAUAUA0GU° uu-u-U-a-Aouu~~~~391-UAAUCUAAGUUAAUUUGAAUAUUAAAAGUACAAGUAUAAUUUGUAAUUCUAAAGUAUUUUAAUGGUAUAUUUUUAOUAGOUAAAUGAAAAGUAUAAAUGGAUAUAACUUAAUAUUUAAUAUUUGUUUAAU0AAAAGUAUUUUAUUAUUAUAUUGUAUAGUAUUAUUAUAGUGUAUAGUUUUUUAAAAAUAUAAAAAUAUUGUUAAUAAAAUUAUCO-16016AUUUUACCAAUUAAGAAGAAUAUUAUAAUAAUGGGUGUCUUAUAUUUUAAAUAAAUAUUUAAAUU CoGUUAGUAAAUUUAUUAUUUGUAUUAUUUAUAUAAUAGGUGUAUUAUAUUUAAAUUUUAAAUUUGUUGUUUUAUAUUUAGAUACAUAUUUAUAGAUUA AUA UAUUUAAAUAAFig.26aTrypanosome txuceir234
    • Nucleic Acids ResearchSecondary Structure of mitochondral 23S Ribosomal RNA: 3half1000LAu lap,u A %.A AA usuu UAAA %A3,Fig.26bTrypanosome bruceir235
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 5halfu ^Auuuu uU cA^UA^AU UAAAUUAUUU UA AICAAA UAA L"A;G AAU AUACuA 396UA UAUAUAUAUAUAUUAAAUUGA AAUAUUAAAAAUACAAAUUUA AAUUUGUUAUUAAUACUAUUA CUUUUAAAAAUGCAUAGAGAU UAUAAUAUCACAUAUAAUUUU AUUAUUUUAAUAUUUAAUAUC UUGUUUAUACAAAAGUAACUA UUAUUGAAUAAAAAGAAUUAA UUUUUAUUAAUUAUUUUUUAU AAAAUAUAAAAAUAUUGUUAU AUAAAAUUAUCAACA 6AUuuAuuAAuuu^^^ ~~~AU^AU^UUUGGUUUUAUAUUC s>U UAAAAAUAUUAUAUAUUUUAU ~~~~~~~~~~GUUUU A AAUUU GU UGUU UUAUG ~~~~~~UAUUUAGUUUAAUAUUUAUAU UAUUAGUAAAUAAUAUAGAUAUCUUG GU UUAGAAAUAU UAUA%%UAAUG~~~~~UUUFig.27aLeishmania tarentolaer236
    • Nucleic Acids ResearchSecondary Structure of mitochondrial 23S Ribosomal RNA: 3half700AuUCUACAUA^ It.^ UU.AU-UU GAAUUaUUU I}UAG UAAA-U A AA- UA UAU AAAA^UGCG UUCUU AUUOUAGCU AAUAUG AAGAUUUAAGA A AUAAAU-A C U aGAU u AU UA C AAACG Uucu UAUUAu uU-A UAUA _u u AUA-UAAG AG0-AGCPAA-UG_U-AAAU-Ag U4-800AA-U A A AU ^ 900 AXAAA C_-A U A A A,~~~~~A,^^ cu^AAAAAU= uAA A U U AAAGA cA OA AAAAAAUAAAUA A u AA UUU AAUUA U iA,AUuAUUAAAu0 UG000A U UU U%~~uUA A GcA AAAA t AAAA0 A~UAUA~ ~ ~~~~~GAU AA LIU .....ciU /U A 0-CAAA 0UUAA UAA u u~~~Au A UU GUAA-Cu UG ~ C-UtC -AA UA% G A-UA A ~ CAUUA%%% UCUFig.27bLeishmania tarentolaer237
    • Nucleic Acids ResearchSecondary Structure of archaebactenal 23S Ribosomal RNA: 5halfFig.28aHlococcue moffhua overEscherdchia coir238
    • Nucleic Acids ResearchSecondary Structure of archaebacteral 23S Ribosomal RNA: 3halfFig.28bHalococcus morrhuae overEscherichia cofir2391720-
    • Nucleic Acids ResearchSecondary Structure of archaebacterial 23S Ribosomal RNA: 5halfFig.29aHalococcus morrhuaer240cA
    • Nucleic Acids ResearchSecondary Structure of archaebacterial 23S Ribosomal RNA: 3half2000GGAC GAG8 G A-oaA A0G:8 ACUCGUAG,A 11111 A3 C CUUGAGCAaAAA-9AX Ac-A6:8c cu2900s,ccC °o Acc u GIG aAUU CAuG-cA.G4C-GAC-GFig.29bHalococcus morrhuaer241
    • Nucleic Acids ResearchSecondary Structure of archaebactenal 23S Ribosomal RNA: 5halfcuGA A44,1AC GCUACCCU AA 160A0A off. Ill *g,t AAUGGCAGoAAGCGAACAACOU%-l U COACuAC G ~,UACUUA. - G A.Fig.30aHalobactenum halobiumr242
    • Nucleic Acids ResearchSecondary Structure of archaebactenal 23S Ribosomal RNA: 3half3Fig.30bHalobacterium halobiumr243aA
