Gutell 120.plos_one_2012_7_e38320_supplemental_data
Upcoming SlideShare
Loading in...5
×
 

Like this? Share it with your network

Share

Gutell 120.plos_one_2012_7_e38320_supplemental_data

on

  • 312 views

Feagin J.E., Harrell M.I., Lee J.C., Coe K.J., Sands B.H., Cannone J.J., Tami G., Schnare M.N., and Gutell R.R. (2012). ...

Feagin J.E., Harrell M.I., Lee J.C., Coe K.J., Sands B.H., Cannone J.J., Tami G., Schnare M.N., and Gutell R.R. (2012).
The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum.
PLoS One, 7(6):e38320.

Statistics

Views

Total Views
312
Views on SlideShare
312
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Gutell 120.plos_one_2012_7_e38320_supplemental_data Document Transcript

  • 1. The Fragmented Mitochondrial Ribosomal RNAs ofPlasmodium falciparumJean E. Feagin1*¤a, Maria Isabel Harrell1¤b, Jung C. Lee2¤c, Kevin J. Coe1¤d, Bryan H. Sands1¤e,Jamie J. Cannone2, Germaine Tami1¤f, Murray N. Schnare3, Robin R. Gutell21 Seattle Biomedical Research Institute, Seattle, Washington, United States of America, 2 The Institute for Cellular and Molecular Biology, and the Center forComputational Biology and Bioinformatics, The University of Texas at Austin, Austin, Texas, United States of America, 3 Department of Biochemistry and MolecularBiology, Dalhousie University, Halifax, Nova Scotia, CanadaAbstractBackground: The mitochondrial genome in the human malaria parasite Plasmodium falciparum is most unusual. Over halfthe genome is composed of the genes for three classic mitochondrial proteins: cytochrome oxidase subunits I and III andapocytochrome b. The remainder encodes numerous small RNAs, ranging in size from 23 to 190 nt. Previous analysisrevealed that some of these transcripts have significant sequence identity with highly conserved regions of large and smallsubunit rRNAs, and can form the expected secondary structures. However, these rRNA fragments are not encoded in linearorder; instead, they are intermixed with one another and the protein coding genes, and are coded on both strands of thegenome. This unorthodox arrangement hindered the identification of transcripts corresponding to other regions of rRNAthat are highly conserved and/or are known to participate directly in protein synthesis.Principal Findings: The identification of 14 additional small mitochondrial transcripts from P. falcipaurm and the assignmentof 27 small RNAs (12 SSU RNAs totaling 804 nt, 15 LSU RNAs totaling 1233 nt) to specific regions of rRNA are supported bymultiple lines of evidence. The regions now represented are highly similar to those of the small but contiguousmitochondrial rRNAs of Caenorhabditis elegans. The P. falciparum rRNA fragments cluster on the interfaces of the tworibosomal subunits in the three-dimensional structure of the ribosome.Significance: All of the rRNA fragments are now presumed to have been identified with experimental methods, and nearlyall of these have been mapped onto the SSU and LSU rRNAs. Conversely, all regions of the rRNAs that are known to bedirectly associated with protein synthesis have been identified in the P. falciparum mitochondrial genome and RNAtranscripts. The fragmentation of the rRNA in the P. falciparum mitochondrion is the most extreme example of any rRNAfragmentation discovered.Citation: Feagin JE, Harrell MI, Lee JC, Coe KJ, Sands BH, et al. (2012) The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum. PLoS ONE 7(6):e38320. doi:10.1371/journal.pone.0038320Editor: Bob Lightowlers, Newcastle University, United KingdomReceived February 15, 2012; Accepted May 3, 2012; Published June 22, 2012Copyright: ß 2012 Feagin et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Funding: Support for these studies was provided by National Institutes of Health R01 AI40368 and The M. J. Murdoch Charitable Trust (JEF), by grant MOP-11212to Michael W. Gray from the Canadian Institutes of Health Research (MNS), and National Institutes of Health R01 GM067317 and Welch Foundation F-1427 (RRG).The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.Competing Interests: The authors have declared that no competing interests exist.* E-mail: feagin@u.washington.edu¤a Current address: Departments of Pharmacy and Global Health, University of Washington, Seattle, Washington, United States of America¤b Current address: Center for Childhood Infections and Prematurity Research, Seattle Children’s Research Institute, Seattle, Washington, United States of America¤c Current address: Department of Physics and Chemistry, Milwaukee School of Engineering, Milwaukee, Wisconsin, United States of America¤d Current address: Drug Discovery, Drug Metabolism and Pharmacokinetics, Johnson and Johnson, San Diego, California, United States of America¤e Current address: Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington, United States of America¤f Current address: Atlantic Research Centre, Dalhousie University, Halifax, Nova Scotia, CanadaIntroductionThe human malaria parasite Plasmodium falciparum has a mostunusual mitochondrial (mt) genome. It consists of tandem repeatsof a 5967 nt sequence which encodes open reading frames similarto the genes for cytochrome c oxidase subunits I and III (cox1 andcox3) and apocytochrome b (cob) of other organisms [1]. Mt DNAsalso characteristically encode the rRNAs needed for mt translation[2]. While sequences similar to regions of large subunit (LSU) andsmall subunit (SSU) rRNAs are encoded by the P. falciparum mtgenome, they are scattered across both strands of the genome,interspersed with each other and the protein coding genes, andcorrespond to small RNAs [3,4]. Fragmented rRNAs have beenreported from other organisms [5–13] and in some instances, mostnotably for Chlamydomonas reinhardtii mitochondria [5], thefragments are encoded out of order with each other. However,the Chlamydomonas mt rRNA fragments correspond to the majorityof the eubacterial rRNA structure while those of Plasmodium speciesmap to a smaller percentage of the bacterial rRNA. TheCaenorhabditis elegans mt rRNAs [14] and those of kinetoplastidprotozoans [15–18] are very small but are composed of continuousLSU and SSU rRNAs. The combination of a high degree offragmentation and the small size of the fragments makes the P.falciparum mt rRNAs among the most unusual described.PLoS ONE | www.plosone.org 1 June 2012 | Volume 7 | Issue 6 | e38320
  • 2. The features of a particularly small mt genome with just threeprotein coding genes and highly fragmented mt rRNAs appear tobe conserved among the phylum Apicomplexa, to which P.falciparum belongs. The mt DNA sequence has been determined fornumerous species of Plasmodium, which demonstrate strong overallconservation. The sequence and transcription of the mt genome ofthe rodent parasite Plasmodium yoelii have been examined in somedepth [19,20], demonstrating the same structural and geneticorganization as for P. falciparum. Mt genomes of other Plasmodiumspecies, while not as thoroughly analyzed, share these character-istics [21] (also described in this work), as do related species.Theileria parva is an apicomplexan cattle parasite having a ,6.6 kbmt genome [22,23]. The same three protein coding genes arepresent as in P. falciparum and a few rRNA fragments correspond-ing to domains IV and V of the LSU rRNA have been assigned bysequence analysis in T. parva [23]. The gene order for the T. parvamt genome differs from that of Plasmodium, however, as does thephysical form of the genome. The Plasmodium mt genome occurs intandem repeats but the T. parva mt genome consists of single linearcopies of the genome bounded by inverted repeat sequences [23].The mt genomes of additional Theileria species and of severalBabesia species [24] have also been sequenced and are similar incharacter to that of T. parva, consistent with these genera bothbeing in Piroplasmida. Those of Eimeria tenella, a coccidian, havemuch the same genes but show a third variation on mt gene order[25]. The mt genomes of Hepatocystis, Leucocytozoon, and Hemoproteusspecies, lesser known apicomplexans, closely resemble Plasmodiummt genomes in structure and content [26]; they and Plasmodiumspecies are all members of Order Haemosporidia. Highlyfragmented mt rRNAs thus appear to be a common feature ofapicomplexans.Assignment of fragmented rRNAs based on DNA sequencesimilarities alone can be misleading. Consequently, evidence thatthe P. falciparum mt rRNA-like sequences are transcribed is animportant factor in establishing their potential as components offunctional mt ribosomes. We have previously reported a total of 20small transcripts mapping to the P. falciparum mt genome [4]. Theyrange from 40 to 195 nt in length and many carry non-codedoligo(A) tails of unknown function [27,28]. A majority of the smallRNAs are similar to regions of rRNA sequences from otherorganisms [3,4], although they are encoded in the mt genome outof linear order with respect to conventional rRNAs. Takentogether, they comprise many of the highly conserved sequences inrRNAs. However, RNAs corresponding to many regions of therRNAs were not previously detected, including the GTPase centerin domain II of the LSU rRNA. The two candidate sequencesinitially thought to comprise that region were each predicted to be,100 nt long [3] but evidence for transcripts in that size rangewas not found [4]. With the recent proliferation of large-scalesequencing projects, small transcripts complementary to mt DNAhave been reported from P. falciparum cDNA libraries, and thesimilarity of some of these to rRNA regions has been noted [29].Detailed crystallographic data for ribosomes and ribosomalsubunits have become available in recent years, greatly assistingour understanding of the functional correlates of rRNA andprotein structures. In 2000, Ban et al. [30], Wimberly et al. [31],and Schuenzen et al. [32] published high-resolution three-dimensional crystal structures of the Haloarcula marismortui largesubunit and the Thermus thermophilus small subunit of the ribosome,respectively. A year later, Yusupov et al. [33] published thestructure of the assembled T. thermophilus 70S ribosome. Moredetailed structural analyses have followed, including lowerresolution analyses of the mammalian [34,35] and C. elegans [36]mt ribosomes and mammalian cytoplasmic ribosomes [37]. Morerecently, higher resolution three-dimensional structures of twoeucaryotic cytoplasmic small ribosomal subunits were published,from Saccharomyces cerevisiae [38] and Tetrahymena thermophila [39].The mechanism of action of antibiotics has been structurallyprobed [40–42], the mechanism of peptide bond formation hasbeen evaluated [43–49], specific interactions between rRNA andprotein components of ribosomes have been assessed [50–53], andthe structure of the polypeptide exit tunnel has been revealed [54].This wealth of structural data, augmented with comparativeinformation that reveals patterns of sequence and structureconservation [55], provides a framework for further evaluationof the unusual Plasmodium rRNAs.We here report mapping an additional 14 small transcripts tothe P. falciparum mt genome, yielding a total of 34 such transcripts(Figure 1). Using multiple analyses, we have identified 27 of themas rRNA fragments assigned to specific regions of SSU and LSUrRNA. The regions represented are highly similar to the small butcontiguous mt rRNAs of C. elegans, and are consistent with afunctional role in mt protein synthesis for these highly fragmentedrRNAs.ResultsPlasmodium mt DNA ConservationComplete (or nearly complete) mt genome sequences arecurrently available for 25 species and one Plasmodium isolatecollected from a mandrill, and for eight species in four relatedgenera of hemosporidians (Table S1). All of them have the sameorder and orientation of the protein coding genes and theremaining sequence is highly conserved. We aligned representativesequences from each Plasmodium species, the Plasmodium isolate, andthe related hemosporidians, later adding mt DNA sequences fromanother 184 Plasmodium mt DNAs (Table S1). Based on thealignments, the closest relatives of P. falciparum are parasites ofchimpanzees: P. reichenowi, P. billcollinsi, and P. billbrayi, the lattertwo being recently suggested species [56]. (Gorillas harbor aparasite that appears even more closely related to P. falciparum [57]but a full mt DNA sequence is not available.) The mt DNAsequences of the three chimpanzee parasites are 97.4%, 94.2%,and 91.7% identical to that of P. falciparum (M76611), respectively.The mt DNAs of other primate malarias, including the humanparasites P. vivax, P. ovale, P. malariae, P. knowlesi, and multiplespecies that parasitize monkeys, are 87.3%–89.1% identical to P.falciparum. Those of rodent, lizard, and avian malaria parasites are87.8%–88.3% identical to P. falciparum. The conservation of thenon-Plasmodium hemosporidian mt DNAs relative to that of P.falciparum is 82.6%–86.8%. Some of the variation reflects minorsize differences among the mt genomes (Table S1). Much reflectssilent or conservative substitutions in the three protein codinggenes.Variations between individual sequences may represent poly-morphisms or sequencing errors instead of real differences. Mtgenomes have been sequenced from numerous geographicallydistinct P. falciparum [58,59] and P. vivax lines [60]. There arecomparatively few polymorphic sites within these species, princi-pally silent substitutions in the protein coding genes. There is farless redundancy of mt DNA data from other Plasmodium species;for some species, only a single sequence is available. However,some of those less-represented species are very closely related; forexample, the mt DNA sequences of P. cynomolgi, P. fieldi, and P.simiovale are ,99% identical to that of P. vivax so shared variation islikely real. Some of the sequence variation reflects single ntdifferences in just one of the species. Prudence is warranted wheninterpreting these as they may be idiosyncratic to a specific isolateP. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 2 June 2012 | Volume 7 | Issue 6 | e38320
  • 3. or may reflect sequencing errors. Many of the mt DNAs weregenerated by PCR amplification, adding another possible sourcefor variation. Additionally, the PCR-generated mt genomestypically lack a 50–100 nt region. Because the P. falciparum mtgenome is tandemly repeated, PCR amplification with neighbor-ing divergent primers yields a nearly complete genome, missingonly the sequence between the primers. Sequences generated fromdifferent isolates or species in the same study lack the same regionso these presumably reflect primer location. Such mt DNAsequences were included in our analyses, with the missingsequence ignored. We did not include other partial or incompletemt genome sequences in our analyses.The size of the complete Plasmodium mt genomes varies from5864 nt (P. billcollinsi and P. billbrayi) to 6014 nt (P. juxtanucleare).The differences relate primarily to nt additions/deletions at thejunctions between genes–both mRNAs and small RNAs–or in the281 nt of apparently non-coding sequence. This is so marked thatgaps in sequence alignments almost always correspond to themapped locations of transcript ends (Table 1). Other hemospor-idian mt genome lengths range from 5935 nt (L. sabrasezi) to6684 nt (L. majoris), except for Hepatocystis, which has substantialinsertions relative to the other mt genomes (discussed below). Foreach, most of the variation between sequences is due to differencesat the junctions between genes. Many of the alignment gaps occurat an A run, with the number of 39 A residues (or T for thecomplementary strand) in mt DNAs often differing betweenspecies. Nearly all of the P. falciparum small RNAs areoligoadenylated after transcription so differences in the numberof encoded A residues at the 39 end of an RNA may not matter.Addition of A residues post-transcriptionally may thus render theRNAs more similar among the species than are their genes.More substantial size variation occurs at some sites, creatinggaps in the alignment (Table S2). The twelve largest gaps includesix at the junction of genes transcribed from different strands andsix with both genes on the same strand. The largest of the gaps isfound between the cox1 and cob ORFs, separated by 20 nt in P.falciparum but by 94 in Hepatocystis. Transcript mapping has shownthat the P. falciparum cox1 and cob transcripts are immediatelyadjacent [27]. If that is also the case in Hepatocystis, theuntranslated regions (UTRs) for one or both transcripts wouldbe larger than some of the small mt RNAs. A thirteenth gap is a51 nt insertion in the Hepatocystis cob ORF toward the 39 end. Theinsertion maps to the 39 end of LSUB, and may or may not beincluded in the Hepaptocystis LSUB RNA. If included, it would be a39 tail for LSUB, and easily accomodated in the structure. Thepotential effect on COB is greater. The Hepatocystis amino acidsequence is well-conserved relative to that of Plasmodium prior toand following the insertion. The DNA sequence of the insertioncontains two stop codons but it seems unlikely that it is an intron.These are not common in mt-encoded genes and there is no otherevidence for introns in apicomplexan mt genomes. Alternateexplanations are that Hepatocystis has a truncated but functionalCOB, or that the stop codons reflect sequence errors. (Since onlyone Hepatocystis sequence is available, the latter explanation seemsquite plausible.) The inserted sequence, if translated, would have ahydrophobic character, consistent with the membrane proteinCOB, and the LSUB RNA would be unaffected, other than apossible tail.In several cases, some or all of the gap sequence is highlyconserved among species. A run of 13 nt in the gap between cox3and LSUF is conserved in all the species we examined, as areseven of the eight nt immediately adjacent to LSUF. Of 21 ntbetween RNA6 and RNA12, 15 are conserved in all the species weexamined. Even when there is not broad sequence conservation,there tends to be conservation among closely related species,consistent with related hosts (Table S1). However, species with thesame size of intergenic region (Table S2) do not necessarily havethe same sequence.A handful of sites have 4–7 nt discontinuities in the alignment;these are invariably located at the 39 or 59 end of a gene.Differences in nt sequence also tend to cluster near the ends of thesmall RNAs and in the intergenic regions. RNA10, which isassigned to the sarcin ricin loop (SRL) is the principal exception(Figure S1). The 39 part of RNA10 contains the SRL as part of aFigure 1. Schematic map of the P. falciparum mt genome. A schematic map of the 6 kb element is shown, with genes above or below the linedepending on direction of transcription (orange arrows: left to right above the line and right to left below). Because the P. falciparum mt genome istandemly repeated, the endpoints shown are the endpoints of Genbank submission M76611, rather than actual structure. Protein coding genes areindicated by white boxes, small mt rDNA sequences are shown with blue (SSU rRNA) and green (LSU rRNA) boxes and labels, and the locations ofRNA23t-RNA27t are indicated with red arrows and labels. Gene abbreviations: cox1 and cox3, cytochrome c oxidase subunits I and III; cob, cytochromeb; LA-LG, LSU rRNA fragments; SA-SF, SSU rRNA fragments; 1–22, RNA1-RNA22; 23t-27t, RNA23t-RNA27t.doi:10.1371/journal.pone.0038320.g001P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 3 June 2012 | Volume 7 | Issue 6 | e38320