    • Nucleic Acids ResearchSecondary Structure of archaebacterial 23S Ribosomal RNA: 5half-i200Fig.31aMethanococcus vannielliir244
    • Nucleic Acids ResearchSecondary Structure of archaebacterial 23S Ribosomal RNA: 3halfuCcU-AGC-C8ac8CcACCUGC-GGAA A A U-AG G A U-A1890-UA U-AC -¢ U G C-GCGU ~C A C-G0UGAM ~~~~~~~~~~~~~AAA-UGA U UG-C G G- CA A 2200-UA C-GA ACUA G~:A U G UA A UGUGU A:GU UAAA A A G AUA AG-C UAA C GGUGG UC a C A 11111 CUc-8Gi:UGUC U CCACC CAAA a8 2G, 2000 G C A UU U U A CCGI UG.CU CAGUGU- ACAAACA ACGCC UUA AGCAU IH AcAUUUGU UGCGG U AU-AAGUU AGGA-CaA CO, C AG %ACCU C AU AUG- A CGAU a:8 c. CC- UCU AA18008:aCGCAGUGAUGACACCGAGGA%GU UCG ACCAGa- a,0 C C CCCUU G-CIG* GGGUIIG* III U A-UGUUAAGCCUAACGGUUGA GGA GGAUUCAAUGCCUC U CCAGG~~~~~~~~~~A.U~~~ ~ ~ ~ ~ ~ ~ ~ ~ A A GUCAAAAG G_u-:AC UGAGGGGU A &-AAGA-C ~~~~~~~~GUG G AC -CAAAC G-C-40G_C0A GUG A- CC CUUA A G A_A G7~~~~~~230GGUAG-C AU-AG L1 G-CZ S: 20AGCGGUGGAA:aACA GC A GCCA UA :GC A A1750 AGAGA UCG C C CUUuA 8 G u uG~~AG A C%A u `2300GUCCAGU%GAGGGZ8 U:AA 8:8C-G~~~~~CAG-C U AAUAUU U QCG GCC CU AAc A-~~UA- GU CAAAAc~~~~~U G UUU U00aG:A G GGCA GGCCC%G~U G CUG~~~GAGAA G C A,U ~AG, A U GACGAU AAUU-A~ ~ ~ ~ ~ GCGG AA illi A C~~~~~ U GC G-C UUUGGGCAGA UUCAGUGGAC AAUC GGGUCUGCGA ,~~~~~ .~~~~. ..GAA UU GUC C G GI%LCGU IGU1A111C G~~~~~GAuGG C CG U1A~~~~~~~ A~~~~ 2600 AG A G 2805C~GG cCUUG~~~~~~~~~~~~~~~~~C GG~~~~~~~~~~~~~C,%AC u 29 1CA GFig.31bMethanococcus vannielliir245
    • Nucleic Acids ResearchSecondary Structure of archaebacterial 23S Ribosomal RNA: 5halfFig.32aMethanobacterium thermoautotophicumA:260 -314r246A
    • Nucleic Acids ResearchSecondary Structure of archaebactenal 23S Ribosomal RNA: 3half3 uccc uuuuuu3u.,UU .UC2875Fig.32bMethanobacterium thermoautotrophicumr247
    • Nucleic Acids ResearchSecondary Structure of archaebacterial 23S Ribosomal RNA: 5half5Fig.33aDesulfurococcus mobilisA: 267-336r248
    • Nucleic Acids ResearchSecondary Structure of archaebactefial 23S Ribosomal RNA: 3halfCCAU-A-c~~~~~~~~~U°c c8~ uCoA a C-.A A A Aa A A A -CFig.33bDesulfurococcus mobilisr249
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5halfFig.34aSaccwhomyces cerevislse overEscherichia colir250
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3half-70B . .mFig.34bSaccharomyces cerevlslae overEscherichia colir251-no6
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5half5.8S35ACouAouuvooCCUCoCAA"ovuGcacAAucoACCOAUCCUO^UOUCUUCC: 715-767GAG UOGUUGA AA4-CC3CCB: 419- 636Fig.35oSaccharomyces cerevisiaer252"AGOOCAUUU"UCAGACAUGGUGUUUUGUGCCCUCUGCUCCUUGU"U:AG"GAAU"COCAU UCAC:CQ" CA*CAUCAGUUUU"UGU:CAUAAUC A:A AAUGUAGCUU CUCOQUAAGUAU AUAGCC UG:QAA ACUGCC OCUG"ACUGAGGACUGC"CGUAASUCAAG"UGCU"CA
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3half"GIUCGGGUAGUGAGGGCCUUGGUC AAOGCGCCGOOCOUOCUUGUGGAC G AUGCUUGGUGGOGCUUGCUCUGCUAG A - UGCGGACUACUUGCGUGCCUU UUGU G-AGACGGCCUUGGUAOGUCUCU U -UAGACCGUCGOCUUGCUACAAUUA ACAAUCAAC A CG: 1945 - 2100 A cAAA A AA8 U8:o u aG UG AU~0 U AG-CAl AG 8-A. ACUA U GUA A GAAU2200-c u GCU--AA G8U AO Aas^^U-A A-cUoo^COGc^g c 30 u ^o-cs_AGUGH c..|||| c ,AU ^a P ,21Eio-&- o 81:-,f a 1I AUAAAA°^U CCA2490cUAA AGAAAACAAUUUC CUUGCOAG IIIA U U CAAU UAUAGAA~~~~~~~~UC°UUAG AUCC-OA o-AAAGCAUUAU GUAA UUCAUUUUCCA-U AG-CA U ACGUUCUAGC AGAA U8CUU.COA CCCu U U C A^A-U 8-8A 00 ~~~~~AC C CAAUUCAAGGUC Caoocuto^U-A A G G CCAUUCGGGG Aucuuucov A UU-A A-1A8- CUGAUCOGG AA8GAGGCA88A AUUGA :0cA~U 2300 UuA CA:U CU-AUCAAUGC UAG AAAUA C UACUGAA : Uu UAcAAG42AUA -o-H~~~~~~~~~~ACAAUCUA~~ ~ ~ ~~~U~J1905 A:260 AAC U V~~~~~~~~~ AUA va~~~U GGGu.cG G UAU U UUGa: Aa ic8lAUGCG~ ~ ~ ~ ~ ~ ~ ~ ~ G~~~~cc~,: u AccCA GUAGA 4 c20AA AU-AA 87AG0CAA~~~~~~~~O GAC 2U G, A=XCOAAAc240 GA UA %AA"C :AA Cc80UUCUUUGCUCCACACAAUAUAGAUG GC~~UA C- GA u UUAGUGCGGAUACGAAUAAGGCGUCCUUGGGGC ~~~~~~~AGUAGUC 0CCCAUUGUCGCUGAACCAUAGCAGGCUAGCA~ ~ ~ ~~GAUCGC%GAAUlU CAJUUCUACACGGUGCACUUGGCGGAAAGGCCUU U CAGGGUGCUUGCUGGCGAAUUGCAAUG A0UCAUUUUGCGUGG A UK: 3148-3285 UA.8G?!.aGAFig.35bSaccharomyces cerevisiaer253
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5halfD:2067 -- 2246AGUCGAGAGUGGACGGGAGCGGCGGGGGCGGCGGCGCGCGCGCGCGUGUGGUGUGCGUCGGAGGGCGGCGGCGGCCGCGGCCGGCGGGGGUGUGGGGUCCUUCC C CCGC CCC CCC CCC CA CGCCUCCUCCCCUCCUCCCGCCCACGCCCCGCUCCCCGCCCCCGGAGCCCCGCGGAGCUAC5.8SAX AGGCCGGCGCGCUCGCCGGC GCC COAGOOUGGOAUCCCOCAGGCC dUCCCCAGUCCOUCOCCGOGC elsuACCCOCCGOCCUUCOGCC: 1379- 1465AOGUAAACGGOUGGGGUCCGCGCAGUCCGCCCOGAGOAUUCAACCCGGCGGCGGGuCCGGCCOUGUCGGCGGCCCGGCGOAUCUUUCCCOCCCCCCGUUCCUCCCGACCCCUCCACCCGCCCUCCCUUCCCCCGCCGCCCCUCCUCCUCCUCCCCGGAOOGOGGCGGGCUCCGGCGGGUGCGGGGGUGGGCGGGCGGGGCCGGGGGUGGGGUCOOCGGGGGACCGuCCCCCOGACCGGCGACCGGCCGCCGCCOGGOCAC UUUCCAGOCOGUGCGCCGOAGCCGGCUCCOGACGCGCUGGGAAGGC CCGOCGGGOAA^GGUGGC UCGGGGGGC CCCGUCCGOUC CGU CCGUCC UCCUCCUCCCCCOUCUCCOCCCCCCGGCCCCGCOUCCUCCCUCGGGAGGGCGCGC GGGUCGGGGCGGCGGC GGCGGC GGC GGUGGCGGCGGCGGCGGGGGCGGCGGG:CCGAAACCCCCCCCGAGUGUUACAGCCCCCCCGGCAGCAGCACUCGCCG AUCC GGCGC CoAGoGAGCGAGACCCGUCGCCGCGCUCUCCCCCCUCCCGGCGC CCCCCCGCCGGGAAUCCCCGCGAGGGGGGuCuCCCCCGGCGC GGC GCC GC CGUCUCC UCCUCGGGGCGCCOCGCCCACC CC UCCC ACGGCGCGACCGCUCUCCCACCCCUCCUCCCCGCGCCCCCGCCCCGGCGACGGGGGGGGGUGCCGCGCGCGGGUCGGGGGGCGGGGCGGACUGUCCCCAGUGCGCCCCGGGC GGGUCGCGC CGU CGGGCC CGGCGGGAGGU UCU C UCGGGGC CA^CGCGCGCG UCCCCCGAAGAGGGGGACGGCCGAGCGAGCGCACGGGGUCGGCGGCGACGUCGGCUACCCACCCGACCr2545.8SHomo sapiens B: 423-1295Fig.36a
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3halfG:2874- 3575G00CUG0OUCGGUCOGOCUOG0GCGCOAAOCOOOOCUOGG0CCOCOCCOCGOCU0GACOAOGCOCOCOCCCCCCCCACOCCCOOGGCACCCCCCUCGC6OCCCUCCCCCOCCCCACCCOCOCOCOCCOCUCOCUCCCUCCCCACCCCC0 AACCCUCUCUCUCUCUCUCUCCCCCOC GUCCCCOUCCUCCCCCCUCCCCOOGO A-uccccauccucceccuccccGoooA U37_OA0COCCOCOUOCOOOCOCOGCGOG CJ 3700O0GAOAAGOOUCOGOOCOOCAGGOO U ACCGCOCGOCGOCCOCCOGGOCOGCC G -AGCOGG0OCAOGUCCCCGCOGOGGG A UGGCCCC6G6ACCC006606CCGOC A GGGC606C6GGACUCUGGACOCOAGC CGG A ACGOOCCCUUCCCOUOGAUCOCCCCA C C AOCUOCOGCGOOCGUCOCOOCCOCCC