  • 4. Table 1. P. falciparum small mt RNA mapping and identification.geneaP. falciparum M76611bcoordinatesT. parva Z23263coordinatesRaabe, et al. 29cDNAscsize RNA/DNA(P. falciparum)dsubunit/ordereSSUA 2023-1916 3666-3561 mtR_6043/27 125/108 SSU/4SSUB 505-390 4182-4074 none complete 116/116 SSU/6SSUD 5446-5379 3800-3733 mtR_111/36 65/68 SSU/10SSUE 1638-1680* 2095-2057 mtR_215/7 40/42 SSU/11SSUF 5507-5447 1840-1900 mtR_11b/1105 74,58/61 SSU/12LSUA 5201-5026 4073-3906 none complete 175/176 LSU/1LSUB 4618*-4586 3667-3691 mtR_143/27 30/29 LSU/3LSUC 225*-204 1824-1839 mtR_203/2 23/22 LSU/4LSUD 5854-5772 3114-3196 mtR_5773a/31 85/83 LSU/8LSUE 5771-5577 3199-3377 none complete 190/195 LSU/9LSUF 1516-1630 3507-3395 none complete 125,110/115 LSU/11LSUG 389-283 5667-5775 mtR_36a/221 110/107 LSU/12RNA1 593-506 3827-3905 mtR_19/19 95/88 LSU/6RNA2 1698-1763 3098-3032 mtR_69c/15 75/67 LSU/2RNA3 1830-1910 5658-5584 mtR_5713a/91 85/81 LSU/7RNA4 4625-4696 mtR_37a/410 75/72RNA5 4716-4802 mtR_5822/61 92/87 SSU/9RNA6 4808-4865 1643-1584 mtR_92/41 58/58 LSU/15RNA7 5283-5202 1678-1758 mtR_5837/69 94/82RNA8 5954-5855 3031-2940 mtR_41/38 115/100 SSU/5RNA9 72-125 4211-4183 mtR_182b/7 62/54 SSU/8RNA10 724-625 4359-4301 mtR_140a/29 100/100 LSU/13RNA11 5340-5284 2300-2240 mtR_14a/12 78/57 LSU/5RNA12 4887-4945 mtR_52b/35 68/59 SSU/2RNA13 5025-4996 4401-4373 mtR_5844/63 48/30 LSU/10RNA14 5546-5508 2039-1997 mtR_11c/62 40/39 SSU/1RNA15 624-594 1759-1790 mtR_76b/163 40/31RNA16 3-33 mtR_60/21 ?/31RNA17 126-165 2192-2154 mtR_18a/132 ?/40 SSU/3RNA18 4964-4988 1518-1494 mtR_104/23 ?/25 LSU/14RNA19 5576-5547 mtR_42/9 ?/30 SSU/7RNA20 34-71 mtR_86/15 54/38RNA21 1807*-1829 mtR_26/26 ?/23RNA22 5378-5341 mtR_59/124 ?/38RNA23t 171-203 mtR_21/182RNA24t 262-224 mtR_39/36RNA25t 283-262 mtR_40b/15RNA26t 1764-1806 mtR_49/72RNA27t 4138-4085 mtR_84/122aNaming convention reflects history of identification [4]. RNA23t through RNA27t are tentative assignments. We have not detected them in RNA blotting experiments,but sequence conservation and comparative abundance of cDNAs [29] suggest they are mature RNAs or abundant processing products.b59 ends are based on primer extension data, except for RNA1 (RNase protection), RNAs 9 and 14–22 (59 RACE), and RNA21 (Raabe, et al. [29] cDNAs and sequenceconservation). 39 ends were determined by 39 RACE except for SSUE, LSUB, and LSUC (inferred from 59 end location and transcript size). We have confirming RNaseprotection data for many of the 59 and 39 ends. *, coordinates inferred.ccDNAs corresponding to mapped P. falciparum mt RNAs. Each designation is name/number of cDNAs.dThe observed size from denaturing polyacrylamide gels is noted for the RNA size, compared to the gene size (DNA) based on the location of 59 and 39 ends. ?, RNAidentified by RACE, not blotting.eAssignment of P. falciparum small mt RNAs to large and small subunit rRNAs; numbers indicate linear order relative to conventional rRNAs.doi:10.1371/journal.pone.0038320.t001P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 4 June 2012 | Volume 7 | Issue 6 | e38320
  • 5. 43 nt sequence block that is nearly identical among Plasmodiumspecies. A 13 nt block at the 59 end of RNA10 is identical amongspecies. Between these sites, there is considerable variation,including additions/deletions. Overall, the mt DNAs of Plasmodiumand related hemosporidians are very highly conserved.Identification of Additional P. Falciparum Small mt RNAsThe GTPase center of the ribosome plays a crucial role intranslocation so assignment of corresponding RNA fragments is anecessity to postulate a functional mt ribosome. Our attempts tolocate such fragments by northern blot analysis were initiallybased on the expectation from sequence analysis that theseRNAs would be ,100 nt long; these attempts were unsuccessful[4]. One alternate possibility was that other small RNAs from themt DNA might encode the GTPase functions. However, none ofthe five RNAs that were unassigned to specific regions of rRNAat that time appeared similar to the GTPase center sequences[4]. Completion of the mt genome sequence from several otherPlasmodium species provided another means to look for smallRNAs. When we aligned the mt DNAs of Plasmodium species, wefound 100% conservation in two short regions which weresimilar to the GTPase center: a region 26 nt long for helixH1057 and 16 nt long for helix H1087 (Figure S2A). Wetherefore re-examined transcription for these very small, highlyconserved regions using oligonucleotide probes complementary tothe conserved sequences. The result was detection in P. falciparumRNA of a ,30 nt RNA (LSUB) and a ,23 nt RNA (LSUC) forthe 26 and 16 nt conserved regions, respectively (Figure S2B).We believe that, despite their very small size, these RNAsprovide the GTPase center of the Plasmodium mt ribosome.The difficulties we encountered in detecting the GTPase centerRNAs suggested that other small RNAs might have been missed inprior studies. The nucleotide sequences of regions known toencode putative rRNA fragments are typically conserved amongPlasmodium species at 90% or greater (Table S3). In comparison,while the amino acid sequences of the three protein genes areconserved at .95% among these species, the nucleotide sequencefor the mRNAs is only ,85% conserved (Table S3). These dataprovided a criterion for re-examination of P. falciparum mttranscripts. We analyzed all apparently non-coding mt sequences.15 nt long that were conserved at ,90% or better amongPlasmodium species. By RNA blotting and hybridization (Table S4),we found additional transcripts: RNA11 (assigned to LSU rRNA),RNA12 and RNA14 (both assigned to SSU rRNA), RNA15, andRNA16 (Figure S3). Comparison of the P. falciparum and T. parvamt DNAs suggested another possible LSU rRNA fragment, andRNA blotting confirmed the presence of a small RNA, nowlabeled RNA13 (Figure S3). We also evaluated small regions ofvery high conservation by 59 and 39 RACE (Table S4), confirmingsix additional RNAs under 40 nt long: RNA17 and RNA19 (bothassigned to SSU rRNA), RNA18 (assigned to LSU rRNA),RNA20, RNA21, and RNA22 (Table 1).After completion of our transcript mapping but prior tocompletion of our sequence analysis, Raabe et al. [29] publishedan analysis of non-protein coding RNAs identified from size-selected P. falciparum cDNA libraries. They reported .100 suchRNAs corresponding to the mt genome. We analyzed their datawith ours, comparing the location of transcript ends and, forthose for which RNA blots were shown, whether the observedtranscripts were consistent with the expected size of the smallRNAs and their potential precursors. They found cDNAscorresponding to all the small RNAs we identified (Table 1),though their cDNAs for LSUE (190 nt), LSUA (175 nt), LSUF(125 nt), and SSUB (116 nt) are not full-length and cDNAs forsome of the others have minor variance in 59 and 39 ends. Manyof the remaining cDNAs lack 59 and/or 39 ends consistent withour mapped transcript ends, some include parts of adjacent smallRNAs, and all were represented by just a few copies each (,10).In contrast, cDNAs corresponding to the RNAs we mappedtypically were abundant (.10 to 1000 copies), except that someof the smallest RNAs were poorly represented (LSUC, SSUE,and RNA19 each have ,10 cDNAs). The abundance of aparticular cDNA is not reliably diagnostic of the correspondingRNA abundance. However, correlation of our mapped tran-scripts to the more abundant cDNAs [29] is suggestive. Webelieve that the less abundant cDNAs may be products of RNAdegradation or breakage during experimental manipulation.With identification of these new small RNAs, only 4.2% of theP. falciparum mt genome–251 of 5967 nt, spread across 15 sites–lacked mature transcripts. The two largest sites are the 38 nt 39and 58 nt 59 flanks of LSUC. These include a 26 nt block and a14 nt block, respectively, in which the sequence is identical amongthe Plasmodium species and the other hemosporidians. Although wedid not find evidence for mature RNAs derived from thesesequences, Raabe, et al. [29] reported small RNAs from bothregions (mtR_21 on the 39 flank, and mtR_39 and mtR_40b onthe 59 flank). Similarly, they reported a cDNA (mtR_49)corresponding to the 43 nt between RNA2 and RNA21; sequenceconservation for this area is low (81.8%) but the variance is largelyconfined to the 59 third of the region. A 28 nt region between cox3and LSUF is well-conserved among the Plasmodium species(94.1%). The 39 15 nt of the region are included in an apparentlong-lived precursor RNA for LSUF, as discussed below. Theremaining intergenic regions range from 3–21 nt and conservationis typically 50–70% (Table S2). Lower conservation suggests a lackof (conserved) function.Five of the cDNAs [29] map to well-conserved sequences wherewe did not find evidence for RNAs; they are represented by .10cDNAs, and have transcripts of size consistent with the proposedcoding region and with processing from precursor transcripts. Asnoted above, four flank mapped rRNAs and the fifth (mtR_84) iscomplementary to part of the cob gene. Although we did not detectthese transcripts, their characteristics are consistent with thembeing at least long-lived processing intermediates and some may bemature mt RNAs. We have tentatively named them RNA23tthrough RNA27t (Table 1).With the possible addition of several RNAs identified by Raabe,et al. [29], all of the small RNAs that derive from the P. falciparummt genome have apparently been identified. The rRNA fragmentstotal 2037 nt, the seven unassigned RNAs sum to 328 nt, andthree mRNAs cover 3351 nt. Together, they account for 95.3% ofthe 5967 nt P. falciparum mt genome. (Overlapping sequences areonly counted once.) However, it is difficult to be absolutely certain.Including the Raabe RNAs would raise coverage to 97.6% of thegenome. Additionally, it is clear from the search for GTPasecenter rRNAs that transcripts can be as short as 23 nt; these arenot easily detected. Further, the LSUB fragment overlapscompletely the 39 end of the cob gene (but not the previouslymentioned Hepatocystis insertion) on the opposite strand of DNA(Figure 1). This opens the possibility of alternate strand coding forother small RNAs; Raabe et al. [29] report several of these but onlyone (mtR_84) appears to be plausible. While we have tested allregions of the P. falciparum mt genome for transcripts on bothstrands, not all have been subjected to the more rigorous scrutinyused to detect the GTPase center fragments. These caveats aside,we have mapped 34 small RNAs encoded by the P. falciparum mtgenome, 27 of which have been assigned to specific regions ofrRNA (Table 1).P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 5 June 2012 | Volume 7 | Issue 6 | e38320
  • 6. Transcript MappingA total of three protein coding genes and 20 small RNAs havebeen previously shown by RNA blotting to derive from the P.falciparum mt genome [3,4,27,28,61]; to these we have now added14 more small RNAs. The genes on the P. falciparum mt genomeare closely packed (Figure 1) and both DNA strands arepolycistronically transcribed, with individual transcripts presumedto be cleavage products from the precursor [62]. To assistevaluation of the predicted secondary structure and potentialinteractions of the rRNA fragments, we mapped the 59 and 39 endsof the small transcripts. Identifying the 39 end is especiallyimportant for the P. falciparum mt RNAs since most have non-encoded oligo(A) tails up to 25 nt long [27] and therefore the RNAsize on blots often exceeds the size of the corresponding DNAsequence. We have previously reported the 39 ends, includingoligo(A) tails, of some of the small mt RNAs [4] and here identifythe 39 ends and oligoadenylation status for most of the remainingRNAs (Table S5).The 39 ends of the P. falciparum small RNAs were identified by 39RACE, augmented in some cases by RNase protection. Theoligo(A) tails are often too short for priming cDNA synthesis witholigo(dT) so for 39 RACE, we enzymatically added 39 C tails tototal RNA. This was followed by cDNA synthesis primed witholigo(dG), then PCR amplification with oligo(dG) and gene-specific 59 primers [28]. The PCR products obtained were clonedand sequenced, revealing the presence of non-encoded As at the 39end of most of the small transcripts (Table S5). The length of the Atail is variable but tends to be generally characteristic for eachtranscript; that is, most cDNAs for specific small RNAs have shortA tails while those for others have predominantly long A tails(Table S5). SSUB lacks added 39 A residues [28] and, with thepossible exceptions of SSUE, LSUB, and LSUC (see below), is theonly small mt RNA that lacks an oligo(A) tail. The significance ofoligo(A) tail presence and size is unknown. Oligoadenylation of mtrRNAs has been previously reported for mammals and insects[63–65] but not examined in detail. The phenomenon may simplyreflect a promiscuous mt poly(A) polymerase activity.We obtained 59 end locations by primer extension, RNaseprotection, or 59 RACE; in many cases, more than one mode wasused. These data are straightforward with two exceptions. TheLSUF rRNA, which corresponds to part of the peptidyltransferasedomain of LSU rRNA, has two transcripts detected on RNA blots[4] and two primer extension products (Figure S4); the sizedifference in each case is 15 nt. The precise relationship betweenthe two transcripts is unknown. The larger transcript couldrepresent an abundant RNA processing intermediate or both sizesof the RNA could be functional, possibly in different roles. (We areunaware of any examples of the latter.) It is notable that the 15 nt59 extension of the larger transcript is less conserved amongPlasmodium species (,70%) than the remainder of the LSUF RNA(98%), due to considerable variability in the first seven nt (FigureS4). Sequence corresponding to the conserved section of LSUF hasbeen identified in T. parva [23], but there sequence correspondingto the 15 nt extension is not conserved. On balance, these databetter support the hypothesis that the larger RNA is an abundantprecursor. (Probes for SSUF also detect two sizes of transcript onRNA blots [4] but neither primer extension nor 39 RACE supportsan extension such as that seen for LSUF. This may reflect thatdifferent oligonucleotides used for the RNA blot, 39 RACE, andprimer extension might have differential ability to hybridize toboth RNAs; that hybridization dynamics differ for blot hybridiza-tion compared to solution hybridization; or that the RNA blotprobe cross-hybridizes to another small RNA.) The secondexception involves the 59 end of RNA21, for which detection ofapparent precursor transcripts by 59 RACE both enlightens andcomplicates data interpretation, as discussed below.Mapping for three of the small RNAs posed technical challengesthat we were not able to overcome. The 40 nt SSUE RNAincludes a near-universally conserved 16 nt sequence, GUACA-CACCGCUCGUC. Except for the underlined U, this exactlymatches the corresponding sequences from the genome of the P.falciparum apicoplast (a relict plastid that encodes its own rRNAs[66]) and the nuclear encoded SSU rRNAs. The small size of thetranscript limits options for positioning primers and attempts at 39and 59 RACE for SSUE using total RNA have failed, likely due tocross-hybridization of the primers to these other rRNAs. Use of mtRNA would theoretically alleviate this problem. However,methods for isolation of P. falciparum mitochondria [67,68] providerelatively crude fractionation. We have found RNA from suchorganelle preparations to be significantly contaminated with non-mt sequences, and were unable to obtain an SSUE 59 RACEproduct from the ‘‘mt’’ RNA. Primer extension produced multipleproducts, some of which also may reflect cross-hybridization toother P. falciparum rRNAs. Consequently, the 59 and 39 ends ofSSUE are predictions, based on the following observations:N Radiolabeled probes complementary to SSUE detect a 40 nttranscript [4].N SSUE size does not alter following digestion with RNase H inthe presence of oligo(dT), suggesting that the transcript lacks asignificant oligo(A) tail [28].N 59 RACE for RNA21 produced long products which appear toderive from partially processed precursor transcripts. Twoclones have a 59 end at 1631 and two at 1638. The LSUF 39end from 39 RACE maps to 1630 [28] and the 41 nt conservedregion starts at 1638 (Figure S5A).N SSUE is encoded in a 64 nt region between LSUF and RNA2.A 41 nt portion of that region is 100% conserved amongPlasmodium species and varies very little in the otherhemosporidians. It differs from the other P. falciparum SSUrRNAs at just two sites in the 39 half. The conserved region isflanked by seven slightly variable nt at the 59 end and the 18 nt39 flank is poorly conserved among Plasmodium species.N The 41 nt conserved sequence fits well into the expectedsecondary structure for this region of SSU rRNA, includingmaintenance of highly conserved sequence and capacity toform helices with portions of SSUB and SSUF, creating areasonably conventional secondary structure (Figure 2). How-ever, the final 18 nt of the 64 nt region would not be predictedto participate in a helix with other small mt RNAs.Taking these points together, it is likely that SSUE isencompassed within the 41 nt highly conserved sequence, withits 59 end at 1638 and the 39 end at 1680, and few, if any, As addedat its 39 end.Mapping LSUB and LSUC presented a different challenge. ForRACE, at least one primer must be gene-specific and success isenhanced if nested gene-specific primers can be used. However,the LSUB and LSUC transcripts are only 30 and 23 nt,respectively, so the gene-specific primers are severely limited.That the primers must be small means in turn that temperatures inthe initial rounds of PCR must be comparatively low, withaccompanying loss of specificity. Despite multiple attempts, wehave been unable to obtain RACE products for these RNAs.Given the relative size of the transcripts and their highly conservedsequence, any 39 oligo(A) residues would likely be too few innumber for successful RNase H analysis for A tails. Based onconservation of sequence between the Plasmodium species, betweenP. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 6 June 2012 | Volume 7 | Issue 6 | e38320
  • 7. Figure 2. SSU rRNA secondary structure. The P. falciparum mt SSU rRNA secondary structure model is superimposed onto the E. coli SSU rRNAsecondary structure model diagram. Regions where P. falciparum has no structure equivalent to E. coli are shown using gray circles and lines. Colorednucleotides compare the P. falciparum sequence to the Three Phylogenetic Domains/Two Organelles (aka 3P2O) consensus sequence from the Gutelllab’s Comparative RNA Web (CRW) Site [URL for CRW Site: http://www.rna.ccbb.utexas.edu/. URL for 16S rRNA conservation diagram: http://www.rna.ccbb.utexas.edu/SAE/2B/ConsStruc/Diagrams/cons.16.3.3DOM.pdf]. Upper case colored nucleotides are conserved in at least 98% of the sequencesP. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 7 June 2012 | Volume 7 | Issue 6 | e38320
  • 8. P. falciparum and T. parva, and the size of the transcripts, we havepredicted the likely 59 and 39 ends as 4618 and 4586 for LSUB and225 and 204 for LSUC, respectively (Table 1).Transcription and ProcessingMt genomes are often polycistronically transcribed, thencleaved to release mature RNAs [69]. We have previouslyreported evidence for extensive polycistronic transcription of theP. falciparum mt genome, including RNase protection dataconsistent with multigenic precursor transcripts and detection ofoverlapping, near-genome length RT-PCR products [62]. DuringRACE analysis of the P. falciparum mt small RNAs, we obtainedadditional evidence in support of polycistronic transcription. Asnoted above, 59 RACE with a gene-specific primer for RNA21generated products that assisted identification of the SSUE 59 end.Additional products mapped to nt 1754, 1764, 1765, and 1766 ofP. falciparum mt DNA (Figure S5A). The 39 end of RNA21 maps tont 1829 (Table 1) but we were unable to detect RNA21 by blottingso could not use transcript size to assist the analysis. Gaps in the mtDNA alignment, combined with cDNA data [29], suggest thereare two transcripts between RNA2 and RNA3. One is RNA21(mtR-26), a 23 nt transcript with only two variable sites, and theother is RNA26t (mtR_49), a 43 nt RNA that is .90% conservedat all but seven residues toward the 59 end. RNA2, RNA26t,RNA21, and RNA3 are immediately adjacent to each other in P.falciparum but there are 1–2 nt gaps or insertions in many otherspecies, located at the predicted junctions. Ironically, the primerchosen for RNA21 overlapped its 59 end, but that end wasidentified from analysis of apparent precursors. The 59 RACEproducts mapping to 1764–1766 likely derive from the cleavagethat produces the 39 end of RNA2/59 end of RNA26t, followed byminor nibbling. (Position 1754 maps within RNA2 and we suspectit reflects an artifact.).RNA16 and RNA20 abut each other and are transcribed fromthe same DNA strand (Figure 1). While performing 39 RACEusing a gene-specific primer for RNA16, we obtained two sizes ofPCR product. One corresponded to RNA16, including its oligo(A)tail and the other included RNA16 with no A tail followed byRNA20, which had an oligo(A) tail (Figure S5B). Similarly, whenperforming 59 RACE with a gene-specific primer for RNA20, weidentified not only the 59 end of RNA20 but also obtained longerproducts consisting of the expected RNA20 sequences plus all ofRNA16 (Figure S5B). These data imply that 39 cleavage andoligoadenylation of RNA20 can precede the corresponding stepfor RNA16 and that the 59 end of RNA16 can form prior to its 39end.The accumulated mapping data have allowed us to identifypossible sites of cleavage in the putative precursor transcript. Onecaveat exists for this analysis; if the 39 end of an RNA maps to anA residue, it is ambiguous whether that A derives from the DNAsequence or from addition of the oligo(A) tail. Unless there is datasuggesting otherwise, we have assumed that 39 end A residues withcorresponding DNA sequence are encoded rather than added bypoly(A) polymerase. Based on this criterion, many of the mtRNAsdirectly abut each other. Indeed, in almost every instance in whichgenomic As are found at the junction between genes, it appearsmost likely that they are part of the transcript of the upstreamgene. We have identified one exception. At the junction of RNA14and SSUF (Figure 1), 39 RACE shows that RNA14 has an oligo(A)tail (Table S5) and there are three A residues at the junctionbetween the two genes. Our default interpretation would assignthose As to RNA14. However, 59 RACE shows that SSUF starts atthose A residues. Unless the genes overlap, which is not seenelsewhere in this genome for genes on the same DNA strand (butsee below), all of the As at the 39 end of RNA14 must be addedrather than encoded. Similarly, the junction of RNA1 and SSUBlies in a run of four As. 59 RACE for SSUB showed sometranscripts starting with two As and some with three. The numberof encoded As at the 39 end of RNA1 is therefore uncertain, butaddition of the A tail renders this moot.Ribosomal RNAs are typically derived by cleavage from apolycistronic precursor RNA, often via sequential steps. We havepreviously demonstrated the existence of near-genome lengthpolycistronic transcripts of the P. falciparum mt genome [62],suggesting a role for cleavage to produce individual P. falciparum mtRNAs. The mapping data indicate that there are four sets ofabutted genes, with four to 12 members per set (Table S6). Forthese, a single cleavage event would suffice to create the 59 end ofone RNA and the 39 end of its neighbor. Polycistronictranscription of close-packed genes, followed by cleavage toproduce individual mRNAs, is a common feature of mt genomes.In vertebrates, most mt genes are flanked by tRNAs, andproduction of mature mRNAs and rRNAs goes hand-in-handwith tRNA processing [69]. A similar mechanism would beconsistent with the accumulated P. falciparum data. However, the P.falciparum mt genome does not encode tRNAs so anothermechanism must guide cleavages. The junctions betweentranscripts do not share any obvious specific features with eachother or with the 59 or 39 end sequences immediately adjacent toother P. falciparum mt RNAs except for a tendency to have an A asthe last encoded residue. Similarly, RNAs which do not directlyabut their neighbors also show no conserved characteristics exceptthe tendency to have a 39 terminal A. Of the 31 small RNAs forwhich 39 RACE data is available, the genes for 19 end with A, 2with C, 3 with G, and 7 with T (Table S5). The composition of themt genome is 32.39% A, 15.69% C, 15.90% G, and 36.01% T.The prevalence of A residues at the 39 end of transcripts thereforestrongly exceeds that expected by chance. (This point, of course,depends on our interpretation of which A residues are encodedand which are added.) Overall, the mechanism for recognition ofputative cleavage sites remains unknown.Assignment of New rRNA FragmentsPrior analyses proposed that 15 of the small P. falciparum mtRNAs corresponded to specific regions of LSU or SSU rRNAs [4].These assignments were based on conservation of sequence and/or the potential to form an appropriate secondary structure whilemaintaining some conserved sites. Assigning fragments whichmight correspond to less conserved regions of rRNA structure ismore challenging, but can be assisted by cross-species comparisonsbetween related organisms. The gene content and organization isidentical in all Plasmodium species for which complete mt DNAs areavailable. Indeed, the overall nt conservation is so high (Table S1;Table S3) that comparisons between these are not particularlyused. For the P. falciparum mt rRNA fragments: red nucleotides match the 3P2O consensus sequence, light blue nucleotides differ, and blacknucleotides cannot be compared to the consensus (which is conserved at less than 90%). Base pair symbols are colored when both of the pairednucleotides have the same color. Each fragment is labeled at its 59 and 39 ends. Each helix present in P. falciparum is labeled with its helix number ingreen (e.g., H500), based on the CRW Site’s helix numbering system [URL: 16S rRNA, http://www.rna.ccbb.utexas.edu/CAR/1A/Structures/h.16.b.E.coli.hlxnum.pdf]. Inset: C. elegans mt SSU rRNA secondary structure model.doi:10.1371/journal.pone.0038320.g002P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 8 June 2012 | Volume 7 | Issue 6 | e38320
  • 9. useful in assigning the small RNAs to positions in the SSU andLSU rRNAs. However, the mt genome of T. parva was useful forcomparison.The T. parva mt genome is, at ,6.6 kb, quite small and encodesthe same three protein coding genes as the Plasmodium mt genomes,but they are aranged in a different order on a linear molecule,flanked with inverted repeats [23,70]. The genome also encodessmall RNAs which have similarity to rRNA sequences, some ofwhich have been previously described [23]. Thus, although thegenome organization is quite different from that of Plasmodiumspecies, gene content is very similar. We undertook a detailedexamination of the T. parva mt genome for sequences correspond-ing to the small RNAs mapped to the P. falciparum mt genome. T.parva matches were found for 24 of the 27 P. falciparum small mtrRNAs and for 2 of the unassigned RNAs (Table 1). Four of thefive previously predicted T. parva LSU rRNAs [23] match wellwith our P. falciparum mapping data and predictions. The fifth, T.parva LSU5 RNA, has only a partial overlap with its P. falciparumcounterpart, RNA3, as discussed below. With data from twogenera, it was possible to identify compensatory changes insequence which assisted assignment of additional P. falciparumRNAs to specific regions of rRNA. The T. parva analysis alsoassisted the identification of corresponding sequences in otherapicomplexans (Table S7). The predicted secondary structures forfragments comprising the P. falciparum SSU and LSU rRNAs areshown in Figures 2, 3, 4; the corresponding predicted secondarystructures for T. parva are shown in Figures S6, S7, S8.Conservation at each position is assessed by comparison to allavailable rRNA sequences from three phylogenetic domains(Archaea, Bacteria, nuclear-encoded Eucarya) and two organelles(mitochondria and chloroplasts), called 3P2O (three phylogeneticdomains, 2 organelles).The P. falciparum and T. parva mt rRNA secondary structuremodels are very similar to one another and to the central core ofthe Escherichia coli rRNAs with one notable exception. E. coli 23SrRNA positions 1906–1934 are contained within one of the mosthighly conserved regions of LSU rRNA [55] (http://www.rna.ccbb.utexas.edu/) and, as expected, this region (near the 5’ end ofLSUE) is conserved in the P. falciparum sequence/structure.Surprisingly, the same region of the T. parva homologue is muchshorter, showing poor conservation [23]. This cannot be explainedas a sequencing error because the corresponding mt DNAsequences from Babesia and Theileria species (Table S1) are alsotruncated in this region.Additional evidence to support the placement of RNAfragments to the SSU and LSU rRNAs comes from analysis ofcovariation, evaluating whether the two positions that form abase pair have similar patterns of variation to maintain this basepair. [71] Three categories of covariation are used to gauge theamount of support for the placement of the RNA fragments.Category 1 base pairs contain only pure covariations, i.e., thepatterns of variation in the two columns in the alignment areidentical; all of the base pair types (e.g., A:U, G:C, U:A, C:G)covary with the other base pair types. Category 2 base pairs havecovariation between the two paired nucleotides, but they alsohave a low frequency of the two paired positions with differentpatterns of variation (e.g., base pair types A:U, G:C, with G:Uless frequent, or A:U, G:C, with A:A less frequent). Category 3contains those positions that are either invariant or the patternsof variation at the two paired positions are not the same (e.g.,G:C ,-. G:U). We analyzed the base pair types present for themt rRNA fragments from 218 apicomplexans (species ofPlasmodium and other hemosporidians, the coccidian Eimeria,and the piroplasms Babesia and Theileria). In total, 27 of the 34(39)transcripts for hemosporidians, 20 predicted RNAs for thecoccidian, and 24 predicted RNAs for the piroplasms wereassigned to rRNA. The fragments that were compared areindicated in Table S7; the category 1 and 2 base pair types aregiven in Table S8 and shown in Figures S9, S10, S11).RNA14 is the best candidate among the small RNAs for the 59end of the SSU rRNA, being the only fragment which can form anappropriate helix (H27) with SSUA (Figure 2). The T. parvasequence predicted to correspond to RNA14 has little sequencesimilarity to it but has capacity to pair with the T. parva SSUA-equivalent and can form a similar predicted structure. The base-pairing potential for the T. parva sequence is better than thatproposed for P. falciparum, thus providing more confidence in ourassignment of RNA14 as the 5’ end of SSU rRNA. Of the 17 basepairs in the RNA14 fragment, three are category 1 and four arecategory 2 (Figure S9; Table S8). RNA8 was previously proposedto correspond to the 59 terminal domain of SSU rRNA (prior tothe identification of the RNA14 transcript) [4]; we now show thatRNA8 contains the highly conserved 790 loop and interacts withboth the 39 end of SSUA and the 59 end of SSUB (Figure 2). It hasfive category 2 base pairs.Assignment of RNA17 to SSU rRNA was based upon the factsthat RNA17 and the T. parva homologue both contain a sequencethat is very similar to E. coli SSU rRNA positions 282–294 andthat they contain H289 (Figure 2). RNA12 has the potential tointeract with RNA17, providing the remainder of H240 and atruncated H122 (Figure 2). We have paired the central region ofRNA19 with RNA9 to form the lower half of H1047. RNA17 hasone category 2 covariation; RNA12 and RNA19 have nocovariation. The 39 portion of RNA5 has the potential to basepairwith SSUD and together they may comprise H1303. The 59portion of RNA5 has the capacity to form an extended helix andlarge loop; sequences in the proposed helical regions are well-conserved among Plasmodium species but the 22 nt loop regionvaries in both size and sequence (Table S3). Note that since wehave not yet found T. parva homologues for RNA5, RNA12, orRNA19, assignment of these transcripts to SSU rRNA should beconsidered tentative.RNA2 and RNA11 correspond to portions of the 59 half of LSUrRNA (Figure 3). RNA2 approximately spans E. coli LSU positions944 through 1010, encompassing helices H946, H976 and the 59strand of H991. RNA11 pairs with RNA2, providing the 39 strandof H991. It also forms helix H1164 and pairs with LSUA in H812.RNA2 consists of two hairpins with loop sequences that are verysimilar to their E. coli counterparts. The T. parva homologue wasdetected because the single-stranded loop sequences are identicalto those of P. falciparum. Assignment of RNA11 was accomplishedby searching the mt genomes for the conserved sequence GGUAbetween H1164 and H812, followed by a sequence that could pairwith the appropriate region of LSUA. Candidate sequences werethen manually screened for the presence of a hairpin immediatelyupstream of the GGUA and for the potential to interact withRNA2. Here again the base-pairing potential for these two RNAswas better for the T. parva homologues than for P. falciparum,providing confirmation of our structure predictions for the knownP. falciparum transcripts. RNA1 was previously assigned [4] but wehave revised its interactions. The 59 end of RNA1 basepairs withthe 39 end of RNA11, forming H1196. RNA1 also forms H579with the 59 end of LSUA, encompasses H1276, and basepairs withRNA3. It was not possible to predict a structure for the 39 end ofRNA1 or the 59 end of RNA3. Of the 34 inter and intra base pairsin RNA2, RNA11, and RNA1, six are category 1, and six arecategory 2 (Figure S10; Table S8).P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 9 June 2012 | Volume 7 | Issue 6 | e38320