GeCCOO0AGCCCGOCOOCOGCGCGGC U GOC0CCCCCCACCCCCACCCCACGUC G _U GACUCOOUCOCOCOCOCOUCCCCUOGGG AUGCOAOGCOOUCOGGCGGCGGCGOU G U cCOOCGGOCOOCGOOGGCOGOGCOGUU A u _COUCCCCCCOCCCUACCCCCCCGGC A A0 8G ACUACCCOUCCOCCCCCCOUUCCCCCCUC GUA ACUCCUCOOCOCGCGOCGCOCGCGGC I_U-AA sGUGGCAGGCGOCOGAGOGGCCGCGGGC C_6 AG-C GCGOUCCCCCCCOCCOOOUCCGCCCC U-A c GCOOOOCCOCOOUUCCGCGCOCGCCU A-U C-G G.CCGCCUCOOCCOOCOCCUAGCAOCCG 8 7 IUG-CGAC AuGUAGU AAAUCA AUUUC UUAAGG ^^ GU CcIs Au *U) A0UUU A A C GUAAA-UA-A U-A-300rUACC-CA4,AUU-A 3600 A U%_. CUC A A AUAGG-AUUAUCGUCC AU-dU^UACU^ G_ AEr.AA UAGOC uGA-28501AGCA-^:AU39018OG-CA^U UA ACCAAQUU=j,CGAAA6C%Cc°°^UAGAA GG^ACOOCAOCOCCOCGOAGCCUCO6UU OClii. III"OCCUCO"AUAGCCOGUCCCCC6CC A0UAGUCACCAUUUOUCCCCOCCOOCGOOCCOCCCCCC U UCCUCCACOCOCCCCOCCGCOOOAGO UOCOCOUOCCCCOCCOCOCOCCOOGA GCCOGGUCCGUOCGG"GUGCCCUU ACOUCCU666AAACGOOGCOCOOCCO U.GAAAGOCGCCOCCCCCUCOCCCOU AGGs,CACGCACCOCACGUUCSUGGGAAC 4505S G~ ,cCA AUCUOG* uGK:4689-4917 UUG%00Uo6ACGGA- IC-GUCAC G,C-GCA SUcG CCC0AGCGGGUUGGCGCCAAG C0 ACC G CGU AU C UGG CG lit Gu UCACC GG UC A UA UACAA 2 AAG8A-CU H:4048-4128G G CC GGU GAGGC88A-X-U GGGGGGGC GAC-GC GCCCAGAGGUA-U CUCUCGCUUC AGAG-~U UGGCGCCAAG C AG-YU CGCCCGCCCG _-CA U GCCGGOCGCG G-CA- ACCCOCUCCO A-Y-. GCG a-c,j: GC Cf -5-AA GU^UGYU A^CG^A C-°A UA UcuOCUUVUGGCGOCCAGCGUI II CUA%UUUUCOCUGCGCG UAC4400Fig.36bHomo sapiensr255
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5halfD: 1837-2025CACUCOOAACOOAACOGOACGOAO^COOCCOCOOOUOCOCOUCUCUCOOOOUCOOOOOUOCOUOOGOOOOGCCCOucccccGCCUCCCCUCCGCaCOCCOOU UCOCC CCCaOCOOCUCOOOC CCCGCGOAGCCUACCCAOOCCCCOCCCOOOOOCCCO^AOUOOOUCCCO"OOCCUCUCCAOUCCOCCOAOOOCOCACCACCOOCCCOUCUCOCCCOCCOCOCC: 1211-1297QUAAA CoGoUGG"UCCGCGCAGUCCoCCCGo GAUUCAACOCGGCGGCGCGCGUCCGGCCOUGCCO@UGOUCCCGGCGGAUCUUUCCCGCUCCCCGUUCCUCCCGACCCCUCCACCCGCCGUCGUUCCCCUCUUCCUCOCCOCGCUCC"COCUCCGOCGOCBGOG"GG"G"U"UGGUGGUGOGCGCGCGCGGCG.GGCCGGGGGUGGGUCGG,CGGGGGCCOCCCCCGGCCGOC6ACCGGCCGCCGCCGGCGCACUUCCACCGUGCGUGUCGCCGCGACCOGCUCCGGGACoGCCGGGAAGoCCCG0UGGGGAAGGUGGCUC8G"GG4GCG4CC OUCUCAGGGCGCGCCAACCACCUCACCCCAGU GUCACA GCCCUCCGGCACOCUUU CCCCCA UCCCGGGGCCGAGGAAGCCA GAUGUACCCUCAC COCC CCUUccC AuccGCccouccoccC uccCocCGGCCUGCUUCGO*CCCCGCCCC CCUCCCOCCUCCACCOUCUCCCCACCCCCCUCC"UCCCUCU CUCGCCCCCC GUCCCCCC CGCGGACUUCCCCAGUCCGCCCCOGOCCUC CUCCCUCCCCUCOCGCOCCCCCUGGC CCCCCGCU CC UC UCCUCACUCOUCGCOCCGUCOOOUCCCOOOOOOACCOUCOOUCACOCOUCUCCCOACOAAGCCOACoAC""oUCooCoCOAUGUCoCUACCCACCCOACCB: 431- 1127MouseFig.37ar256
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3halfG: 2648-3260GG:CUOGGUCGGUCGGGCUGOGGCGCGOAGCOGOOCUOGGCGCGCGCCGCGGCUGGACOAGOCOCCOCCOCCCUCUCCCACOUCCOOGGAGACCCCCCOUCCUUUCCGCCCGGGCCCGCCCUCCC GUCaCUCUUCCCCOCOGOOCCCCOUCOUC A 0oGCCCCOCOUCOUCOCCACCUCUCUUC G A C-OCCCCCUCCUUCUUCCCOUCOGCOOO A-U CUCOGGUCOGGGGUCGGCGCGCGGCGc A- C UGGOCUCCGGGCOOCOGGGUCCAACC U- CCCoCoGGGGUUCCoGAGCGGAGoA .AACCAGCOGUCCCCOUGGGCOGOO AAGGCCCGGACACUCGGOGGGCCGGCG A 0GCGGCOOCOACUCUOGACGCGAGCC CG AGOOCCCUUCCCOUGGAUCOCCUCAO CC tCCcuocaocooocoucocooccocucc c_ c ACOGGOGAGCCCOOCGGuGCCGCGC§-o UaGGGUCCCCUCCCCOCOGGOCCUCOC G OUUCCACCCCCCCAUCGCCUCUCCGA3G9AUGUCCCGCGCGUGUG GCGGAAC A U t Cs:GG,CCOCOUCOOUOUUCCCCCOCCGGOU A AG 8 ACUA CccGccccCCoooccocGUuuuccG 0GUo A U GAAUAG Gccocoococccccoccucooccooco -c U_A u G A uAUG o °c 90CCUAGCAoCCoAC c-G o-cC. u A oUGoC-39u :G~~~~~~UUCACC G3300 a7 8 8 y GOu A AUAAAeAau ~~~~~~~~ACAIAAAAAA *UGUU eGU AACA AUUUC UAA GUAUC H:372EU lUllo *l C CCGGUGAGG0C(.) AAUUUGU AGUAGU CUCC AA U GGGGGCGA) A0- CA A GU-iA C F GCCCCGAGGGA- AU Au GCUCUCGCUU AGAA-U C- C G CUGGCGCCAA CAU--A 9ACOCGAU 3600-A-U GCGUCCGUCC A A8c U:ocG.uocooocouco-cuCu°occo coocuo *o _ u ° =C-U-A A-U Gu A cGCGCGUGCG GCCA A AUAGCGCCc~~~~~A =°^ cAU A= ea u 4000CGCUGCGGACG UA GC-AC ACCCGCUCCG 0:A G7UGGCAG3:8 GCU 1GaVsC150lfA GGAUU Aa.1...... ~~CaG ACAG.o-H A~A GUAGGC~~~CGOCUGA CU U-A2600i-~ A A :2A C A AACA~U3500 u7 UG0 .A-U~~~~~~~~~~~~~~~~~~~~~~~~ ~~~G-UUCaAUAUC^OCtXOOOAUO CAA GG*ICCUCOUCA GA-UA-U UUCCoucococcoctoocoococ,ooooucu 42 a5u cCA A VUC A3:8 "U=AAACGA%GAAA GO cAlGuCCCCCGCGGooucGGoCGcGGGUCU uu aooooccocccucucococoucoco (N u2° o AUGo7GUCCGGUGCGSASAGCCOUUCGUCu G A U~~~~~~~~~~~a7ula A AUG@GAAACGGGUGCGCCGGAAAG ~ GCOAA AUA cUGGGGccGcCCuCucGGu^cACCU U AGG Gcc ^ coGA.CGCACGUUCGU0U0GAACCuG A.uouAU55,K: 4379- 460439UGUU-AAUCGC_8 AUUCoU aUUCGUCC AlA CC-Gc-o4700-t 8A- ucUCAs-U ca,IAAGU.AC_uu:U-A. aa.Ac_o-¢?"-c; FigM37bMouser257
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5halfD: 1986-21AoUCOGAACOGaACovAGCaoccocoGOCOCOCOACCCCOOOOOCCOOGCOOCouCOOCuuceoccooccoccocccouCACoeccavo"OCUeeOescMCOacoucoocOccocGoGAGCCUA c26005.8S 3AooCCeOeUeOCCoovaCCCeC*A"UvoUCeCC"QCCUCUCCAoUCCOCConAGoCOCACCACCOOCCCOuUCUocCCoccoCOCC: 1297- 1386QUAAACoooU""oUCCOCOCAGUCCOCCCOolAdUUCAACCCOOCOOCecococcooccooccoouoouccCooCooUCUUcccocuccccouuccueConBeeUCACCCCuenBeo eueueueeOeeeueeeeoeoueeeoeeoueooeeueeOeoeueeMeteueeGoooououceo eweocuceeooooeoo e eoo o Uooou oooooeoeoooeoCaoo UOOOOuco C"oO"ACC CCCCCG"CO C"CO^ CCC OcCcCcOOCOCACUUCcCAc-uo "GGCCAC4CoocCbcrCuc-CoCuGooAGooCCCoocGo ^"UC"uCOCG"0 u"*COUCCCGUtOOCOCCOGAC^CACCC eeCCC uU4UACACCOCeCeooCA^OCAuCoCUoCCAUCCC"oZeeC"o^AoeUAeCe uC eeCe"UCUCCCCCCroCCUCUeCCcuccc CeCCUCCCCOU4§ uucoAAooneoUCOC"oooccO "OCCCCCCUCCCAC"C C"^CCOCUCUCCCACCCCCCOUCOCCUCCOuCouCCCUCuCeoo_uCCeoo"cccoOocOCoocuOCUGCCCcAOUOCGCCCCOGCOUCOUC CoCCOucOO CCC OOOO CcouCOuCACaCOCUCUCCCUCCCCUUCUCooo uvavoAGc"Aocc "oCocACoovouc oc ooUGUCOOCUACCCACCCaACCB: 430- 1213RatFig.38ar258
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3halfG: 2736-3330ooCoGOGQUCoGUCoooCUOOOGCOCOAAOCOOOGCUOOOGCOCQcCCOCOOCUGOACOAOOCOCCOCCOCCCCCCUCCCACOUCCOOG"AOAcccCcuccuuucccOCcoooccCCCUCCCOUCUCCCCOCOUCGC OAAAccccoccoucccccocoucouco A Accousouccccuccucccucccu A- uc-UCUUCCCCOGUCCOCOOGOOGOAC a- aGoauc^^cciucocoacvcc N-A;ooOCoooUOcccoGocOcOcACOUCOAOCOCOOCCCCOOOGCCOA AGUCCOUAACCCGCCGOCCCCC 3395aoUaOOOOOOOOCCCOGACACCC CGO A AaGOOOOGOGCa