  • 10. Figure 3. LSU rRNA secondary structure (59 half.) The P. falciparum mt LSU rRNA (59 half) secondary structure model is superimposed onto theE. coli LSU rRNA (59 half) secondary structure model diagram. Regions where P. falciparum has no structure equivalent to E. coli are shown using grayP. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 10 June 2012 | Volume 7 | Issue 6 | e38320
  • 11. Part of the 59 half of RNA3 forms a helix with the 39 half ofRNA1 to form H1295 (Figure 3). RNA3 also bridges the 59 half tothe 39 half of the LSU rRNA (Figures 3, 4). Part of the 39 half ofRNA3 forms the 59 strand of the H1648 helix, while the middlesection of LSUE forms the 39 half of this helix (Figure 4). RNA3 ishighly conserved among the Plasmodium species, varying in only 3–5 sites, and the helical region is 100% conserved for both RNA3and LSUE. The corresponding T. parva sequence (Table 1)partially overlaps the previously predicted LSU5 rRNA of Kairoet al. [23] and provides compensating base change evidence insupport of the proposed interactions. While no covariations exist inthe seven basepairs in H1295 (RNA3/RNA1), two category 1 andthree category 2 basepairs occur in the 15 basepairs in H1648(Figures S10, S11; Table S8).RNA13 is also assigned to the 39 half of LSU rRNA andcorresponds to the previously proposed LSU2 RNA in T. parva[23]. This is a short but highly conserved sequence with only onedifference among the Plasmodium species, at the 39 end. Thefragment corresponds to E. coli sequences from ,2236–2264. The59 end forms a shortened helix H2077 with the 39 end of LSUEand also encompasses helix H2246 (Figure 4). The sequence ofH2246 is identical among the Plasmodium species, includingdeparture from the consensus sequence at three of six highlyconserved positions in and adjacent to the loop. One category 2base pair occurs in the H2077 helix, and no covariations exist inH2246 (Figure S11; Table S8).Pairwise comparisons between the P. falciparum and T. parva mtgenomes and the E. coli rrnB operon also identified another shortconserved sequence (positions 4964–4981 in P. falciparum, 1518-1501 in T. parva) that resembles E. coli 23S rRNA positions 2687-2710, comprising a portion of H2675 (Figure 4). This 27 nt regionis identical in all 200 Plasmodium species except for one positioneach for P. juxtanucleare and P. fragile. RNA18 has been mapped tothis region by 59 and 39 RACE. No covariations occur from thatportion of RNA18 that forms a five base pair helix (Figure S11;Table S8).RNA6 is virtually identical in Plasmodium species (Table S3). The59 portion of RNA6 is assigned to part of the 39 strand of H2675,basepairing with RNA18 and RNA10 (Figure 4). Of the 20basepairs in RNA6 that interact with RNA18, RNA10, and itself,three are category 2 covariations (Figure S11; Table S8).We were unable to assign all of the RNA transcripts to specificregions of the SSU and LSU rRNAs. The 34 transcripts identifiedhere in P. falciparum (and previous analysis by Feagin andcolleagues [3,4,27,28,62]), plus the five additional transcriptsdetermined by Raabe et al. [29] are listed in Table 1. In total, forP. falciparum, 27 of the 34(39) transcripts have been assigned tospecific regions of the rRNAs. The other hemosporidians havesuch well-conserved mt genomes relative to P. falciparum that wepredict they will have corresponding RNAs. Twenty-six RNAshave been predicted for T. parva (Table 1) and similar RNAs arepredicted to exist for the other piroplasms. Similarly, 20 regionscorresponding to RNA fragments have been identified in the mtgenome of the coccidian, Eimeria (Table S7).Composition of the P. falciparum mt SSU rRNAThe rRNA secondary structures are typically compared to thoseof E. coli, as those are the most studied examples. Significantportions of the SSU and LSU rRNAs primary, secondary, andthree-dimensional structural elements are conserved in all knownrRNAs. The conservation secondary structure diagrams availableat the Gutell lab’s Comparative RNA Web (CRW) Site [http://www.rna.ccbb.utexas.edu/SAE/2B/ConsStruc/] reveal that themt rRNAs are, as a group, much more variable than the rRNAswithin the Archaea, Bacteria, nuclear-encoded Eucarya, andchloroplasts. The mt SSU and LSU rRNAs usually have fewernucleotides than bacterial rRNAs (Table 2). The mt rRNAs of C.elegans are contiguous and highly minimized [36,55], with its SSUrRNA and LSU rRNAs being just slightly smaller than theaggregate size of the P. falciparum mt rRNAs. The correspondenceof the P. falciparum and C. elegans mt rRNAs to each other, and to E.coli rRNAs, is indicated in Table S9.Twelve RNA fragments have similarity to regions of SSU rRNA(Table 1, Figure 2). The assignments differ slightly from what wepreviously proposed [4], reflecting the refinement possible withmapped as opposed to predicted RNA ends, as well as addition ofnew transcripts identified in this study. RNA8 better matches the790 loop than did RNA4, which is now unassigned and RNA5rather than RNA9 is assigned to the 59 strand of H1303. Together,the twelve fragments assigned to SSU rRNA total 804 nt.The P. falciparum mt rRNAs and the C. elegans mt rRNAs aretruncated in all of the major structural domains in the SSU andLSU rRNAs. P. falciparum SSU rRNA contains helices (H27, H39),the 530 loop region (helices H500, H505, H511), and H122,H240, and H289 in domain I (Figure 2; Table S9), though muchof domain I is missing. The C. elegans mt SSU rRNA also lacks alarge portion of domain I. It shares with P. falciparum the well-conserved helices in H27, H39, H500, H505 and H511. It lacksH122, H240, and H289 but, unlike P. falciparum, the C. elegans mtSSU rRNA has helices H9 and H17. The apex of the 530 loopforms a pseudoknot helix with a few nucleotides in the bulge loopbetween helices H500 and H511 [72,73], but the pseudoknot inboth P. falciparum and C. elegans lack strong basepairing potential.This is common among mt rRNAs, however [55]. The 530 loop isone of the most conserved regions of rRNA in both sequence andhigher order structure. It is well conserved in the mt rRNA ofPlasmodium, and closely related species of other hemosporidians,coccidians, and piroplasms.P. falciparum and C. elegans SSU rRNAs both include helicesH567, H577, H769, and H885 in domain II of the SSU rRNA(Figure 2; Table S9). While P. falciparum has H821, C. elegans doesnot, and C. elegans has part of H673 and H722 while P. falciparumapparently does not have these helices. The 790 loop, the cap ofthe helix H769, is highly conserved in all known rRNAs, includingP. falciparum.Domain III is the most well-represented part of the P. falciparummt SSU rRNA, and there is good correspondence between P.falciparum and C. elegans (Figure 2; Table S9). This domain containshelices H921, H939, H944, H960, H984, H1047 (only part of it ispresent in P. falciparum), H1303 (with a putative extra helix incircles and lines. Colored nucleotides compare the P. falciparum sequence to the Three Phylogenetic Domains/Two Organelles (aka 3P2O) consensussequence from the Gutell lab’s Comparative RNA Web (CRW) Site [URL for CRW Site: http://www.rna.ccbb.utexas.edu/. URL for 23S rRNA (59 half)conservation diagram: http://www.rna.ccbb.utexas.edu/SAE/2B/ConsStruc/Diagrams/cons.23.3.3DOM.5.pdf]. Upper case colored nucleotides areconserved in at least 98% of the sequences used. For the P. falciparum mt rRNA fragments: red nucleotides match the 3P2O consensus sequence,light blue nucleotides differ, and black nucleotides cannot be compared to the consensus (which is conserved at less than 90%). Base pair symbolsare colored when both of the paired nucleotides have the same color. Each fragment is labeled at its 59 and 39 ends. Each helix present in P.falciparum is labeled with its helix number in green (e.g., H500), based on the CRW Site’s helix numbering system [URL: 23S rRNA 59 half, http://www.rna.ccbb.utexas.edu/CAR/1A/Structures/h.235.b.E.coli.hlxnum.pdf]. Inset: C. elegans mt LSU rRNA (59 half) secondary structure model.doi:10.1371/journal.pone.0038320.g003P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 11 June 2012 | Volume 7 | Issue 6 | e38320
  • 12. Figure 4. LSU rRNA secondary structure (39 half.) The P. falciparum mt LSU rRNA (39 half) secondary structure model is superimposed onto theE. coli LSU rRNA (39 half) secondary structure model diagram. Regions where P. falciparum has no structure equivalent to E. coli are shown using graycircles and lines. Colored nucleotides compare the P. falciparum sequence to the Three Phylogenetic Domains/Two Organelles (aka 3P2O) consensussequence from the Gutell lab’s Comparative RNA Web (CRW) Site [URL for CRW Site: http://www.rna.ccbb.utexas.edu/. URL for 23S rRNA (39 half)conservation diagram: http://www.rna.ccbb.utexas.edu/SAE/2B/ConsStruc/Diagrams/cons.23.3.3DOM.3.pdf]. Upper case colored nucleotides areconserved in at least 98% of the sequences used. For the P. falciparum mt rRNA fragments: red nucleotides match the 3P2O consensus sequence,light blue nucleotides differ, and black nucleotides cannot be compared to the consensus (which is conserved at less than 90%). Base pair symbolsare colored when both of the paired nucleotides have the same color. Each fragment is labeled at its 59 and 39 ends. Each helix present in P.falciparum is labeled with its helix number in green (e.g., H500), based on the CRW Site’s helix numbering system [URL: 23S rRNA 39 half, http://www.rna.ccbb.utexas.edu/CAR/1A/Structures/h.233.b.E.coli.hlxnum.pdf]. Inset: C. elegans mt LSU rRNA (39 half) secondary structure model.doi:10.1371/journal.pone.0038320.g004P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 12 June 2012 | Volume 7 | Issue 6 | e38320
  • 13. P. falciparum), H1350, H1399 (truncated in both P. falciparum andC. elegans), and H1506.Despite roughly similar sizes, the C. elegans mt SSU rRNAincludes portions of domains I and II that are not represented inthe P. falciparum mt SSU rRNA model. Two of these helices, H9and H17, are present in all known SSU rRNAs. This suggests thatsome of the unassigned small RNAs may correspond to thoseregions. However, while the Plasmodium RNA sequences are highlyconserved relative to each other, there is insufficient conservationto the specific regions of the SSU rRNA to assign the remaining P.falciparum RNAs with confidence.Composition of the P. falciparum mt LSU rRNASeven LSU rRNA fragments, LSUA-LSUG, were originallypredicted based on sequence similarities to other rRNAs [3].Later, two additional LSU rRNA fragments were identified,RNA1 and RNA10. [4] In this paper, we report identification oftranscripts for LSUB and LSUC, and assignment of RNA2,RNA3, RNA6, RNA11, RNA13, and RNA18 to LSU rRNA. Allof these fragments have corresponding sequences in the T. parva mtgenome (Table 1). The P. falciparum mt LSU rRNA currently has15 small RNAs assigned, ranging from 23 to 190 nt long.Together, they total 1233 nt.The 59 half of the LSU rRNA secondary structure issignificantly reduced in both P. falciparum and C. elegans relativeto E. coli (Figure 3; Table S9). Domain I is missing from both.Helix H563 is between domains I and II in the LSU rRNA and ispresent in C. elegans. Domain III is truncated and unmodelled in C.elegans while P. falciparum has the domain III helix H1295, andH1276, a helix between domains II and III.LSUA, LSUB, LSUC, RNA2, and RNA11 are all assigned todomain II of LSU rRNA, as is part of RNA1. As noted above,LSUB and LSUC are assigned to the GTPase center, forminghelices H1057, H1087, and H1082 respectively. While nearly allof the sequence deletions relative to the E. coli rRNAs occur at theperipheral ends of an existing structural domain, two deletions,both in the LSU rRNA, occur internally. One example of this typeof deletion occurs in the helix that links the H991 helix to theGTPase center (Figure 3). Helices H1011 and H1030 aresignificantly truncated in animal mt genomes [55]. For the C.elegans mt LSU rRNA, a few base pairs are predicted for H1030 atthe top of the stem, with unpaired nucleotides bridging the gapbetween the GTPase center and the multi-stem loop below H991.In P. falciparum, RNA2 and RNA11 basepair to form the basalhelix in the stem (H991) but there is no interaction (i.e., noticeablebasepairing potential) between these RNAs and the GTPase centerRNAs, LSUB and LSUC. Indeed, while each of the latter canform an intramolecular helix and can potentially interact witheach other by forming an extended helix H1082 (not present in C.elegans), they are so small that there is no obvious capacity for themto interact with any of the other small RNAs. We hypothesize thatthe GTPase center RNAs are maintained in proper position byinteractions with ribosomal proteins. RNA2 is also assigned toH946 and H976, neither of which is included in the C. elegansstructure. RNA11 is also assigned to H1164 and provides the 39half of the H812 helix while the 59 half of H812 is derived fromLSUA. H1196 is shortened in P. falciparum. In contrast, C. eleganslacks H1164 and H1196 is also truncated. RNA1 is assigned at thejunction of domains II and III, having a strongly conserved AGUAsandwiched between dinucleotides that conserve long-distancebasepairing to domain IV.The 39 half of the LSU rRNA secondary structure is the mostfully represented region, compared to E. coli, for both C. elegans andP. falciparum (Figure 4; Table S9). Parts of Domain IV interact withtRNA and the 30S ribosomal subunit. LSUD and LSUE providemost of domain IV, with RNA3 assigned to one side of helixH1648, the other side being provided by LSUE. There is no C.elegans sequence corresponding to RNA3. A set of adjacent helices(H1682, H1707, and H1752) are missing from both species andhelix H1835 is reduced in C. elegans and P. falciparum to a third thesize in E. coli. Helix 1792 is similar in size in E. coli and P. falciparumbut reduced by half in C. elegans. Other features of domain IV aremaintained in structure and sequence conservation. LSUD andLSUE are separate RNAs in P. falciparum despite the fact that theydirectly abut each other in the P. falciparum mt genome. These twosequences have been found on the same transcript in T. parva(RNA1 of Kairo et al. [23]), but it is possible that this represents aprecursor of LSUD and LSUE. Such a precursor RNA containingLSUD and LSUE is detected in P. falciparum by RNase protection(Mericle and Feagin, unpublished results) and by RT-PCR [62].Structural features of domain V are also strongly conservedbetween P. falciparum and C. elegans, which show similar variancefrom E. coli (Figure 4). Both are missing the L1 binding domain(H2112, H2113, H2117, H2120, and H2127) and the underlyingH2093 and H2200 helices. The 5S rRNA binding domain (helicesH2283–H2372) is deleted in both C. elegans and P. falciparum. Thebulk of domain V, including the peptidyltransferase center, isintact and well-conserved, comprised of LSUE, LSUF, andLSUG.The most conserved feature of domain VI is the sarcin ricinloop at the tip of the H2646 helix. This hairpin loop is conservedacross all 3P2O LSU rRNA genes, including the P. falciparum mtRNA10 fragment (Figure 4). The initial 13 nt of RNA10 areidentical among Plasmodium species and hemosporidians but havenot been assigned to a structure. The next 38 nt are variableacross Plasmodium species and include alignment gaps but withinthe more closely related subgroups, conservation is strong (FigureS1). Regardless of the variation, this sequence can form a longhelix (Figure 4; 17 basepairs with an AAUU tetraloop in P.falciparum). There is no corresponding structure in C. elegans or E.coli but one has been proposed in the mt rRNA of thedinoflagellate Karlodinium micrum [74]. If a similar hairpin existsin T. parva RNA10, it is much shorter and significantly less stable.The 39 end of RNA10 and the 59 end of RNA18 comprise the 59strand of H2675. The 39 end of RNA18 continues to begin the 39strand of H2675, and the rest of this strand is present in the 59 endof RNA6 which continues to form H2735. Domain VI is alsotruncated in C. elegans, with strong correspondence in the regionsthat are present and absent in P. falciparum.Table 2. Relative sizes of mt rRNAs.Organism SSUaLSUatotal AccessionCaenorhabditis elegans mt 697 953 1650 NC_001328.1Leishmania tarentolae mt 610 1173 1783 NC_000894.1Plasmodium falciparum mtb804 1233 2037 M76611.1Homo sapiens mt 954 1559 2513 NC_012920.1Polytomella mtb979 1556 2535 NC_010357.1Chlamydomonas reinhardtii mtb1200 2419 3619 NC_001638.1Reclinomonas americana mt 1595 2751 4346 NC_001823.1Escherichia coli 1541 2904 4445 NC_000913.2asizes are cited in nt.brRNAs are fragmented.doi:10.1371/journal.pone.0038320.t002P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 13 June 2012 | Volume 7 | Issue 6 | e38320