COGOOCOAOA C G%OCOOOCOUCOCOOCCOCUCCCOO O -0°ACUCUGGACOCGAOCCOOOCCCUOOAOCCCOOCOOAUCOCCCOGCO G 0 AU CGOA~~~~~~~aaooouuuuccuccoaccucouccu ° uU uo Cc gcC(cccccuucccccuccocaooouc A u ,_CCUCoUoCUCCCoCouucauu A A c- cu 3700-Accuccococoocoouuccccc _ 7oUAA^^o^^uOCuCOGUCCCCCOCAOA GAUA 0AGCCQuCoCCCoCCCOccCCCG U-0_ u- Au uouuuccc Cooccocccoccuco _- .o-c GU,,u AoUoa c"CGCOCOCUACOCAOCCOAC UIA ~ ~lfill aAccoccaccuocroccoacGU G o~c°o8/ U UCACC aA uG u3500 GA UAAUAAAACAA AUUUC 00UA 0Al38oe3A87G ) " III cG C UAOliii¢^ uu¢ A AOOuOAA CCOH:GU0AO38CAA( UOU ACUAUCUUCC A U OG°OOG OCGAA0 C A COGU COC OCCCCOAGOOOA-U O-A8. A. AG CUCUCOCUU AGAA-US.3A C||.@C AAUc^^uO¢¢u^°O¢¢CCAcU ACOCOUCCOC A AC"A 2 A70 A-C0U | CCCOCc -CCU-A A AU A A= CA-CCAC a A=ACUAC:°CUCC:Ga:8GAA7GUGQU0CGGACCAOG u uGUA OGAUUCCO aA-Uuu 0C C^ ^ U ^oAUUMC"COAACI 0 CAU 0U U=A GAGGCAU 78 GOc&4ooL 4000uvococcoou^coocucccc A 0uou,4c¶uu .I II .I1 0oUGo cUG1coooouccoouocvoooccouuc~~ ~ ~ ~ ~~~~~~1-o uLiuguAUGooooccccccuccAUUUoAuAucAAAA^CAc"^¢^ a,10G,A,AU36000AC u8QUU=A aUUIF* AU cu 87AAA UACA A00AaAAU0GCCCCOOAUACCOGCUCCCCOU AOUAOUCAJCCAUA II CCOOGUCCOGUGCGAGAGCCAUGC 0~~~~~~~A GAA-OUCCCOOGAAACGGGU@CGGCC0O ~ ~ 41AUA^GAA UGUOCGCAACOUAAOCCCCOCAACCUCUCCCCCOUC U GAU CAU 111 oACGCouUCCcAucoUUCOUGOAA A%.C UAGUUOCOCAUC"CUG 0CG¶"oJAC0 000 0Fig.38bRatr259
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5half22953OOOCCOOGCOCaCCCGCeUGO0OU GGAUCCCOCCOCCCCCuCCCUCCOCCCCCCCGOOOOCOOOOGaOOOOCOCCOGCGOOCNCACC ACCOOCCCOUCUCGCCCOCCCCGUC: 1038-1148r260B: 427-953Xenopus laevisFig.39aGUAAACGOGUG(IGOCCOUaCGOUCCGCCCaGAaaAUUCAACCCOOCOGOUCAGCOCCOCCOGOACCO(IOCCACUCGGCGGACCCCCCCOCCOOCCCCCUCCCCUCOCCOGaAGaaCGOUCGCGCGOGa"GACOCOOCCCOGOCOMCCCOecocc"N"N"GNUUUCCUCCGCGGCGGUacaeacaccoacuccoaaccoCOUGGOAAGeCCCAGGGGUUCAGGGCIAA"UGGCCOOCCOCCCCCOCOCOCGGCUACAOCCCCCCCCCANOCAOCAGCACUCOCCOUCOCCCOGOOCCOAaGGAGACaCC"CCUCCOC"UCCUCCUCCCCGGAGCaCOUCCCOCCOCUCCCCCCCOGG"GGCGGCGCGC"GGCGGGGAAG"GGAAGGGGCCCCCCaCUCCC"COCOOCUOUCAACC"GGC"ACUGCCCCCAGUGCGCCCCOUCCOCOCCOCaCCOCCOAGOCOGGAGGGCCOCCOGGAOCCOCCRAaaGUCCarn.r. ....... e.- e. .e- .. re.,
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3halfOGGGC UCOOUCOGOCUOOOOCG e ACGAAOCOCOOCUOOOCCGCOCCOCO G AGCUOOACOAAOOCOCCCCCOUOOCO A - UCUCUUUCCCUCCUCCCOCCCCCCUC A-UCUCUCUCCOOCCCCCCCUCOCOOOOU-OCCOCOGOOOCOOOOOOOCOCGCOO G* AGOCCOOAO^CGCCCOOCOOCOOCOA A UCUCUOOACOCOCOCCOGOCCCUUCC A GUGUOOAUCOCCCCAOCUOCOOCGCG AGO A ACOCCUCUCCCCCoCOCCOUCCCCCu a CCCUOCOCCUCCCCCCOUCAOOGAOC C AGOOOCOCGO OC GCGOOGOCOOCCGG _ U G-2900GGCOOOCCCOOCCUCOOCCOOCOCC Au OUAGCAGCUOAC o AUG: 2432-2767 A U 7CAAG ^G-C -AcuAAAA AUA AAUA AACAAUUUC U-O( ) 2ao^-i ouQCUCCOGU^^OO^UUA G uA- AAACAA AUUCA A -AAGUAA-U ... 3 - %ACoOCA IIIMc^^uocculncuo^AAUUUGU GUAe G UCCA2 280 G-C A A~~~% CCA 8 _ A2400 ~ ~ 0-AGU UGOUAU0^^8 ^2400 19~~~~~~0AC~~~~~~3050AUAucAdACCOCAOCOCCOCOOAOCCUCOOUC * *11OlOOCCUCOOAUUAOCCOOCOCCCCCC AOUAOUCCCOOOOOGCOCCOOCOOGCAOAOCCUOCUCOCCUCOOOACC4OOOCOCOOACOAAO4OOGOCCOCC VCUCUCCCOCCo^OccccouooG o-3700K: 3856-4009 uC AA Co -UUCOUGAAAcUUAOUCCAoCA UC~A -U CA GAAOlU80 oUuuU3~~~~G Jc~~~es~~u-^~ ~ ~ ~ ~CC-QUccA~ ~fGuC,3150CGA8:8AFig.39bXenopus laevisr261
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5half5.8S5,CGAGCOGGGAGGCCCUCACGCCGCACCGCUGGCCGACCCUGAUCUUCUGC: 721-768C0B: 419-640Fig.40aOriza sativa: RICEr262GGAAGCGGAuGGGGGCCGGCGAUGCCCCGGCCGUAUGCGGAACGGCUUCGGCUGGUCCGUCGAUCGGCUCGGGGCGUGGACUGUUGUCGGCCGCGCCGGCGGCCAAAGCCCOGG,GGCuCCGCGCCCCCGGCAGCCGUCGUCGGACGCAGCCGGUCACCGCGCGCCUCUGGCCGGCCCCUCGGGGCGuCGCGCCGCAACGG".. I -I
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3halfOGGCUGGUCUCUGGUGUCCGUCCCC A AGAACCCGUCUUCUGCCUGCGUACUG U ACuCGAUCUGCUCuCCCoUCGAAUGC A - UOGOCCGCCGUCGOCCOGCCCGOGOA A:COOCCOUGAACGCGCCCCUCGGOGG U-ACCUUCCCCGUGCGUCOAACAQCCUA AAC ~~~~~~~~~~~~~~~ACG: 1940-2091 2CG2 A cAA AUAUC C AUU t-a CuU-A G-CAC UG AUGC CGC.UAG UCC-GAAACA C UAG-C U-AAU CU-A AG-CU-GA -g GCSP,C-U:A210 7 U- U^G CUAAACAAAUUU U U A rCC^~AAA 8GA-UGAuACGUCACAG UUAGG U AUCA UCCU UCACU AA UCA- C AAA:819 :SA2300o_ ACcGCA<,C-UAa-Aa7GGAA u UACCC-AAAQ- UGC G CGOCU,3A~~oo-UCA U-CA=UUUCUCCOACOCCCOCCCCOACCCACGUUAGOOCOCACACCCCCAAOOCCCUUGCCACCGUCCAAOCCCUUCCUUCCoACGCGCCGCGGCCooCCoCCUUCGAACUCCCUUCCCAACGGCUGCK: 3142-3267A A CU AGUG¢ AG I lilt AUCACCGAG AAU- CUH:2505-2580G -U UCCOUGAGUCU-AU-AC GGAAGCGGGGC-UC CCUAGCCCCCA-U UCCUUUUGGC AGAGU U UCUAAUOCCC C AU-A AA- U UAUCCCUCUA-U GUCCGAUCCU G-CA-U UOCOGA A-U~XJAU U-C8- Au^U UGU-AC AUUU GCA U-AACAAUIAA -A 2800A-:IAAG00 ~~~Aa AC A C° -U UUuQAAUCAQF%UUAAA CAA..II lo If OCUUGUBGCAOC UCuAUAGUC CCCAUU *11 I II CAU u UAQJUUUUCGUUUCCU AUA U/Cd4 :UUFig.40bOriza sativa: RICEr263
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5half1300 uAGG 6666G AG66U...GAIC ..~~~~~~UAccGUGGCAG-eCuC-AUGGU AA ~ ~ ~~ 666 6 666;"C"CGAA .6GAzg 1800 u~~~~~~~686666~~~~~~~~~~~~~~~~~~~~~C,,GuUUAU_A666 666 66`C666UA/GC.CA A GC.CUGG8C c~~~~~~~88OG66 66 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~~~~GG-C G: uUA~~~~~~97666 66~~~~~~~~~~~~~~~~~~~~~~~~~~~~11666 6 1005AA UGA GCU 0C0UGA, :U jp C6666666 cu~~~~~~~~~~~~ 6666~~~~~~~F~~~~~ AU AA8If u"6cA70AA0 AA.666 6666CUU U G G666E666 GGGC6666666GCAAAC6 6U6GUGU G1602c 165-6AuCA 6GU5.8AA3C1006.~~~~6 ~ ~ Acu 66 666, C6 A3U86-6 66A5ZCGG6.It5II 111 G A 6c 666666 =6 66CAA, ~ ~64o ~666u6 8 88 d6.6 6U%6..~6,.J666666666UG66AC6UGCA66U.Au A I UGAG~~~6 6 6 6?U66u CU., ~ ~ ~ ~ 666 6 ~ , .6 666666666CUC 6.. 6 66 66AAGG,1G66 6G/~~~~~~~~~~~~uGUAU66 1400 6C6C666C6G.6666A 688 CC666666666l666C66 6 6 6 6 6 6 6~~~~~~~~~c: A7G-22A 68 8ICCAAC~~~~~-~-9 AA~~CC: 666 66 6200-%"A 8.U :A A:~~~~~~~66 6 6 II,, 666666666666666666666666666666666 6A 66 66G6 lc Ar00,,AGUAG~~~~~~~~~~~~66 0~68 6,GAGAACG G~ ~~~~~~~~~~6 6>1 G6" IllA16 6 .6 .6Fig.41aCaenorhabditis elegansr264