  • 14. As with the SSU rRNA, it is tempting to speculate that theregions in C. elegans mt LSU rRNA that are missing from theassigned RNAs for the P. falciparum mt LSU rRNA are among theunassigned RNAs.As noted above, our confidence in the placement of the RNAfragments onto the SSU and LSU rRNA secondary structures isaugmented with covariations between the two nucleotides thatform basepairs. Covariation analysis facilitates the identification ofthe base pairs in an RNA secondary structure that are similaramong the sequences in the alignment dataset. When thealignments juxtapose similar structural units in each column,and they are properly interpreted with covariation analysis, thepredicted structure is nearly 100% accurate [75]. Two different P.falciparum datasets were analyzed for positional covariations. Thefirst compares the RNAs with conservation of the 3P2O dataset.Nucleotides that are conserved in 90–98% of the 3P2O dataset inFigures 2, 3, 4 are shown as a lower case red or blue letter, andthose nucleotides conserved in 98–100% of the same 3P2O datasetare shown as an upper case red or blue letter. Red indicates thatthe P. falciparum sequence is the same as the conserved 3P2Osequence while blue indicates that it is different. Seven base pairsin the SSU and LSU rRNAs secondary structure diagrams haveboth nucleotides colored blue indicating that the P. falciparumsequence has covariation at some of the most conservednucleotides in the rRNA (Figures 2, 3, 4).The second dataset contains the predicted mt rRNAs of 218species of Plasmodium species and related apicomplexans. Thesecovariations are shown on the SSU and LSU secondary structurediagrams (Figures S9, S10, S11; Table S8). The total number ofbase pairs that have a covariation between the two pairednucleotides are: SSU rRNA, 10 category 1 and 21 category 2;LSU rRNA, 42 category 1 and 39 category 2; total rRNA, 52category 1 and 60 category 2. While several helices do not haveany covariations, the majority of the helices contain at least one.Thus, we are very confident that the majority, if not all, of the P.falciparum fragments, have been accurately mapped to the rRNAsecondary structure. An analysis of a more diverse collection ofapicomplexan mt genomes and their RNA transcripts wouldfurther evaluate the accuracy of fragment mapping to the rRNAsin this manuscript, and likely facilitate the placement of a few morefragments.Predicted Structure of the P. falciparum mt RibosomeIn recent years, the crystal structures of large and smallribosomal subunits and of whole ribosomes have been obtainedfrom several sources, greatly refining our understanding ofribosome function during protein synthesis. Of particular interestto the work reported here is structural data from the C. elegans mtribosome [36,55]. Like P. falciparum, C. elegans has highlyminimized rRNAs and as discussed above, the P. falciparum mtrRNA fragments correspond closely to the C. elegans mt rRNAs. Mtribosomes have a larger protein to RNA ratio but the polypeptideexit tunnel is still lined entirely with RNA [34]. While nothing isspecifically known about the protein content of P. falciparum mtribosomes, all of the RNA sequences that comprise the lining ofthe C. elegans mt ribosome polypeptide exit tunnel are representedin the RNAs that have been mapped to the 39 portion of P.falciparum mt LSU rRNA.The high-resolution three-dimensional crystal structures of the30S [31] and 50S [30] ribosomal subunits revealed that thecomparative secondary structure models for the SSU and LSUrRNA were 97–98% accurate [75]. These crystal structures alsorevealed the detailed three-dimensional folding of the secondarystructure. We wanted to determine if the fragments of P. falciparumrRNA are close together in three-dimensional space and if theywere at the known functional sites of the ribosome in proteinsynthesis. All of the fragments that have been assigned to the SSUand LSU rRNA secondary structure (Figures 2, 3, 4) were mappedonto the three-dimensional structure of the ribosome (Figure 5A–E; full-page versions in Figures S12, S13, S14, S15, S16). Thesefigures reveal that indeed nearly all of the P. falciparum rRNAfragments map to the regions of the ribosome known to be directlyinvolved in protein synthesis.DiscussionThe P. falciparum mt genome encodes 34 small RNAs, 27 ofwhich have been assigned as parts of fragmented LSU and SSUrRNAs. Compared to other fragmented rRNAs, the number ofseparate RNAs is much larger while the fragments are far smaller,some containing only 23 nt. Are these tiny RNAs in fact part offunctional ribosomes? Considerable data now supports thishypothesis.Some of the Plasmodium mt rRNA fragments were first proposedbecause of sequence similarities to rRNA regions [3,20,76]. A keyissue became whether the predicted rRNAs corresponded to realtranscripts. For a few, the answer was no [4], but the small RNAsdiscussed here are, by definition, transcribed. The mt genome ispolycistronically transcribed [62]; larger presumed precursorRNAs can be detected by RNase protection [62], RT-PCR[62], and in 39 and 59 RACE analysis (this work). The small RNAspersist in the cell while non-coding mt sequences appear to berapidly degraded, based on our inability to detect them other thanby RT-PCR of presumed precursor transcripts.The small RNAs are highly conserved across species andbetween genera. Comparison of the mt genomes of 26 Plasmodiumspecies shows strong conservation of nucleotide sequence for thesmall RNAs, to the degree seen for amino acid sequences of thethree mt protein coding genes (Table S3). Mt genome sizedifferences between the Plasmodium species predominantly reflectaddition or deletion of sequences in non-coding regions or atjunctions between RNAs. Sequences corresponding to many of theP. falciparum rRNA fragments can be found in mt genomes of otherapicomplexans (Table 1; Table S3); some of them have beenconfirmed as transcripts for T. parva [23]. Analysis of dinoflagellatemt sequences has provided evidence that they also have highlyfragmented mt rRNAs [74,77,78]. It has so far been impossible tostrictly define the genetic content of the dinoflagellate mt genome.It typically exists as multiple genome molecules carrying differingcombinations of the mt genome, including different pseudogenesfor the protein coding genes cob, cox1 and cox3. These often showterminal deletions as if the individual DNAs are subject to a highrate of recombination. The complex nature of dinoflagellate mtgenomes means that none can be considered complete. However,sequences corresponding to rRNAs have been reported for severalspecies. Those described to date correspond to some of the best-conserved P. falciparum mt rRNA fragments, not only in the generalidentity of the region but also the size and fragmentation pattern.Dinoflagellates are close relatives to apicomplexans so these datasuggest that the alveolate that is ancestral to both groups alsopossessed fragmented mt rRNAs.Seven of the small RNAs have not been assigned to regions ofrRNA. Their characteristics are otherwise similar to the rRNAfragments, however. They are highly conserved among Plasmodiumspecies, are in a similar size range, and have non-encoded oligo(A)tails. We hypothesize that at least some, perhaps all, of themcorrespond to regions that are less well-conserved among rRNAs,especially regions present in the C. elegans mt rRNA but missingP. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 14 June 2012 | Volume 7 | Issue 6 | e38320
  • 15. P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 15 June 2012 | Volume 7 | Issue 6 | e38320
  • 16. from P. falciparum rRNAs. The greatest discrepancies betweenP. falciparum and C. elegans lie in SSU rRNA, suggesting that anumber of the unassigned RNAs have a role there. However,alternative scenarios cannot be ruled out, including possible non-rRNA functions. In that regard, it is important to note that none ofthe small RNAs has a size or potential secondary structuresuggestive of tRNAs.Mt rRNAs are often small compared to bacterial rRNAs butcontain key regions important to function. When arrayed inpositions corresponding to the secondary structure of canonicalrRNAs, the P. falciparum mt rRNA fragments correspond quite wellto regions present in other small mt rRNAs. In particular,correspondence to the very small C. elegans mt rRNAs is quite high.All of the rRNA fragments are predicted to basepair with at leastone additional rRNA, creating interactions that should help keepthe individual RNAs properly located and oriented. Mt ribosomalproteins likely play a key role in maintaining the relationships ofthe RNAs to each other since the interactions expected betweensome fragments are limited.Arraying the rRNA fragments in a 3-D model furthersubstantiates the picture of a small but functional ribosome withthe rRNA fragments clustered mostly on the interface betweensubunits. The critical point is that nearly all regions of therRNAs that are associated with protein synthesis/function arepresent in the Plasmodium mt rRNAs. Despite their unconven-tional characteristics, they appear likely to function convention-ally once assembled into ribosomes. How that is mediated andthe role of the unassigned fragments both remain to bedetermined.Materials and MethodsParasitesThe C10 clone of P. falciparum was grown in vitro by themethod of Trager and Jensen [79]. Parasites were harvested bysaponin lysis of infected red cells, followed by centrifugation andwashing. Harvested cells were quick-frozen in liquid nitrogen andstored at 280uC until use.DNA AnalysisComplete mt DNA sequences from 25 Plasmodium species andan isolate from a mandrill, plus eight other hemosporidians (TableS1) were aligned in the AlignX program of Vector NTi X10 usingthe Clustal W function, and manually revised as needed toconform to the mapped 59 and 39 ends of P. falciparum RNAs.Using this alignment, the sequence conservation relative to P.falciparum was determined in each species for each of the smallRNAs and for the intergenic regions. Intergenic regions showingan average conservation of ,90% or better were examined onboth DNA strands for the presence of additional small RNAs byRNA blotting.RNA Preparation and AnalysisTotal RNA was prepared as previously described [4] by theacid-guanidinium-phenol-chloroform method of Chomzynski andSacchi [80] or with Trizol (Invitrogen). RNA blots were preparedand analyzed as previously described [4,61]. Briefly, total RNAwas electrophoresed on 12%, 16%, or 20% acrylamide, 7 Murea gels in TBE (0.1 M Tris-borate, 0.9 mM EDTA, pH 8.3)and electrophoretically transferred to nylon membrane in TAE(40 mM Tris-acetate, 1 mM EDTA, pH 8.2). Probes for theRNA blots were [32P]-labeled in vitro transcripts complementaryto the gene or [32P]-end-labeled oligonucleotides, with hybrid-ization and wash conditions as previously described for similarprobes [4]. Primer extension experiments were performed aspreviously described [81], using unlabeled oligonucleotideprimers (Table S4) and Superscript reverse transcriptase (Invitro-gen) in the presence of [a-32P] dATP. 39 RACE was employed todetermine the 39 end of the transcripts. Total RNA was treatedwith DNase I (Pharmacia/Amersham) in the presence of RNasin(Promega), followed by the addition of a 39 C tail with poly(A)polymerase (Invitrogen), as previously described [28]. First strandcDNA was prepared using an oligo(dG) primer(CGGGATCCGGGGGGGGGGGG) and Superscript reversetranscriptase. It was then PCR amplified using Pfx Platinumpolymerase (Invitrogen), with the oligo(dG) primer and a gene-specific 59 primer (Table S4) for each rRNA fragment. PCRconditions were 2 min at 95uC, followed by 4 repetitions of 30seconds at primer-specific annealing temperature, one min at72uC, 15 sec at 95uC, then 29 repetitions of the same with theannealing temperature raised to 58uC, and finally 10 min at72uC. For 59 RACE, first strand cDNA was prepared with gene-specific primers, a C tail was added to the cDNA using terminaldeoxynucleotidyl transferase, and PCR was carried out using anested gene-specific primer and the oligo(dG) primer. For someRNAs, the size or sequence of the transcripts precluded making anested primer so the cDNA primer was used for PCR as well,with mixed success. The PCR products were cloned into thepGEM T-EZ vector (Promega) and sequenced using an AppliedBiosystems 3730XL Genetic Analyzer.Assignment of P. falciparum mt Transcripts to Regions ofrRNA Secondary Structure ModelsThe P. falciparum and T. parva mt genome sequences were re-analyzed by performing pairwise BLAST comparisons [82]between these two sequences and between each of these andthe E. coli rrnB operon [83]. Mt rRNA homologs detected in thisway were then manually folded to fit the E. coli secondarystructure models (http://www.rna.ccbb.utexas.edu/) [55], takingthe P. falciparum transcript mapping data into consideration. TheSpin program of the Staden package [84] was then used to assigntranscripts to "missing" regions of the secondary structures; wesearched for short stretches of sequence that are known to beconserved among other rRNAs (see structure conservationdiagrams at the CRW Site). In some searches, we also includedquery sequences that were predicted by the base pairing partnersequence contained within other rRNA fragments that werealready assigned to the secondary structure models.Figure 5. rRNA tertiary structure. The P. falciparum mt rRNAs are superimposed on a space-filling model of the three dimensional rRNA structure.Each individual P. falciparum rRNA fragment is colored and labeled; regions of the model with no P. falciparum equivalent are colored gray.Functional regions of the rRNAs are labeled in black. Full-page versions of each panel are available as Figures S12–S16. (A) P. falciparum SSU rRNAsuperimposed on Thermus thermophilus (PDB ID 1J5E; left = front/interface side, right = back); (B) P. falciparum LSU rRNA superimposed onHaloarcula marismortui (PDB ID 1S72; left = crown/interface side, right = back); (C–E) secondary structure diagrams for SSU, 59 LSU, and 39 LSUrRNAs, respectively, with each P. falciparum mt rRNA fragment color-coordinated with the fragment colors in the three-dimensional structure.doi:10.1371/journal.pone.0038320.g005P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 16 June 2012 | Volume 7 | Issue 6 | e38320
  • 17. 3D ModelThe computer program RasMol [85] and its scripting languagewere used to color the regions of the SSU and LSU rRNA that areassociated with the P. falciparum rRNA fragments.Accession NumbersAccession numbers for sequences are found in Table S1. Allare mitochondrial genome sequences from apicomplexan para-sites.Supporting InformationFigure S1 RNA10 variation among Plasmodium species.The sequence of P. falciparum RNA10 is shown in the top line, andthe sarcin ricin loop sequence is indicated with a horizontalbracket. For the other Plasmodium species, positions that differ fromP. falciparum are indicated with letters. Bases shown in red areconserved in all Plasmodium species., conserved relative to P.falciparum; -, no corresponding nucleotide.(TIF)Figure S2 Identification of P. falciparum mitochondrialGTPase center rRNAs. (A) The predicted secondarystructures of the most conserved portions of the P. falciparummt sequence corresponding to the GTPase center are shown.Strongly conserved nt are shown in color, with lower caseindicating 90%+ and upper case indicating 95%+ conservationamong three domains and two organelles. Red nt in the P.falciparum sequence match the consensus and the blue nt differsfrom consensus. Open circles are placeholders to indicate thestructure of a conventional GTPase center. These sequences areidentical among 26 different species of Plasmodium, with theexception of the single position in LSUB that varies from overallconsensus. (B) Total P. falciparum RNA was electrophoresed ondenaturing 7M urea, 20% acrylamide gels, electrophoreticallytransferred to nylon membrane, and probed with radiolabeledoligonucleotides complementary to LSUB and LSUC (Table S4).Transcript sizes were determined using a ladder of small in vitrotranscripts as markers.(TIF)Figure S3 Small mitochondrial RNAs of P. falciparum.Total P. falciparum RNA was electrophoresed on denaturing 7Murea, 12% acrylamide gels, electrophoretically transferred to nylonmembrane, and probed with radiolabeled sequences (Table S4)complementary to rDNA regions from the P. falciparum mtgenome. Transcript sizes were determined using a ladder of smallin vitro transcripts as markers. The identities of transcripts shownon the same panel (RNA11, SSUD) were separately establishedwith oligonucleotide probes. Abbreviations are as shown forFigure 1.(TIF)Figure S4 LSUF analysis. (A) Total P. falciparum RNA waselectrophoresed on denaturing 7M urea, 12% acrylamide gels,electrophoretically transferred to nylon membrane, and probedwith a radiolabeled in vitro transcript complementary to LSUF.Transcript sizes, given in nt, were determined using a ladder ofsmall in vitro transcripts as markers. (B) Total P. falciparum RNA(10 ng/lane) was incubated with an unlabeled oligonucleotideprimer and Superscript reverse transcriptase (Invitrogen) in thepresence of [a-32P] dATP. The products were electrophoresed on7M urea, 12% acrylamide gels and exposed to film. Lanes 1–3,extensions were performed at 50uC, 55uC, and 60uC, respectively.The position of the transcript ends is indicated relative to the P.falciparum mt genome (Genbank M76611). (C) The P. falciparum mtsequence for nt 1501–1530 is shown. Vertical arrows indicate thetwo mapped 59 ends for LSUF. Lower case letters indicatepositions that vary among 200 P. falciparum sequences. The numberof hemosporidian species exhibiting the specific nt at each positionis given.(TIF)Figure S5 Mapping P. falciparum mt RNAs. Schematicrepresentations are shown for two regions of the P. falciparum mtgenome, with mapped RNAs indicated by boxes and the DNAsequence for transcript ends shown above the boxes. Transcripttermini are in bold, with the 59 nt italicized and the 39 ntunderlined. The nt position in the genome is located above eachterminus.(TIF)Figure S6 Proposed secondary structure for T. parva mtSSU rRNA. The T. parva mt SSU rRNA secondary structuremodel is superimposed onto the E. coli SSU rRNA secondarystructure model diagram. The transcript ends shown are artificial,based on the extent of sequence similarity between the mapped P.falciparum RNAs, and the T. parva mt DNA sequence, or thecapacity to form expected secondary structure.(TIF)Figure S7 Proposed secondary structure for T. parva mtLSU rRNA (59 half). The T. parva mt LSU rRNA (59 half)secondary structure model is superimposed onto the E. coli LSUrRNA (59 half) secondary structure model diagram. The transcriptends shown are artificial, based on the extent of sequencesimilarity between the mapped P. falciparum RNAs, and the T.parva mt DNA sequence, or the capacity to form expectedsecondary structure.(TIF)Figure S8 Proposed secondary structure for T. parva mtLSU rRNA (39 half). The T. parva mt LSU rRNA (39 half)secondary structure model is superimposed onto the E. coli LSUrRNA (39 half) secondary structure model diagram. The transcriptends shown are artificial, based on the extent of sequencesimilarity between the mapped P. falciparum RNAs, and the T.parva mt DNA sequence, or the capacity to form expectedsecondary structure.(TIF)Figure S9 Location of type 1 and 2 covariations in SSUrRNA. The P. falciparum mt SSU rRNA secondary structuremodel, shown in thick gray lines, is superimposed onto the E. coliSSU rRNA secondary structure model diagram. Regions where P.falciparum has no structure equivalent to E. coli are shown usinggray circles and lines. Category 1 covarying pairs are indicatedwith red and category 2 with blue.(TIF)Figure S10 Location of type 1 and 2 covariations in LSUrRNA (59 half). The P. falciparum mt LSU rRNA (59 half)secondary structure model, shown in thick gray lines, issuperimposed onto the E. coli LSU rRNA (59 half) secondarystructure model diagram. Regions where P. falciparum has nostructure equivalent to E. coli are shown using gray circles andlines. Category 1 covarying pairs are indicated with red andcategory 2 with blue.(TIF)Figure S11 Location of type 1 and 2 covariations in LSUrRNA (39 half). The P. falciparum mt LSU rRNA (39 half)secondary structure model, shown in thick gray lines, issuperimposed onto the E. coli LSU rRNA (39 half) secondaryP. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 17 June 2012 | Volume 7 | Issue 6 | e38320