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3halfUGGUUGGAACGGUUGOCCAGUUGGUUGAUGCUUUUCCGGCOCAGUUCUOGUCUGCUUGAUACUUUCGOOUUOAUUGCGUACUAGUGAUUGUOCCUUGCUUGCGGACGCUUUCUGOUUUGUUCUUUUACCUC GUUCUAUA UCCUGAUCGCUCAUCUAAACAACCOUAG: 2039-2204G UU A AAAG u ,G-CUU-CCGGA g_AUCG GGUACCGGAuUCAAUGCCUAGA UCAAA2000AAAAUUUCUUGCUUCCCOGUGUCGGGAGGCAUCUCUAUCUCOUGOCAACACGAGAGCUUAUGCCCUAUGUAUGOCCUUUGCGUCGUAGUUAAUUCUUCUACGCUUGCCAACGCCAGAUCACUCUGGUUCAAUGUCOGOOGK: 3261-33993,Fig.41bCaenorhabditis elegansr265
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5halfE: 1622-1719-A A GAUGA,,,. aCUCGAC203326SAAAQCACCCAOOOCOAOCCUA UOCOOACCCCOCAA UOCUCUCCUAACCOOOCUCUCOGC-B: 420-674Fig 42aPhysarum polycephalumr266A*AACQ"AAAUCUAUACQWIACUC:UCGAAA ocuo"coaauucaucCCCUGCCAUACOOCOCUCAOUAC. OCACAOCUGC"CUGAGGC"COCUOG"AAGOUOACCUAACG"CAA UCUCOCUUACGG"GAG"CO"CAA"ACACCG"Accocaa"ccuc UCCOUCUA"GCUUACACUCACOCOU"AUG"UUCGCCCCAUAACCOU"GAC4UACACCOUGUCAGAOCUUAGUUUAC--- -- -- -- -- - -- - - -
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3halfAGOCU:GGUGUCGCUGGCUGGGUA AAOGCU OCOGGAUGUGCUUUAGUAA AAUGOCCoAGOCoCUUUCGoGUGCCOA uGAGCOUAACOOOCCOCUCGGGCU O-cGAAAACUABAUCAUUGCGGAOGUUC U-AOCCCOAGUGOUGAAAACCOOCACAC A ACoCUAACAoCUAAC A cG: 2103-2266 AAA cGCA U AUG t- 2U AA UU A CIU AAAACAU 0U AA A UAUGUUUAGO2300 A UA AAS S-(CI ACGCH: 2683-2914U0CU0UAACIAACOAACOGAACCOCOUCCCUCU CACCGUAAAAGOUOGGOOAAGOGAUAGOCAAUCCAAAUUCUAGCOCUUUCCOCOCUCAUACOACGAGUU0GCUCCCCUG0GUGAGUACCOUGGAACCAC0A0CUGG0CUUCCOAUCCGGCGAOUGCU0UUUCCGC000AACCA0AGACGOUCUUCUCOOCCUCUOUGOOCUUCAUGCCGOUACGUAAUUGCGUGUAGC3000AGAC AG-CC-GGZUG-CCOCAAUCAAAGAUACOCUUGC UUUUAAGUCUGGCAACOCOGUCUUUUACCAUCAACA0CCAGUCAACU0A0CA0OACOCOAUGCAAA0A0OUC0AAAUUAOCCCGUAAAAAGOUCAGUUCCUCGUUAA0CCOCCCCCACOGGOOCAUCAACOOCOCUCCOCCU0CAUCA0GCUCOQUAUUCK: 3496-3676FigA2bPhysarum polycephalumr267ua
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 5halfE: 1637-1744 59 "6e" H: 1783-1994IU.GUGGAAAUCGAAA^CACUUGCCAOOUGACAAAUCAAUCCUCCCACGOUOAaCUUUCUUUUCACCAUAAUCCAAUCUCCOOCUUUOCUOOOCUUOOOCCUUUUUACUUCUCOC(IUUGUUCGOAOCOOOOGCCCAAGAUUGAAAAAUGCAOCUCUCCCUACOUACUOUCAUUOUUOUGAGUUCUOCGCAUUAAACAAAAACCUOOOOUOUe, *s,.95.8SO^AUOC4A44UQCAUCUGUOOGU UCACACOUC*AAUCCOUUUOAUUUGCCCAACACCO^CcmC: 759-824ACAAUUo"AvUAscCUCC:uuucouuuuUoccAGAACCAocccuAcuocaucCOcoc"GcAo cuucucu uoUCUCCAuGcu"COCA4SAAAAUoSoOU&CCCCCACC _.8: 462- 674Fig.43oCnthidia fasciculatar268
    • Nucleic Acids ResearchSecondary Structure of eucaryotic 23S Ribosomal RNA: 3halfG:2124- 2342GGGCAAAGUCAG2AGAAAACCGGAGG AGCCAGUGUCCCUCCACGUGCAGCCGAuCuuCAGAUUUGouuuAGCGCuC c uGCCGCCUA:ACACGCAGUUAGCGACAuucccoocouou^^c cc o_ cCUCACUCuGGCACGooCCoGGCuuG c cOCOGGUUCACOCUCOUCUUGUGCCG A 0H: 2752-3012HK:3426-3541GAAAAAGCGAGAAAAAGAUUAUCCGGC AAAAC OGA C UC GGCCGACUAUGGGOCCU GGCGAGCGGUGGOAGAAGUAACGCCAUCACCGUGAGAUUGAGAAGGGAACUCGCA"6f"1 39 /59"1"CCC UCA ACGAAUACGC CACCUAUCACACA GGA GOCAUGC 0CC CUAC UCGGC C_UCA A GA AUA UUCA AGA UCACA A GGAACAACGUCCCUCACCAAACGAGAGOGGGGCACUAACGUCCCGAGGCGCAGAACCAA GA GGCC UGA AAUUA CA AGCUCAGOGACAL: 3698-3906AGUAAG%GCacuuc cG 3650c GCOCAAFig.43bCrithidia fasciculatar269L/