  • 18. structure model diagram. Regions where P. falciparum has nostructure equivalent to E. coli are shown using gray circles andlines. Category 1 covarying pairs are indicated with red andcategory 2 with blue.(TIF)Figure S12 SSU rRNA tertiary structure. The P. falciparummt SSU rRNAs are superimposed on a space-filling model of thethree dimensional rRNA structure of Thermus thermophilus (PDB ID1J5E; left = front/interface side, right = back). Each individual P.falciparum rRNA fragment is colored and labeled; regions of themodel with no P. falciparum equivalent are colored gray. Functionalregions of the rRNAs are labeled in black. (Full page version ofFigure 5A.)(TIF)Figure S13 LSU rRNA tertiary structure. The P. falciparumLSU rRNA is superimposed on a space-filling model of the threedimensional rRNA structure of Haloarcula marismortui (PDB ID1S72; left = crown/interface side, right = back). Each individualP. falciparum rRNA fragment is colored and labeled; regions of themodel with no P. falciparum equivalent are colored gray. Functionalregions of the rRNAs are labeled in black. (Full page version ofFigure 5B.)(TIF)Figure S14 P. falciparum mt SSU rRNAs color-coded totertiary structure. Secondary structure diagram for P.falciparum mt SSU rRNA with each P. falciparum mt rRNAfragment color-coordinated with the fragment colors in theThermus thermophilus three-dimensional structure (Figure S12). (Fullpage version of Figure 5C.)(TIF)Figure S15 P. falciparum mt LSU rRNAs (59 half) color-coded to tertiary structure. Secondary structure diagram forP. falciparum mt LSU rRNA (59 half) with each P. falciparum mtrRNA fragment color-coordinated with the fragment colors in theHaloarcula marismortui three-dimensional structure (Figure S13).(Full page version of Figure 5D.)(TIF)Figure S16 P. falciparum mt LSU rRNAs (39 half) color-coded to tertiary structure. Secondary structure diagrams forP. falciparum mt LSU rRNA (39 half) with each P. falciparum mtrRNA fragment color-coordinated with the fragment colors in theHaloarcula marismortui three-dimensional structure (Figure S13).(Full page version of Figure 5E.)(TIF)Table S1 Mt genomes from Plasmodium species andrelated apicomplexans.(PDF)Table S2 Intergenic size variation among hemospor-idian mt genomes.(PDF)Table S3 Similarity of individual mt genes fromPlasmodium species relative to P. falciparum.(PDF)Table S4 Oligonucleotides used in this study.(PDF)Table S5 P. falciparum mt rRNA 39 end sequences.(PDF)Table S6 Abutted P. falciparum mt gene sets.(PDF)Table S7 Fragment placement in rRNA alignments forcovariation analysis.(PDF)Table S8 Prospective covariations found in fragmentedapicomplexan mt rRNA genes.(PDF)Table S9 Correspondence of P. falciparum and C.elegans mt rRNAs.(PDF)AcknowledgmentsThe authors thank Barbara Mericle, David Rehkopf, Tamara Reynolds,Caitlin Tolzmann, and Michelle Wurscher for excellent technicalassistance.Author ContributionsConceived and designed the experiments: JEF RRG. Performed theexperiments: JEF MIH JCL KJC BHS JJC GT MNS. Analyzed the data:JEF MIH JCL KJC BHS JJC GT MNS. Wrote the paper: JEF MNSRRG.References1. Feagin JE (1992) The 6 kb element of Plasmodium falciparum encodesmitochondrial cytochrome genes. Mol Biochem Parasitol 52: 145–148.2. Lang BF, Gray MW, Burger G (1999) Mitochondrial genome evolution and theorigin of eukaryotes. Annu Rev Genet 33: 351–397.3. Feagin JE, Werner E, Gardner MJ, Williamson DH, Wilson RJM (1992)Homologies between the contiguous and fragmented rRNAs of the twoPlasmodium falciparum extrachromosomal DNAs are limited to core sequences.Nucleic Acids Res 20: 879–887.4. Feagin JE, Mericle BL, Werner E, Morris M (1997) Identification of additionalrRNA fragments encoded by the Plasmodium falciparum 6 kb element. NucleicAcids Res 25: 438–446.5. Boer P, Gray MW (1988) Scrambled ribosomal RNA gene pieces inChlamydomonas reinhardtii mitochondrial DNA. Cell 55: 399–411.6. Heinonen TYK, Schnare MN, Young PG, Gray MW (1987) Rearranged codingsegments, separated by a transfer RNA gene, specify the two parts of adiscontinuous large subunit ribosomal RNA in Tetrahymena pyriformis mitochon-dria. J Biol Chem 262: 2879–2887.7. Schnare MN, Gray MW (1990) Sixteen discrete RNA components in thecytoplasmic ribosome of Euglena gracilis. J Mol Biol 215: 73–83.8. Schnare MN, Heinonen TYK, Young PG, Gray MW (1986) A discontinuoussmall subunit ribosomal RNA in Tetrahymena pyriformis mitochondria. J BiolChem 261: 5187–5193.9. Spencer DF, Collings JC, Schnare MN, Gray MW (1987) Multiple spacersequences in the nuclear large subunit ribosomal RNA gene of Crithidia fasciculata.EMBO J 6: 1063–1071.10. Turmel M, Boulanger J, Schnare MN, Gray MW (1991) Six group I introns andthree internal transcribed spacers in the chloroplast large subunit ribosomalRNA gene of the green alga Chlamydomonas eugametos. J Mol Biol 218: 293–311.11. White TC, Rudenko G, Borst P (1986) Three small RNAs within the 10 kbtrypanosome rRNA transcription unit are analogous to domain VII of othereukaryotic 28S rRNAs. Nucleic Acids Res 14: 9471–9489.12. Milbury CA, Lee JC, Cannone JJ, Gaffney PM, Gutell RR (2010)Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrialgenomes. BMC Genomics 11: 485.13. Evguenieva-Hackenberg E (2005) Bacterial ribosomal RNA in pieces. MolMicrobiol 57: 318–325.14. Okimoto R, Macfarlane JL, Clary DO, Wolstenholme DR (1992) Themitochondrial genomes of two nematodes, Caenorhabditis elegans and Ascaris suum.Genetics 130: 471–498.15. Sloof P, Van den Burg J, Voogd A, Benne R, Agostinelli M, et al. (1985) Furthercharacterization of the extremely small mitochondrial ribosomal RNAs fromtrypanosomes: a detailed comparison of the 9S and 12S RNAs from Crithidiafasciculata and Trypanosoma brucei with rRNAs from other organisms. NucleicAcids Res 13: 4171–4190.P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 18 June 2012 | Volume 7 | Issue 6 | e38320
  • 19. 16. de la Cruz VF, Lake JA, Simpson AM, Simpson L (1985) A minimal ribosomalRNA: Sequence and secondary structure of the 9S kinetoplast ribosomal RNAfrom Leishmania tarentolae. Proc Natl Acad Sci USA 82: 1401–1405.17. de la Cruz VF, Simpson AM, Lake JA, Simpson L (1985) Primary sequence andsecondary structure of the 12S kinetoplast (mitochondrial) ribosomal RNA fromLeishmania tarentolae: conservation of the peptidyl transferase structural elements.Nucleic Acids Res 13: 2337–2356.18. Payne M, Rothwell V, Jasmer DP, Feagin JE, Stuart K (1985) Identification ofmitochondrial genes in Trypanosoma brucei and homology to cytochrome c oxidasein two different reading frames. Mol Biochem Parasitol 15: 159–170.19. Suplick K, Morrisey J, Vaidya AB (1990) Complex transcription from theextrachromosomal DNA encoding mitochondrial functions of Plasmodium yoelii.Mol Cell Biol 10: 6381–6388.20. Vaidya AB, Akella R, Suplick K (1989) Sequences similar to genes for twomitochondrial proteins and portions of ribosomal RNA in tandemly arrayed 6-kilobase-pair DNA of a malarial parasite. Mol Biochem Parasitol 35: 97–108.21. Hikosaka K, Watanabe Y, Kobayashi F, Waki S, Kita K, et al. (2011) Highlyconserved gene arrangement of the mitochondrial genomes of 23 Plasmodiumspecies. Parasitol Int 60: 175–180.22. Dechering KJ, Kaan AM, Mbacham W, Wirth DF, Eling W, et al. (1998)Isolation and functional characterization of two distinct sexual-stage-specificpromoters of the human malaria parasite Plasmodium falciparum. Mol Cell Biol 19:967–978.23. Kairo A, Fairlamb AH, Gobright E, Nene V (1994) A 7.1 kb linear DNAmolecule of Theileria parva has scrambled rDNA sequences and open readingframes for mitochondrially-encoded proteins. EMBO J 13: 898–905.24. Hikosaka K, Watanabe Y, Tsuji N, Kita K, Kishine H, et al. (2010) Divergenceof the mitochondrial genome structure in the apicomplexan parasites, Babesiaand Theileria. Mol Biol Evol 27: 1107–1116.25. Lin RQ, Qiu LL, Liu GH, Wu XY, Weng YB, et al. (2011) Characterization ofthe complete mitochondrial genomes of five Eimeria species from domesticchickens. Gene 480: 28–33.26. Perkins SL, Austin CC (2009) Four new species of Plasmodium from New Guinealizards: integrating morphology and molecules. J Parasitol 95: 424–433.27. Rehkopf DH, Gillespie DE, Harrell MI, Feagin JE (2000) Transcriptionalmapping and RNA processing of the Plasmodium falciparum mitochondrialmRNAs. Mol Biochem Parasitol 105: 91–103.28. Gillespie DE, Salazar NA, Rehkopf DH, Feagin JE (1999) The fragmentedmitochondrial ribosomal RNAs of Plasmodium falciparum have short A tails.Nucleic Acids Res 27: 2416–2422.29. Raabe CA, Sanchez CP, Randau G, Robeck T, Skryabin BV, et al. (2010) Aglobal view of the nonprotein-coding transcriptome in Plasmodium falciparum.Nucleic Acids Res 38: 608–617.30. Ban N, Nissen P, Hansen J, Moore PB, Steitz TA (2000) The complete atomicstructure of the large ribosomal subunit at 2.4 A˚ resolution. Science 289: 905–920.31. Wimberly BT, Brodersen DE, Clemons WM, Morgan-Warren RJ, Carter AP, etal. (2000) Structure of the 30S ribosomal subunit. Nature 407: 327–339.32. Schluenzen F, Tocilj A, Zarivach R, Harms J, Gluehmann M, et al. (2000)Structure of functionally activated small ribosomal subunit at 3.3 angstromsresolution. Cell 102: 615–623.33. Yusupov MM, Yusupova GZ, Baucom A, Lieberman K, Earnest TN, et al.(2001) Crystal structure of the ribosome at 5.5 A resolution. Science 292: 883–896.34. Mears JA, Sharma MR, Gutell RR, McCook AS, Richardson PE, et al. (2006) Astructural model for the large subunit of the mammalian mitochondrialribosome. J Mol Biol 358: 193–212.35. Sharma MR, Koc EC, Datta PP, Booth TM, Spremulli LL, et al. (2003)Structure of the mammalian mitochondrial ribosome reveals an expandedfunctional role for its component proteins. Cell 115: 97–108.36. Mears JA, Cannone JJ, Stagg SM, Gutell RR, Agrawal RK, et al. (2002)Modeling a minimal ribosome based on comparative sequence analysis. J MolBiol 321: 215–234.37. Chandramouli P, Topf M, Menetret JF, Eswar N, Cannone JJ, et al. (2008)Structure of the mammalian 80S ribosome at 8.7 A resolution. Structure 16:535–548.38. Ben-Shem A, Jenner L, Yusupova G, Yusupov M (2010) Crystal structure of theeukaryotic ribosome. Science 330: 1203–1209.39. Rabl J, Leibundgut M, Ataide SF, Haag A, Ban N (2011) Crystal structure of theeukaryotic 40S ribosomal subunit in complex with initiation factor 1. Science331: 730–736.40. Hansen JL, Moore PB, Steitz TA (2003) Structures of five antibiotics bound atthe peptidyl transferase center of the large ribosomal subunit. J Mol Biol 330:1061–1075.41. Hansen JL, Ippolito JA, Ban N, Nissen P, Moore PB, et al. (2002) The structuresof four macrolide antibiotics bound to the large ribosomal subunit. Mol Cell 10:117–128.42. Tu D, Blaha G, Moore PB, Steitz TA (2005) Structures of MLSBK antibioticsbound to mutated large ribosomal subunits provide a structural explanation forresistance. Cell 121: 257–270.43. Barta A, Dorner S, Polacek N, Berg JM, Lorsch JR, et al. (2001) Mechanism ofRibosomal Peptide Bond Formation. Science 291: 203.44. Hansen JL, Schmeing TM, Klein DJ, Ippolito JA, Ban N, et al. (2001) Progresstoward an understanding of the structure and enzymatic mechanism of the largeribosomal subunit. Cold Spring Harb Symp Quant Biol 66: 33–42.45. Hansen JL, Schmeing TM, Moore PB, Steitz TA (2002) Structural insights intopeptide bond formation. Proc Natl Acad Sci U S A 99: 11670–11675.46. Ban N, Freeborn B, Nissen P, Penczek P, Grassucci RA, et al. (1998) A 9A˚resolution x-ray crystallographic map of the large ribosomal subunit. Cell 93:1105–1115.47. Nissen P, Hansen J, Ban N, Moore PB, Steitz TA (2000) The structural basis ofribosome activity in peptide bond synthesis. Science 289: 920–930.48. Steitz TA (2005) On the structural basis of peptide-bond formation andantibiotic resistance from atomic structures of the large ribosomal subunit. FEBSLett 579: 955–958.49. Rodnina MV, Beringer M, Wintermeyer W (2007) How ribosomes makepeptide bonds. Trends Biochem Sci 32: 20–26.50. Klein DJ, Moore PB, Steitz TA (2004) The contribution of metal ions to thestructural stability of the large ribosomal subunit. RNA 10: 1366–1379.51. Klein DJ, Moore PB, Steitz TA (2004) The roles of ribosomal proteins in thestructure assembly, and evolution of the large ribosomal subunit. J Mol Biol 340:141–177.52. Moore PB, Steitz TA (2002) The involvement of RNA in ribosome function.Nature 418: 229–235.53. Nissen P, Ippolito JA, Ban N, Moore PB, Steitz TA (2001) RNA tertiaryinteractions in the large ribosomal subunit: the A-minor motif. Proc Natl AcadSci U S A 98: 4899–4903.54. Voss NR, Gerstein M, Steitz TA, Moore PB (2006) The geometry of theribosomal polypeptide exit tunnel. J Mol Biol 360: 893–906.55. Cannone JJ, Subramanian S, Schnare MN, Collett JR, D’Souza LM, et al.(2002) The comparative RNA web (CRW) site: an online database ofcomparative sequence and structure information for ribosomal, intron, andother RNAs. BMC Bioinformatics 3: 2.56. Krief S, Escalante AA, Pacheco MA, Mugisha L, Andre C, et al. (2010) On thediversity of malaria parasites in African apes and the origin of Plasmodiumfalciparum from bonobos. PLoS Pathog 6: e1000765.57. Liu W, Li Y, Learn GH, Rudicell RS, Robertson JD, Keele BF, et al. (2010)Origin of the human malaria parasite Plasmodium falciparum in gorillas. Nature467: 420–425.58. Joy DA, Feng X, Mu J, Furuya T, Chotivanich K, et al. (2003) Early origin andrecent expansion of Plasmodium falciparum. Science 300: 318–321.59. Conway DJ, Fanello C, Lloyd JM, Al Joubori BM, Baloch AH, et al. (2000)Origin of Plasmodium falciparum malaria is traced by mitochondrial DNA. MolBiochem Parasitol 111: 163–171.60. Jongwutiwes S, Putaporntip C, Iwasaki T, Ferreira MU, Kanbara H, et al.(2005) Mitochondrial genome sequences support ancient population expansionin Plasmodium vivax. Mol Biol Evol 22: 1733–1739.61. Feagin JE, Drew ME (1995) Plasmodium falciparum: Alterations in organelletranscript abundance during the erythrocytic cycle. Exp Parasitol 80: 430–440.62. Ji Y, Mericle BL, Rehkopf DH, Anderson JD, Feagin JE (1996) The 6 kbelement of Plasmodium falciparum is polycistronically transcribed. Mol BiochemParasitol 81: 211–223.63. Dubin DT, HsuChen CC, Timko KD, Azzolina TM, Prince DL, et al. (1982) 3’termini of mammalian and insect mitochondrial rRNAs. In: Slonimski P, BorstP, Attardi G, editors. Mitochondrial Genes. Cold Spring Harbor: Cold SpringHarbor Press. 89–98.64. Dubin DT, Montoya J, Timko KD, Attardi G (1982) Sequence analysis andprecise mapping of the 3’-ends of HeLa cell mitochondrial ribosomal RNAs.J Mol Biol 157: 1–19.65. Van Etten RA, Bird JW, Clayton DA (1983) Identification of the 3’-ends of thetwo mouse mitochondrial ribosomal RNAs. J Biol Chem 258: 10104–10110.66. Wilson RJ, Williamson DH (1997) Extrachromosomal DNA in the Apicom-plexa. Microbiol Mol Biol Rev 61: 1–16.67. Fry M, Beesley JE (1991) Mitochondria of mammalian Plasmodium spp.Parasitology 102: 17–26.68. Krungkrai J (1995) Purification, characterization and localization of mitochon-drial dihydroorotate dehydrogenase in Plasmodium falciparum, human malariaparasite. Biochim Biophys Acta 1243: 351–360.69. Gray MW (1993) Origin and evolution of organelle genomes. Curr Opin GenetDev 3: 884–890.70. Shukla GC, Nene V (1998) Telomeric features of Theileria parva mitochondrialDNA derived from cycle sequence data of total genomic DNA. Mol BiochemParasitol 95: 159–163.71. Gutell RR, Weiser B, Woese CR, Noller HF (1985) Comparative anatomy of 16-S-like ribosomal RNA. Prog Nucleic Acid Res Mol Biol 32: 155–216.72. Powers T, Noller HF (1991) A functional pseudoknot in 16S ribosomal RNA.EMBO J 10: 2203–2214.73. Gutell RR, Noller HF, Woese CR (1986) Higher order structure in ribosomalRNA. EMBO J 5: 1111–1113.74. Jackson CJ, Norman JE, Schnare MN, Gray MW, Keeling PJ, et al. (2007)Broad genomic and transcriptional analysis reveals a highly derived genome indinoflagellate mitochondria. BMC Biol 5: 41.75. Gutell RR, Lee JC, Cannone JJ (2002) The accuracy of ribosomal RNAcomparative structure models. Curr Opin Struct Biol 12: 301–310.P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 19 June 2012 | Volume 7 | Issue 6 | e38320
  • 20. 76. Joseph JT, Aldritt SM, Unnasch T, Puijalon O, Wirth DF (1989) Character-ization of a conserved extrachromosomal element isolated from the avianmalarial parasite Plasmodium gallinaceum. Mol Cell Biol 9: 3621–3629.77. Kamikawa R, Inagaki Y, Sako Y (2007) Fragmentation of mitochondrial largesubunit rRNA in the dinoflagellate Alexandrium catenella and the evolution ofrRNA structure in alveolate mitochondria. Protist 158: 239–245.78. Slamovits CH, Saldarriaga JF, Larocque A, Keeling PJ (2007) The highlyreduced and fragmented mitochondrial genome of the early-branchingdinoflagellate Oxyrrhis marina shares characteristics with both apicomplexanand dinoflagellate mitochondrial genomes. J Mol Biol 372: 356–368.79. Trager W, Jensen JB (1978) Cultivation of malarial parasites. Nature 273: 621–622.80. Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acidguanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156–159.81. Gardner MJ, Feagin JE, Moore DJ, Spencer DF, Gray MW, et al. (1991)Organization and expression of small subunit ribosomal RNA genes encoded bya 35-kb circular DNA in Plasmodium falciparum. Mol Biochem Parasitol 48: 77–88.82. Tatusova TA, Madden TL (1999) BLAST 2 Sequences, a new tool forcomparing protein and nucleotide sequences. FEMS Microbiol Lett 174: 247–250.83. Brosius J, Dull TJ, Sleeter DD, Noller HF (1981) Gene organization and primarystructure of a ribosomal RNA operon from Escherichia coli. J Mol Biol 148: 107–127.84. Staden R, Beal KF, Bonfield JK (2000) The Staden package, 1998. MethodsMol Biol 132: 115–130.85. Bernstein HJ (2000) Recent changes to RasMol, recombining the variants.Trends Biochem Sci 25: 453–455.86. Cox-Singh J, Davis TM, Lee KS, Shamsul SS, Matusop A, et al. (2008)Plasmodium knowlesi malaria in humans is widely distributed and potentially lifethreatening. Clin Infec Dis 46: 165–171.P. falciparum Mitochondrial rRNAsPLoS ONE | www.plosone.org 20 June 2012 | Volume 7 | Issue 6 | e38320
  • 21. P. falciparum UAUGUCCUGU UUCAAAUAUA UAUAU----GAAUA AUUGUACGAA UAGACAAUUG UGUUCAUAGC UAGAGUACGU AAGGAAAAGG AAAGGUUAAC CGCUAUCAAAP. reichenowii .......... .......... .....----..... .........U ..U....... .......... .......... .......... .......... ..........P. billcollinsi .......... .......... .....AU--..... .......... ..U....... .......... .......... .......... .......... ..........P. billbrayi .......... .......... .....AUAU..... .........U ..U....... .......... .......... .......... .......... ..........P. gallinaceum .......... .....G...U GU.G-----CU.AU ..G.-..... CUA.U..... .......... .......... ........A. .......... ..........P. relictum .......... ...C.G...U GU.G-----CU.AU ..G.-..... .UU.U..... .......... .......... ........A. .......... ..........P. juxtanucleare .......... .....G...U –U.G-----CU.AU ..G.-..... .UAU--.... .......... .......... ........A. .......... ..........P. floridense .......... ...G.U..AU GU.G-----CU.AU ..G.-..... .UAUU..... .......... .......... ........A. .......... ..........P. mexicanum .......... ...G....AC AU.G-----CU... UAA.-..-.. .U.U...... .......... .......... ........A. .......... ..........P. ovale .......... ...G.U..U. G..C-----UU... U...-..A.U A.U.U.U... ...AA..... .......... .......... .......... ..........P. malariae .......... .....C...U G..G-----CU.AU ..G.-..-.. .UA.--U... ...AC.A... .......... .......... .......... ..........P. gonderi .......... .....U.... G.. -----CU.GU ..A.-..-.. ..A.--G... ...AA.A... .......... ........A. .......... ..........P. sp. .......... .....C...U G..G-----CU.AU ..A.-..-.. ..C.---... ...AA.A... .......... ........A. .......... ..........P. fragile .......... ....UC.... G.U.-----CU.GU ..A.-.U-.. .UU.---... ..A.A.A... .......... ........A. .......... ..........P. knowlesi .......... ...GUCC... G...-----CU.GU ..A.-..-.. .UA.--G... ...AA.A... .......... ........-. .......... ..........P. coatneyi .......... ....UCC... G.U.-----CU.GU ..A.-G.-.. .UA.--G... ...AA.A... .......... ........A. .......... ..........P. inui .......... ....GC.... G.U.-----CU.GU ..A.-..-.. .CA.--.... ...AG..... .......... ........A. .......... ..........P. hylobati .......... .....C.... G.U.-----CU.GU ..A.-..-.. .GA.--.... ....A.A... .......... ........A. .......... ..........P. vivax .......... .....C.... G...-----CU.GU ..A.-..-.. ..AU--.... ....A.A... .......... ........A. .......... ..........P. simuim .......... .....C.... G...-----CU.GU ..A.-..-.. ..AU--.... ....A.A... .......... ........A. .......... ..........P. simiovale .......... .....C.... G...-----CU.GU ..A.-..-.. .UU.--.... ...AA.A... .......... .......... .......... ..........P. fieldi .......... .....C.... G...-----CU.GU ..A.-..-.. .UU.--.... ...AA.A... .......... ........A. .......... ..........P. cynomolgi .......... .....C.... G...-----CU.GU ..A.-..-.. .UA.--.... ....A.A... .......... ........A. .......... ..........P. yoelii .......... ...G.U.... -C.G.----CU.G. U.A.-..-.. ..C.U.U... ...AU.A... .......... .......... .......... .........-P. berghei .......... ...G.U.... -C.G.----CU.G. U.A.-..-.. ..C.U.U... ...AU.A... .......... .......... .......... .........-P. chabaudi .......... ...G.U.... -C...----CU.AG U.A.-.U-.. .GC.U.U... ...AU.A... ....C..... .......... .......... .........-sarcin ricin loop
  • 22. Gg UACCc CAAAAAAaAUuUUUUUUUUUGgGGgGgGGUuC cCoooooooooooooLSUB LSUCAB23LSUC—LSUB~30H1082H1087H1057
  • 23. 7865684840 4054RNA11SSUDRNA12 RNA13 RNA14 RNA15 RNA16
  • 24. 1501 1510Pf G A G A T A A T G T g C C G TG 15 1 4 2 3 24 34 28 34A 3 22 8 5 3 7 3 6T 16 11 22 26 28 27 7 34 34 34C 1 34 341520 1530Pf A A A C A t A T A A C G G T AG 34 1 1 33 32 33A 16 34 34 34 33 34 33 1 2 34T 18 33 34 1C 34 1LSUF (short)LSUF (long)CA1251101 2 3B15011516
  • 25. AATAAATAATATCTAGCG . . . . . . . .TACGCCCTTAACG . . . AAATGT . .CCCTATTAAGCTTTTG . . . CAATATTGAGTTGAC . . . GAGTGGATTAAATGCCRNA16 RNA20 RNA93 72713433B1630 1631 1638ASSUELSUF1680 1763 180617641754RNA2 RNA211697RNA26t RNA31807 1829 1830
  • 26. SSU ASSU BRNA 9SSU DSSU ESSU F5’3’5’3’5’3’5’3’5’3’5’3’RNA 8RNA 145’3’5’3’5’3’RNA 17GAUUAUAUACGUAUGCUAAUAGAACC UUUUAU A AUCCCAUGCUGAUAUUAAAU AA UA UC AUUA GC CUAA U UUCUAUAAAAA A G G A U U GGAUAUUAUAUUGUAAAAUC A UGCAGUGCCAGCAG CCGC GGCAAUACUGUAUAAUUCGAGUAUAGUAAAUUCAUGUUA GGCGAAAAACGAGUUCAUGUUAUAUAAUUAACAUAUUUGAA ACUCUAUA UCUGUUUUA UAGUACAGGAUUA G AUACCCUGGAAUAUAUUGA U UCCACAUAUA A GA ACUUUAUAUUUCUUUGCCUU GGA U GUC AGU UAGUACGUAACAUACAUGUUGA A A U G U U AUA A GU A GU GA A A UCAGUGGAACAUGUUGUUUAAUUUGAUUUCACG CACUAUAU C U UACUGAUAAAAUUACACUAAGUCAGAAUCAUCUAAUUUAUCAGUACAUUAAUGUGUUAC A AGAGAUGAUGGCCGUAGGAAUUGAUAUUAAACGUCAA AGAGUACUAGACGUUAAAUAUUCUAGCA G U A UUC GCGUAAUAACUACUUUGAACACACUGCUCGACACGUAUUACAGUCAGUACGAAGUCGAAACA AGGU A GU U G AC A G UGAACUUGUAGCUGAACAAAGUA
  • 27. LSU ALSU B LSU C3’5’3’3’5’5’5’3’5’3’5’3’5’RNA 2 RNA 11RNA 1RNA 33’ halfCUUAACGUAAUUAAAUAUUUCAGUAAAAAUUGUAAUCUAACUUUAUUUAA U A C AUUGGUACGAACCUUACACCCUUAAAC GGUGUUGGACGA AAUAAAGUUAAUAGAUAAAU U C CAAUUG A ACAAUUAUA GAUUGUUCUCUGUGAAAUCUUUUAUGAAGAGUAAUGAUGGACUAUGUAAGUUAA C C U A U G U A G U CAAAUGCGAAAC AGCGC A CA AUCA UAUUUAAAGUACAU UAAUGUAUGCUUGAAUG C UG U A A U C A CUUUUAAAGAGA UAG CG UUAUAGCUCACUGUAUAGAU UUGAAAUAAAUG AAAAUUUUUUAAGGUAA C A G A GUAGAGAA CCUUCUGGA AUUAUG U U A A UUUUAGUAAUGAA A A U A U CAGUAUAUACAGUAACUUAUUAUAGACCAUUUUGCAAUCAUAUUUGAAAUAUAUUUCUAUACUG
  • 28. LSU DLSU ELSU FLSU G5’3’ 5’3’5’3’5’3’5’3’RNA 10RNA 35’3’RNA 13RNA 18RNA 65’3’5’3’A3’5’ half UGAGUUAA AUUUAGUGAAGGAACUUGACAGGUACAAUGAGGAGCGUCUGUUGAAUAC C UA C ACA AGAUAAUGCUAAGAUUU AUAUCGAUGUAUAUUAUCUGAU A C CUGUUCA GUGGUUUAGCC AAACAAC AGGGA UCUCUU UU AAAGUAAGAAUUGACUAUCUAAAUAAUAGUCAUGUGAAUGGUAUAACGACUUCUCUAUUGUCUCCACUAAAUGUUCU A U G AAAUAGACUUA GC U UUG AAUAGGAAGCUUGA U A U A C UGG G ACG GUAAGA CCCUGUGCACCUUCACUUCCCUCCGAAGGGAAGU U U AGCCGGG AAGUUU GCGUCUUUAACUACUAUUGGUAAUAAGGU ACGCCAGGG A UAACAGG U UAA A G A U U A AU U AU AG UACUCAUGUAAUUAAUCUAUUGACACCUCCAUGUCGUCUCACCAUA C C U U U UUGUUUUGUUAA U G C U U GAAUAAGGUUUAAUAGGUAUGAGAGUUCUCAUAUUAAU AUGGUACGUGAGUUGGGUUAAGAACGCCGCAAGGCU GUUCGUUCCCUAUCUAGAUAUUUGAAAGAGUUUUGUUU U A U A U G U A AAAGUGUUCUAGCCAGA GUACG UAAGGAAUAGGAAAGAUUAAC CGCUAUCAGGUGUUCGGUAUUGCAUGCCUAGUGUAU U GA U GU AAUUAUCGCACAAAUAGUUAACAAGAAAAAUAUAUUAAUAAGUUG AAGUUAUGGUUUAA
  • 29. 5’3’SSUARNA14RNA12RNA17SSUESSUFSSUD RNA5SSUBRNA8RNA19RNA95’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’IIIIII105010015020025030035040045050055060065070075080085090095010001050110011501200125013001350140014501500H9H17H27H122H240H289H500H505H511H567H575H577H655H673H722H769H885H921H939H944H960H984H1047H1068H1074H1303H1350H1399H1506H39H821H1241
  • 30. 5’ 3’5’3’LSUB5’3’LSUC5’3’RNA25’3’RNA115’3’RNA1RNA35’3’LSUA3’ half5’IIIIII50100150200250300350400450500550600650700750800850900950100010501100115012001250130013501400145015001550160016402900H563H579H589H671H687H736H700H777H812H822H946H976H991H1030H1057H1082H1087H1164H1196H1262H1276H1295
  • 31. 5’3’3’RNA35’3’LSUD5’3’LSUE5’ 3’RNA135’3’LSUF5’3’ LSUG5’3’RNA105’3’ RNA185’3’RNA6aa5’3’5’ halfIVVVI16501700175018001850190019502000205021002150220022502300235024002450250025502600265027002740280028502900H1648H1764H1775H1782H1792H1830H1835 H1906H1925H1935H2023H2043H2064H2077H2246H2455H2507H2520H2547H2588H2646H2675H2735
  • 32. 530 loopA-siteP-siteSSUARNA14SSUFSSUDRNA9SSUBRNA8SSUERNA19RNA5RNA12RNA17
  • 33. P-loopPTLGTPaseSRLA-loopLSUALSUGRNA10LSUBRNA13 RNA11RNA1RNA3RNA18LSUDRNA2LSUCLSUFRNA6LSUE
  • 34. 5’3’SSUARNA14RNA12RNA17SSUESSUFSSUDRNA5SSUBRNA8RNA19RNA95’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’5’3’IIIIII105010015020025030035040045050055060065070075080085090095010001050110011501200125013001350140014501500H9H17H27H122H240H289H500H505H511H567H575H577H655H673H722H769H885H921H939H944H960H984H1047H1068H1074H1303H1350H1399H1506G
  • 35. 5’ 3’5’3’LSUB5’3’LSUC5’3’RNA25’3’RNA115’3’RNA1RNA35’3’LSUA3’ half5’IIIIII50100150200250300350400450500550600650700750800850900950100010501100115012001250130013501400145015001550160016402900H563H579H589H671H687H736H700H777H812H822H946H976H991H1030H1057H1082H1087H1164H1196H1262H1276H1295
  • 36. 5’3’3’RNA35’3’LSUD5’3’LSUE5’ 3’RNA135’3’LSUF5’3’ LSUG5’3’RNA105’3’ RNA185’3’RNA6aa5’3’5’ halfIVVVI16501700175018001850190019502000205021002150220022502300235024002450250025502600265027002740280028502900H1648H1764H1775H1782H1792H1830H1835 H1906H1925H1935H2023H2043H2064H2077H2246H2455H2507H2520H2547H2588H2646H2675H2735
  • 37. Table S1. Mt genomes from Plasmodium species and relatedapicomplexans.Organism1(Host2)Mt DNAsize (nt)3identity toM76611Initial Set4Accession DataPlasmodium (Haemosporida)P. berghei (rodent) 5957 88.3% Y AB558173 (contig 5406, Sanger)5961 88.0% AF014115P. billbrayi (chimpanzee) 5945 91.8% GQ3554685949 91.7% Y GQ3554695864 90.3% GQ3554705865 90.5% GQ355471P. billcollinsi (chimpanzee) 5864 92.7% GQ3554775864 92.8% GQ3554785950 94.2% Y GQ355479P. chabaudi (rodent) 5949 88.1% AB3796635949 88.2% AB3796645949 88.2% AB3796655949 88.1% AB3796665949 88.1% AB3796675949 88.2% AB3796685949 88.2% AB3796695949 88.2% AB3796705949 88.2% AB3796715948 88.2% Y AF014116P. coatneyi (OW monkey, Asian) 5976 88.5% Y AB354575P. cynomolgi (OW monkey, Asian) 5983 88.8% AB4349195982 88.8% AB4441215985 88.8% AB4441225986 88.9% AB4441235983 88.8% AB4441245983 88.8% AB4441255993 88.9% AB4441265986 88.9% AB4441275986 88.9% AB4441285991 88.8% AB4441295984 88.8% AB4441305984 88.8% AB4441315884* 87.3% Y AY800108
  • 38. Organism1(Host2)Mt DNAsize (nt)3identity toM76611Initial Set4Accession DataP. falciparum (human) 5967 (self) Y M766115967 99.9% AJ276844 (NC_002375)5949 99.9% AY2829245949 99.9% AY2829255949 99.9% AY2829265949 99.9% AY2829275949 99.9% AY2829285949 99.9% AY2829295949 99.9% AY2829305949 99.9% AY2829315949 99.9% AY2829325949 99.9% AY2829335949 99.9% AY2829345949 99.9% AY2829355949 99.9% AY2829365949 99.9% AY2829375949 99.9% AY2829385949 99.9% AY2829395949 99.9% AY2829405949 99.9% AY2829415949 99.9% AY2829425949 99.9% AY2829435949 99.9% AY2829445949 99.9% AY2829455949 99.9% AY282946.5949 99.9% AY2829475949 99.9% AY2829485949 99.9% AY2829495949 99.9% AY2829505949 100.0% AY2829515949 100.0% AY2829525949 99.9% AY2829535949 99.9% AY2829545949 99.9% AY2829555949 99.9% AY2829565949 99.9% AY2829575949 99.9% AY282958
  • 39. Organism1(Host2)Mt DNAsize (nt)3identity toM76611Initial Set4Accession Data5949 99.9% AY2829595949 100.0% AY2829605949 99.9% AY2829615949 99.9% AY2829625949 99.9% AY2829635949 99.9% AY2829645949 99.9% AY2829655949 99.9% AY2829665949 99.9% AY2829675949 99.9% AY2829685949 99.9% AY2829695949 100.0% AY2829705949 100.0% AY2829715949 99.9% AY2829725953 99.9% AY2829735949 99.9% AY2829745949 99.9% AY2829755949 99.9% AY2829765949 99.9% AY2829775949 99.9% AY2829785949 99.9% AY2829795949 99.9% AY2829805949 99.9% AY2829815949 99.9% AY2829825949 100.0% AY2829835949 99.9% AY2829845949 100.0% AY2829855949 99.9% AY2829865949 100.0% AY2829875949 100.0% AY2829885949 99.9% AY2829895949 99.9% AY2829905949 99.9% AY2829915949 99.9% AY2829925949 99.9% AY2829935949 99.9% AY2829945949 99.9% AY282995
  • 40. Organism1(Host2)Mt DNAsize (nt)3identity toM76611Initial Set4Accession Data5949 99.9% AY2829965949 99.9% AY2829975949 99.9% AY2829985949 99.9% AY2829995949 99.9% AY2830005949 99.9% AY2830015949 99.9% AY2830025949 99.9% AY2830035949 99.9% AY2830045949 99.9% AY2830055949 99.9% AY2830065949 99.9% AY2830075949 99.9% AY2830085949 99.9% AY2830095949 99.9% AY2830105949 99.9% AY2830115949 99.9% AY2830125949 100.0% AY2830135949 100.0% AY2830145949 100.0% AY2830155949 99.9% AY2830165949 99.9% AY2830175949 100.0% AY2830185967 99.8% DQ642845P. fieldi (OW monkey, Asian) 5983 89.0% Y AB3545745988 89.0% AB4441325987 89.0% AB444133P. floridense (lizard) 6002 88.3% Y EF079654 (NC_009961)P. fragile (OW monkey, Asian) 5977 88.7% AB4441345978 88.8% AB4441355977 88.7% AB4441365977 88.7% Y AY722799 (NC_012369)P. gallinaceum (bird) 6003 88.3% Y AB250690 (NC_008288)6002 88.1% AB599930P. gonderi (OW monkey, African) 5989 89.1% AB4349185900* 87.7% Y AY800111P. hylobati (OW monkey, Asian) 5973 88.3% Y AB354573
  • 41. Organism1(Host2)Mt DNAsize (nt)3identity toM76611Initial Set4Accession DataP. inui (OW monkey, Asian) 5972 88.0% AB3545725976 88.5% AB4441095981 88.4% AB4441105976 88.2% AB4441115980 88.4% AB4441125976 88.2% AB4441135981 88.2% AB4441145971 88.0% AB4441155973 87.9% AB4441165976 88.2% AB4441175972 87.9% AB4441185979 88.4% AB4441195976 88.5% AB4441205972 87.9% Y HM032052P. juxtanucleare (bird) 6014 87.8% Y AB250415P. knowlesi (OW monkey, Asian;human5)5957 88.4% AB4441065958 88.4% AB4441075958 88.3% AB4441085957 88.4% Y AY722797 (NC_007232)P. malariae (human) 5968 88.8% Y AB3545705969 88.7% AB4891925969 88.7% AB4891935968 88.7% AB4891945856 87.0% GQ3554855856 87.0% GQ355486P. mexicanum (lizard) 5991 87.9% AB3757655991 87.9% Y EF079653 (NC_009960)P. ovale (human) 5974 89.1% Y AB354571P. reichenowi (chimpanzee) 5966 97.4% Y AJ251941 (NC_002235)P. relictum (bird) 5996 88.4% AY733088 (NC_012426)6003 87.8% AY7330895997 88.8% Y AY733090P. simiovale (OW monkey, Asian) 5987 89.0% AB4349205898* 87.6% Y AY800109P. simium (NW monkey) 5990 88.9% Y AY722798 (NC_007233)5899 87.5% AY800110P. vinckei vinckei (rodent) 5948 87.5% AB599931
  • 42. Organism1(Host2)Mt DNAsize (nt)3identity toM76611Initial Set4Accession DataP. sp. DAJ-2004 (OW monkey, African) 5896* 87.3% Y AY800112P. vivax (human) 5991 88.9% AY5980355990 88.9% AY5980365991 88.9% AY5980375991 88.9% AY5980385991 88.9% AY5980395991 88.9% AY5980405994 88.9% AY5980415989 88.9% AY5980425990 88.9% AY5980435991 88.9% AY5980445991 88.9% AY5980455989 88.9% AY5980465989 88.9% AY5980475992 88.9% AY5980485991 88.9% AY5980495989 88.9% AY5980505990 88.9% Y AY598140 (NC_007243)P. yoelii (rodent) 5956 88.4% Y M29000 M21313 M33978(MALPY00209 (TIGR))Other HaemosporidaH. sp. jb1.JA27 (bird) 5970 86.6% AY733086 (NC_012423)H. sp. jb2.SEW5141 (bird) 5970 86.8% Y AY733087 (NC_012425)H. columbae (bird) 5988 83.3% Y FJ168562 (NC_012448)Hepatocystis sp. (bat) 6259 86.3% Y FJ168565L. caulleryi (bird) 5959 85.9% Y AB302215L. fringillarium (bird) 5992 83.2% Y FJ168564 (NC_012451)L. majoris (bird) 6684 83.5% Y FJ168563 (NC_012450)L. sabrasezi (bird) 5935 82.6% Y AB299369 (NC_009336)Parahaemoproteus vireonis (bird) 5893* 86.6% Y FJ168561 (NC_012447)Eimeria (Coccidia)Eimeria tenella (bird) 6213 NA AB564272Babesia and Theileria (Piroplasmida)B. bovis (cow) 5970 NA AB4990886005 NA EU075182B. caballi (horse) 5847 NA AB499086B. gibsoni (dog) 5865 NA AB499087T. annulata (cow) 5905 NA CR940346 (NT_167255)
  • 43. Organism1(Host2)Mt DNAsize (nt)3identity toM76611Initial Set4Accession DataT. equi (horse) 8246 NA AB499091T. orientalis (cow) 5957 NA AB499090T. parva (cow) 5924 NA AB4990895895 NA Z23263 (011005)1P., Plasmodium; H., Haemoproteus; L., Leucocytozoon; B., Babesia; T., Theileria.2OW, Old World; NW, New World.3* mt genome sequence incomplete; presumed to reflect PCR primer choice.4Complete (or nearly complete) mitochondrial genomes of 25 Plasmodium species, one Plasmodium isolate,and eight related hemosporidian species used for initial alignment.5P. knowlesi, previously considered only a monkey parasite, has recently been found to cause humaninfections as well [86].
  • 44. Table S2. Intergenic size variation among hemosporidian mt genomes.OrganismaRNA23t><LSUCbRNA10<<cox3ccox3<>LSUFLSUF>>SSUESSUE>>RNA2RNA3><SSUASSUA<>cox1cox1c>>cobcRNA4>>RNA5RNA5>>RNA6RNA12>>RNA18RNA8<>RNA16P. falciparum 0 9 28 7 16 5 13 20 19 5 18 15P. reichenowi 0 9 28 7 16 5 13 20 19 5 18 15P. billcollinsi 1 9 34 7 16 5 13 20 19 5 18 15P. billbrayi 0 9 38 7 15 5 13 20 19 4 18 14P. gallinaceum 1 10 32 10 17 5 17 14 19 7 25 15P. relictum 0 10 32 10 14 5 17 14 19 7 25 15P. juxtanucleare 7 11 31 15 18 5 18 14 18 7 24 15P. floridense 0 10 31 9 17 5 17 15 19 0 25 18P. mexicanum 1 10 33 12 16 5 13 14 19 0 18 18P. ovale 1 9 30 11 18 5 17 7 19 4 20 9P. malariae 1 9 31 7 18 5 19 14 19 4 20 9P. gonderi 0 8 30 11 18 5 28 27 19 1 19 16P. sp. DAJ-2004 2 6 30 11 17 5 29 24 19 4 19 15P. fragile 2 6 30 11 18 5 26 21 20 4 20 10P. knowlesi 2 6 30 11 18 5 14 18 19 4 20 6P. coatneyi 2 6 30 11 18 5 32 21 18 3 20 6P. inui 2 6 30 11 17 5 17 20 29 4 20 11P. hylobati 2 6 31 11 17 5 24 21 29 4 20 9P. vivax 2 12 30 11 18 5 24 21 19 4 20 11P. simium 2 12 30 11 18 5 31 21 19 4 20 11P. simiovale 2 8 30 11 18 5 28 17 19 4 20 11P. fieldi 2 8 32 11 18 5 25 13 19 4 20 11P. cynomolgi 2 10 30 11 18 5 23 15 19 4 20 15P. yoelii 1 6 30 11 16 5 17 19 19 0 22 4P. berghei 1 6 30 11 16 5 17 19 19 0 22 4
  • 45. OrganismaRNA23t><LSUCbRNA10<<cox3ccox3<>LSUFLSUF>>SSUESSUE>>RNA2RNA3><SSUASSUA<>cox1cox1c>>cobcRNA4>>RNA5RNA5>>RNA6RNA12>>RNA18RNA8<>RNA16P. chabaudi 1 6 30 11 15 5 17 17 19 0 21 4Haemoproteus sp. 4 11 32 7 17 5 13 15 0 0 25 16Parahaemoproteus 4 12 32 7 17 5 17 15 12 0 25 NAL. caulleryi 2 4 32 4 17 5 14 16 11 0 25 13L. sabrasezi 2 10 32 4 4 2 13 13 11 0 27 17L. majoris 4 11 32 6 17 3 17 15 11 4 27 14L. fringillarium 4 11 33 6 17 9 17 15 11 10 27 14H. columbae 3 10 31 7 17 5 18 19 8 0 24 17Hepatocystis sp. 20 19 62 16 18 18 46 94 24 0 0 28aOrganisms arranged by relatedness of mt genomes from Clustal W alignment, to assist pattern identification. P, Plasmodium; L, Leucocytozoon; H,Haemoproteus.bGene pairs flanking a gap of 10 nt or more are shown with carets indicating the direction of transcription. The number of nt in the gap is given, based onthe 5’ or 3’ end of the flanking transcripts, as appropriate.cFor these genes, the gap is calculated from the end of the ORF, not the transcript end. This was done because using the transcript end would haverequired negative numbers for some gaps.
  • 46. SSUA S4 108 92 6% 99 1% 99 1% 92 6% 93 5% 93 5% 94 4% 94 4% 94 4% 93 5% 93 5% 94 4% 93 5% 93 5% 93 5% 93 5% 93 5% 94 4% 93 5% 100 0% 93 5% 93 5% 93 5% 93 5% 92 6% 94 3%804 95 97 94 96 98 95 96 94 95 96 95 96 94 95 95 95 95 95 95 99 95 95 95 95 95 95average SSU rRNA98.5% 99.5% .0% 99.5% 98.5% 98.5% 99.0% 99.0% 9% 99.0% 99.0% 98.5% 9% 99.0% 98.5% 99.0% 96.9% 99.0% .0% 98.5% 98.5% 99.0% 99.0% 98RNA4 72 86 96 98 83 87 86 86 90 84 90 86 86 84 88 76 84 86 88 86 100 0% 90 87 84 84 1% 87identical 376 89% 98% 99% 90% 91% 91% 91% 83% 91% 83% 91% 91% 88% 83% 91% 91% 90% 82% 91% 100% 83% 91% 91% 91% 89% 90%Amino acid sequence similarity is shown We calculated similarity on the basis of identity and also allowing for conservative amino acid replacementsTable S3. Similarity of individual mt genes from Plasmodium species relative to P. falciparum.gene rRNA orderasize (nt)bergheibillbrayibillcollinsichabaudicoatneyicynomolgifieldifloridensefragilegallinaceumgonderihylobatiinuijuxtanucleareknowlesimalariaemandrillbmexicanumovalereichenowirelictumsimiovalesimiumvivaxyoeliaverageRNA14 S1 39 100.0% 97.4% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 92.3% 100.0% 97.4% 97.4% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 99.5%RNA12 S2 59 89.8% 98.5% 100.0% 86.4% 93.2% 91.5% 93.2% 93.2% 91.5% 96.6% 96.6% 93.2% 89.8% 94.9% 89.8% 91.5% 91.5% 93.2% 93.2% 100.0% 94.9% 91.5% 89.8% 89.8% 89.8% 92.7%RNA17 S3 40 97.5% 97.6% 97.5% 97.5% 97.5% 100.0% 100.0% 100.0% 95.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 95.0% 100.0% 100.0% 100.0% 97.5% 100.0% 100.0% 100.0% 100.0% 95.0% 98.9%SSUA S4 108 92 6%. 99 1%. 99 1%. 92 6%. 93 5%. 93 5%. 94 4%. 94 4%. 94 4%. 93 5%. 93 5%. 94 4%. 93 5%. 93 5%. 93 5%. 93 5%. 93 5%. 94 4%. 93 5%. 100 0%. 93 5%. 93 5%. 93 5%. 93 5%. 92 6%. 94 3%.RNA8 S5 100 94.0% 99.1% 99.0% 95.0% 96.0% 95.0% 96.0% 91.0% 95.0% 94.0% 97.0% 96.0% 95.0% 94.0% 95.0% 96.0% 96.0% 95.0% 95.0% 99.0% 93.0% 94.0% 95.0% 95.0% 93.0% 95.3%SSUB S6 116 97.4% 99.2% 99.1% 97.4% 99.1% 97.4% 99.1% 96.6% 96.6% 97.4% 97.4% 99.1% 97.4% 97.4% 97.4% 97.4% 97.4% 97.4% 99.1% 99.1% 97.4% 97.4% 97.4% 97.4% 97.4% 97.8%RNA19 S7 30 100.0% 96.7% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0%RNA9 S8 54 94.4% 98.3% 98.1% 94.4% 92.6% 92.6% 94.4% 92.6% 92.6% 94.4% 94.4% 94.4% 90.7% 94.4% 92.6% 96.3% 94.4% 100.0% 94.4% 98.1% 96.3% 96.3% 92.6% 90.7% 98.1% 94.7%RNA5 S9 87 89.7% 99.0% 95.4% 87.4% 90.8% 88.5% 89.7% 87.4% 88.5% 86.2% 87.4% 88.5% 87.4% 86.2% 89.7% 88.5% 89.7% 85.1% 87.4% 98.9% 87.4% 88.5% 87.4% 89.7% 90.8% 89.2%SSUD S10 68 98.5% 98.6% 100.0% 98.5% 95.6% 95.6% 95.6% 95.6% 95.6% 92.6% 95.6% 97.1% 94.1% 94.1% 95.6% 97.1% 95.6% 94.1% 97.1% 100.0% 94.1% 95.6% 95.6% 95.6% 97.1% 96.1%SSUE S11 42 100.0% 97.6% 100.0% 100.0% 100.0% 100.0% 100.0% 97.6% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 97.6% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 99.8%SSUF S12 61 98.4% 98.4% 100.0% 98.4% 100.0% 100.0% 100.0% 100.0% 100.0% 98.4% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 98.4% 100.0% 100.0% 100.0% 100.0% 98.4% 99.5%average SSU rRNA 804 95.3%.3% 97.8%.8% 94.9%.9% 96.0%.0% 98.9%.9% 95.4%.4% 96.3%.3% 94.8%.8% 95.1%.1% 96.3%.3% 95.1%.1% 96.0%.0% 94.5%.5% 95.3%.3% 95.3%.3% 95.5%.5% 95.8%.8% 95.5%.5% 95.9%.9% 99.3%.3% 95.4%.4% 95.5%.5% 95.1%.1% 95.3%.3% 95.3%.3% 95.8%.8%LSUA L1 176 97.7% 99.4% 99.3% 97.2% 96.6% 85.2% 97.7% 98.9% 97.7% 97.7% 85.2% 98.3% 97.2% 98.9% 97.2% 98.3% 99.3% 97.7% 98.3% 97.7% 98.9% 85.2% 97.2% 97.2% 97.7% 98.0%RNA2 L2 67 92.5% 98.6% 98.5% 94.0% 94.0% 92.5% 95.5% 92.5% 94.0% 94.0% 92.5% 95.5% 92.5% 92.5% 91.0% 95.5% 92.5% 92.5% 95.5% 100.0% 92.5% 94.0% 94.0% 92.5% 92.5% 94.1%LSUB L3 29 100.0% 96.6% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 96.6% 96.6% 93.1% 100.0% 96.6% 100.0% 96.6% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 99.2%LSUC L4 22 95.5% 95.7% 90.9% 95.5% 95.5% 95.5% 95.5% 86.4% 86.4% 90.9% 95.5% 95.5% 100.0% 90.9% 90.9% 100.0% 100.0% 90.9% 90.9% 100.0% 90.9% 95.5% 95.5% 95.5% 95.5% 94.2%RNA11 L5 57 91.2% 98.4% 98.2% 94.7% 89.5% 91.2% 93.0% 91.2% 91.2% 93.0% 93.0% 91.2% 91.2% 100.0% 89.5% 91.2% 89.5% 94.7% 93.0% 98.2% 91.2% 87.7% 87.7% 91.2% 91.2% 92.5%RNA1 L6 88 96.6% 98.9% 98.9% 96.6% 98.9% 96.6% 97.7% 93.2% 96.6% 95.5% 96.6% 98.9% 95.5% 98.9% 97.7% 95.5% 94.3% 95.5% 96.6% 100.0% 98.9% 96.6% 96.6% 96.6% 95.5% 96.9%RNA3 L7 81 95.1% 98.8% 100.0% 93.8% 95.1% 96.3% 96.3% 93.8% 93.8% 97.5% 96.3% 95.1% 95.1% 97.5% 96.3% 96.3% 95.1% 95.1% 96.3% 100.0% 97.5% 96.3% 96.3% 96.3% 95.1% 96.1%LSUD L8 83 97.6% 98.8% 100.0% 97.6% 97.6% 97.6% 97.6% 97.6% 97.6% 97.6% 98.8% 97.6% 97.6% 97.6% 98.8% 97.6% 98.8% 97.6% 97.6% 100.0% 97.6% 97.6% 97.6% 97.6% 97.6% 98.0%LSUELSUE L9L9 195195 98.5% 99.5% 100.0%100 99.5% 98.5% 98.5% 99.0% 97.4%97.4% 99.0% 97.9%97. 99.0% 99.0% 98.5% 97.9%97. 99.0% 98.5% 99.0% 96.9% 99.0% 100.0%100 97.4%97.4% 98.5% 98.5% 99.0% 99.0% 98.7%.7%RNA13 L10 30 96.7% 96.8% 100.0% 96.7% 100.0% 100.0% 100.0% 96.7% 96.7% 96.7% 96.7% 100.0% 100.0% 100.0% 96.7% 100.0% 96.7% 96.7% 100.0% 100.0% 96.7% 96.7% 100.0% 96.7% 96.7% 98.3%LSUF L11 115 98.3% 99.1% 100.0% 97.4% 99.1% 98.3% 99.1% 93.9% 98.3% 96.5% 99.1% 98.3% 98.3% 97.4% 98.3% 97.4% 100.0% 97.4% 98.3% 100.0% 97.4% 98.3% 98.3% 98.3% 98.3% 98.2%LSUG L12 107 98.1% 99.1% 99.1% 97.2% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 98.1% 99.7%RNA10 L13 100 82.0% 99.2% 100.0% 79.0% 87.0% 83.0% 90.0% 85.0% 78.0% 83.0% 82.0% 91.0% 88.0% 82.0% 78.0% 85.0% 88.0% 86.0% 85.0% 98.0% 83.0% 83.0% 83.0% 83.0% 82.0% 89.1%RNA18 L14 25 100.0% 96.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0%RNA6 L15 58 96.6% 98.3% 100.0% 96.6% 96.6% 96.6% 98.3% 100.0% 98.3% 98.3% 98.3% 98.3% 98.3% 96.6% 98.3% 98.3% 98.3% 98.3% 98.3% 100.0% 100.0% 98.3% 96.6% 96.6% 96.6% 98.1%average LSU rRNA 1233 96.3% 99.2% 96.2% 96.5% 99.4% 96.8% 97.3% 95.5% 96.4% 97.2% 96.4% 97.1% 96.4% 97.1% 96.3% 96.5% 96.9% 95.9% 96.8% 99.5% 96.6% 96.8% 96.6% 96.7% 96.3% 96.9%average mt rRNAs 2037 95.9% 98.6% 95.7% 96.3% 99.2% 96.2% 96.9% 95.2% 95.9% 96.9% 95.9% 96.7% 95.7% 96.4% 95.9% 96.1% 96.5% 95.8% 96.4% 99.4% 96.1% 96.3% 96.0% 96.1% 95.9% 96.5%RNA4 unassignedunassigned 72 86.1%.1% 96.9%.9% 98.6%.6% 83.3%.3% 87.5%.5% 86.1%.1% 86.1%.1% 90.3%.3% 84.7%.7% 90.3%.3% 86.1%.1% 86.1%.1% 84.7%.7% 88.9%.9% 76.4%.4% 84.7%.7% 86.1%.1% 88.9%.9% 86.1%.1% 100.0%. 90.3%.3% 87.5%.5% 84.7%.7% 84.7%.7% 86.1%86. 87.7%.7%RNA7 unassigned 82 97.6% 97.6% 100.0% 96.3% 96.3% NDc97.6% 96.3% 97.6% 96.3% NDc97.6% 96.3% 96.3% 96.3% 97.6% NDc95.1% 96.3% 100.0% 96.3% NDc98.8% 98.8% 97.6% 97.3%RNA15 unassigned 31 100.0% 97.3% 100.0% 100.0% 87.1% 100.0% 87.1% 96.8% 100.0% 100.0% 100.0% 87.1% 100.0% 100.0% 100.0% 83.9% 100.0% 100.0% 87.1% 100.0% 100.0% 100.0% 100.0% 100.0% 100.0% 97.2%RNA16 unassigned 31 96.8% 97.4% 100.0% 96.8% 96.8% 96.8% 96.8% 96.8% 93.5% 96.8% 96.8% 96.8% 96.8% 96.8% 96.8% 96.8% 96.8% 90.3% 96.8% 100.0% 96.8% 96.8% 96.8% 96.8% 96.8% 96.8%RNA20 unassigned 38 92.1% 100.0% 100.0% 92.1% 97.4% 97.4% 97.4% 100.0% 97.4% 97.4% 97.4% 97.4% 100.0% 97.4% 97.4% 97.4% 100.0% 100.0% 94.7% 100.0% 97.4% 97.4% 97.4% 97.4% 92.1% 97.4%RNA21 unassigned 36 97.2% 100.0% 100.0% 97.2% 100.0% 97.2% 100.0% 97.2% 100.0% 94.4% 97.2% 100.0% 100.0% 91.7% 94.4% 100.0% 100.0% 97.2% 100.0% 100.0% 94.4% 97.2% 97.2% 97.2% 97.2% 97.9%RNA22 unassigned 38 97.4% 100.0% 97.4% 94.7% 94.7% 94.7% 94.7% 94.7% 92.1% 94.7% 92.1% 94.7% 94.7% 92.1% 94.7% 92.1% 94.7% 100.0% 100.0% 97.4% 100.0% 94.7% 94.7% 94.7% 97.4% 95.5%total unassigned RNAs 328 94.8% 99.1% 93.9% 93.9% 99.4% 95.4% 93.9% 95.4% 95.1% 93.9% 96.3% 96.3% 94.8% 96.0% 93.3% 93.0% 96.0% 95.1% 93.9% 99.7% 96.3% 96.6% 95.7% 94.8% 94.8% 95.5%total small mt RNAs 2365 95.7% 98.7% 95.4% 96.0% 99.2% 96.1% 96.5% 95.2% 95.8% 96.4% 95.9% 96.6% 95.6% 96.3% 95.5% 95.7% 96.4% 95.7% 96.1% 99.5% 96.2% 96.4% 96.0% 95.9% 95.7% 96.3%COBdCOB identical 376 89% 98% 99% 90% 91% 91% 91% 83% 91% 83% 91% 91% 88% 83% 91% 91% 90% 82% 91% 100% 83% 91% 91% 91% 89% 90%conserved 96% 99% 100% 97% 97% 97% 97% 91% 97% 92% 97% 97% 96% 91% 97% 97% 97% 92% 96% 100% 92% 97% 97% 97% 96% 96%COX1didentical 477e93% 96% 98% 92% 94% 94% 94% 94% 94% 94% 93% 94% 93% 94% 94% 92% 93% 94% 95% 99% 94% 94% 94% 94% 92% 94%conserved 98% 99% 99% 97% 98% 98% 98% 98% 98% 97% 98% 98% 98% 98% 98% 98% 98% 98% 99% 100% 98% 98% 98% 98% 98% 98%COX3didentical 250e84% 86% 88% 83% 84% 84% 86% 84% 85% 84% 84% 83% 84% 82% 85% 84% 83% 83% 81% 94% 84% 86% 84% 84% 84% 85%conserved 91% 96% 97% 91% 92% 92% 92% 92% 93% 93% 92% 92% 92% 92% 92% 92% 92% 92% 91% 98% 93% 93% 93% 93% 91% 93%aLinear order of rRNA fragments, based on similarity to conventional rRNAs.bSample collected from a mandrill, species not identified.cND, not done. RNA7 similarity was not calculated for species from which its sequence is largely missing, presumably due to placement of PCR primers.dAmino acid sequence similarity is shown We calculated similarity on the basis of identity and also allowing for conservative amino acid replacements. , .eP. falciparum cox1 and cox3 lack conventional initiation codons and are presumed to use non-standard intiation codons [1] , common for mitochondrial proteins.
  • 47. Table S4. Oligonucleotides used in this study.Analysis Gene RACE Primer Sequence PositionaRACE Analysis SSUB 5’ cDNA GTGTTCCACCGCTAGTGTTTGC 431-4525’ PCR CCACTTGCTTATAACTGTATGGACG 463-487SSUE 5’ CCAACAACATAACATTTTTTAGTCCCA 1794-1820RNA1 3’ GCTGACTTGAGTAATGATA 559-578 rcRNA4 3’ CATTTCTGAGTATTGAGCGGAAC 4647-4669RNA6 5’ cDNA CTTGCCAACTCCCTATCATGTC 4839-4860 rc5’ PCR GTCTTGCTAACGGCTTGTACGG 4820-4841 rc3’ CCGTACAAGCCGTTAGCAAGACA 4820-4843RNA9 5’ CAATCAAATTGGATGGTGTTGGC 83-105rc3’ CCTAATTTACGGGTCGGTTGTGG 69-91 rcRNA10 3’ GTACGAATAGACAATTGTGTTCATAGCTA 664-691RNA11 5’ TTCAATTCGTACTTCCACTACCAG 5279-53023’ CATCGATATACGGATTTCTCCTG 5348-5370 rcRNA12 3’ GGGATATTTGTAGTACACCTTGATTGG 4911-4937RNA13 3’ GGGAAGTTTAGCCAGGAAGTCAGC 5001-5024 rcRNA14 5’ CGAGTCGATCAGGAAGGTTTC 5519-55393’ GATGAAACCTTCCTGATCGACTCG 5519-5542 rcRNA15 3’ CACACTTCCCTTCTCGCC 606-623RNA16 5’ cDNA GGATGGTGTTGGCTGGGC 78-95 rc5’ PCR GGTATCTCGTAATGTAGAACAA 9-303’ AAGCTTTTGGTATCTCGTAATGTAG 1-25RNA17 3’ CTGTGTTACAAATTTTTGATCCCAGG 114-139RNA18 3’ CGGTATTGCATGCCTGGTG 4968-4986RNA19 3’ GTTCTTATGTGTTGGCATGG 5557-5576 rcRNA20 5’ cDNA GGATGGTGTTGGCTGGGC 78-95 rc5’ PCR GAAAAGGATTTGACGGTCAACTC 35-57 rc3’ TGAGTTGACCGTCAAATCCTTTTCA 34-58RNA21b3’ GCATGGGACTAAAAAATGTTATGTTGTTG 1791-18205’ CCAACAACATAACATTTTTTAGTCCCA 1794-1821 rcRNA22 5’ CAGGAGAAATCCGTATATCGATG 5348-53703’ CATCGATATACGGATTTCTCCTG 5348-5370 rcPrimer Extension LSUB TGATTACAGCTCCCAAGCAAAC 4594-4615LSUC GAGCTATGACGCTATC 206-221LSUF GAGCTCTATATATACTATAACC 1553-1574 rcRNA6 GTCTTGCTAACGGCTTGTACGG 4820-4842 rcRNA11 CAGGAGAAATCCGTATATCGATG 5348-5370
  • 48. Analysis Gene RACE Primer Sequence PositionaRNA12 CAATCAAGGTGTACTACAAATATC 4913-4936 rcRNA13 GACGCTGACTTCCTGGCT 4998-5015RNA14/RNA15 GTTTCTTTTACCTCACGAGTCGATC 5504-5528RNA Blots LSUB TGATTACAGCTCCCAAGCAAAC 4594-4615LSUC GAGCTATGACGCTATC 206-221LSUF GAGCTCTATATATACTATAACC 1553-1574 rcRNA12 CAATCAAGGTGTACTACAAATATC 4913-4936 rcRNA13 GACGCTGACTTCCTGGCT 4998-5015RNA14 GTTTCTTTTACCTCACGAGTCGATC 5504-5528RNA15 TTCTATGGAAACACACTTC 595-613RNA16 GTTCTACATTACGAGATACCAAAAGC 3-28 rcaPosition is given per Genbank entry M76611. rc, reverse complement.bThe 5’ RACE primer for RNA21 overlapped the transcript start but generated products which correspond to the ends ofupstream RNAs.
  • 49. Table S5. Plasmodium falciparum mt rRNA 3’end sequencesFragment SequenceSSUA GTATTATCCA TCCATGTCAG GCGTTAAAAG CGTTCGTTCT TATAGTGTAGGUAUUAUCCA UCCAUGUCAG GCGUUAAAAG CGUUCGUUCU AAAAAAAGUAUUAUCCA UCCAUGUCAG GCGUUAAAAG CGUUCGUUCU AAAAAAAAAAAAA (2)GUAUUAUCCA UCCAUGUCAG GCGUUAAAAG CGUUCGUUCU AAAAAAAAAAAAAAAAAASSUB TTGTTTCATT TGATAGTAAA CACTATACCT TACCAATCTA TTTGAACTTGUUGUUUCAUU UGAUAGUAAA CACUAUACCU UACCAAUCUA (4)SSUD GACGTCAGGA AGTCCTGGAC GTTGAATCCA ATAGCATTGA TTAAAAGACAGACGUCAGGA AGUCCUGGAC GUUGAAUCCA AUAGCAUUGA AAAGACGUCAGGA AGUCCUGGAC GUUGAAUCCA AUAGCAUUGA AAGACGUCAGGA AGUCCUGGAC GUUGAAUCCA AUAGCAUUGASSUF AACATGGTAG TTGACAGTGA ACTTGTAGCT GAACCAAAAA TGGCTGCTGGAACAUGGUAG UUGACAGUGA ACUUGUAGCU GAACCAAAAAAACAUGGUAG UUGACAGUGA ACUUGUAGCU GAACCAAAAA AAAAACAUGGUAG UUGACAGUGA ACUUGUAGCU GAACCAAAAA AAAAAA (2)LSUA TAGACGGTTT TCTGCGAAAT CTATTTGGAA GATATATCAT TGGGAAGTTTUAGACGGUUU UCUGCGAAAU CUAUUUGGAA GAUAUAUCAU AAAAAAAAAAAAALSUD TGATGAATAT TTCAAGTTAC TGACATCTGC CCGGCATCAA TGATAAACGGUGAUGAAUAU UUCAAGUUAC UGACAUCUGC CCGGCAUCAA AAUGAUGAAUAU UUCAAGUUAC UGACAUCUGC CCGGCAUCAA AAALSUE GCCCGACGGT AAGACCCTGA GCACCTTAAC TTCCCTAAAA GTTCTTATGTGCCCGACGGU AAGACCCUGA GCACCUUAAC UUCCCUAAAA AAAAAAAAAAAAAAALSUF CTATTGGCAC CTCCATGTCG TCTCATCGCA GCCTTGCAAT AAATAATATCCUAUUGGCAC CUCCAUGUCG UCUCAUCGCA GCCUUGCAAU AAAAAACUAUUGGCAC CUCCAUGUCG UCUCAUCGCA GCCUUGCAAU AAAAAAAACUAUUGGCAC CUCCAUGUCG UCUCAUCGCA GCCUUGCAAU AAAAAAAAALSUG AGAACGTCTT GAGGCAGTTT GTTCCCTATC TACCGTTTTA TCTTTGCATGAGAACGUCUU GAGGCAGUUU GUUCCCUAUC UACCGUUUUA AAAAAAAAAAAAGAACGUCUU GAGGCAGUUU GUUCCCUAUC UACCGUUUUA AAAAAAAAAAAARNA1 AGCTATCCAT AGTTAATTGA TTCCGTTTTG ACCGGTCATT TTCTTTGCCTAGCUAUCCAU AGUUAAUUGA UUCCGUUUUG ACCGGUCAUU AAAARNA2 TGAGATGGAA ACAGCCGGAA AGGTAATTTT ACGCCCTTAA CGTAAAGATCUGAGAUGGAA ACAGCCGGAA AGGUAAUUUU ACGCCCUUAA AAAAAAAAAAUGAGAUGGAA ACAGCCGGAA AGGUAAUUUU ACGCCCUUAA AAAAAAAAAAAAAAAUGAGAUGGAA ACAGCCGGAA AGGUAAUUUU ACGCCCUUAA AAAAAAAAAAAAAAAAAAAAARNA3 CTGTGAGGAA ACTACATTAA AGGAACTCGA CTGGCCTACA CTATAAGAAGCUGUGAGGAA ACUACAUUAA AGGAACUCGA CUGGCCUACA AAAAAA (2)
  • 50. Fragment SequenceCUGUGAGGAA ACUACAUUAA AGGAACUCGA CUGGCCUACA AAAAAAAA (2)RNA4 GATTGAGCGG AACAAATCAG ACCGTAAGGT TATAATTATG TACTATGATTGAUUGAGCGG AACAAAUCAG ACCGUAAGGU UAUAAUUAUG AAA (2)RNA5 TTACAGTATC AATCGGATTT ACATGCTCAG CCGCCAAAAA CTATAACGATUUACAGUAUC AAUCGGAUUU ACAUGCUCAG CCGCCAAAAA AAAAAAAAAAUUACAGUAUC AAUCGGAUUU ACAUGCUCAG CCGCCAAAAA AAAAAARNA6 AAGCCGTTAG CAAGACATGA TAGGGAGTTG GCAAGTTAAA GAAGTTCTGAAGCCGUUAG CAAGACAUGA UAGGGAGUUG GCAAGUUAAA AAAGCCGUUAG CAAGACAUGA UAGGGAGUUG GCAAGUUAAA AA (2)RNA7 AATCGAGAGA GATTCCATTA GTTGTCTCTA TGAATAGTGG TTATAGCCATAAUCGAGAGA GAUUCCAUUA GUUGUCUCUA UGAAUAGUGG AAAAAAAAAAAAUCGAGAGA GAUUCCAUUA GUUGUCUCUA UGAAUAGUGG AAAAAAAAAAAAAAA (2)RNA8 CCCGGGAAAC CGGCGCTTCC ATTTATAAGA AGTTAAATTA CTGGAAGCGTCCCGGGAAAC CGGCGCUUCC AUUUAUAAGA AGUUAAAUUA AAAAAAACCCGGGAAAC CGGCGCUUCC AUUUAUAAGA AGUUAAAUUA AAAAAAAAAAAAACCCGGGAAAC CGGCGCUUCC AUUUAUAAGA AGUUAAAUUA AAAAAAAAAAAAAAAA (3)CCCGGGAAAC CGGCGCUUCC AUUUAUAAGA AGUUAAAUUA AAAAAAAAAAAAAAAAAACCCGGGAAAC CGGCGCUUCC AUUUAUAAGA AGUUAAAUUA AAAAAAAAAAAAAAAAAAARNA9 AACACCATCC AATTTGATTG GGAATTATCT GTGTTACAAA TTTTTGATCCAACACCAUCC AAUUUGAUUG GGAAUUAUCU GUGUUACAAAAACACCAUCC AAUUUGAUUG GGAAUUAUCU GUGUUACAAA AAACACCAUCC AAUUUGAUUG GGAAUUAUCU GUGUUACAAA AAAAACACCAUCC AAUUUGAUUG GGAAUUAUCU GUGUUACAAA AAAAAAAACACCAUCC AAUUUGAUUG GGAAUUAUCU GUGUUACAAA AAAAAAAAAAAACACCAUCC AAUUUGAUUG GGAAUUAUCU GUGUUACAAA AAAAAAAAAAAARNA10 TAGAGTACGT AAGGAAAAGG AAAGGTTAAC CGCTATCAAA TGGCGAGAAGUAGAGUACGU AAGGAAAAGG AAAGGUUAAC CGCUAUCAAA AAAAAAAAAUAGAGUACGU AAGGAAAAGG AAAGGUUAAC CGCUAUCAAA AAAAAAAARNA11 TTTAGAACAG GAGAGTATAT TCTGGTAGTG GAAGTACGAA TTGAAGTGGAUUUAGAACAG GAGAGUAUAU UCUGGUAGUG GAAGUACGAA AAAAAAAAARNA12 TGTATGGGAT ATTTGTAGTA CACCTTGATT GGTTTTACTA TTTATACTTAUGUAUGGGAU AUUUGUAGUA CACCUUGAUU GGUUUUACUA AAAAAAAAAAAA (2)UGUAUGGGAU AUUUGUAGUA CACCUUGAUU GGUUUUACUA AAAAAAAAAAAAAUGUAUGGGAU AUUUGUAGUA CACCUUGAUU GGUUUUACUA AAAAAGAAAAAAAAAAAAUGUAUGGGAU AUUUGUAGUA CACCUUGAUU GGUUUUACUA AAAAAAAAAAAAAAAAAAAAAAAAARNA13 GATATATCAT TGGGAAGTTT AGCCAGGAAG TCAGCGTCTA TATTAAAAA5’ UGGGAAGUUU AGCCAGGAAG UCAGCGUCUA AAAAAAAAAAAAAA
  • 51. Fragment SequenceRNA14 TTAAGGATGA AACCTTCCTG ATCGACTCGT GAGGTAAAAG AAACAGTCCG5’ UUAAGGAUGA AACCUUCCUG AUCGACUCGU GAGGUAAAAG AAUUAAGGAUGA AACCUUCCUG AUCGACUCGU GAGGUAAAAG AAAUUAAGGAUGA AACCUUCCUG AUCGACUCGU GAGGUAAAAG AAAAAAAAUUAAGGAUGA AACCUUCCUG AUCGACUCGU GAGGUAAAAG AAAAAAAAAAUUAAGGAUGA AACCUUCCUG AUCGACUCGU GAGGUAAAAG AAAAAAAAAAAAAAARNA15 GCTATCAAAT GGCGAGAAGG GAAGTGTGTT TCCATAGAAA CCTTGTATAT5’ U GGCGAGAAGG GAAGUGUGUU UCCAUAGAAA AAAAAAAAARNA16 TATAATAAAG CTTTTGGTAT CTCGTAATGT AGAACAATAT TGAGTTGACC5’ G CUUUUGGUAU CUCGUAAUGU AGAACAAUAU AG CUUUUGGUAU CUCGUAAUGU AGAACAAUAU AA (3)G CUUUUGGUAU CUCGUAAUGU AGAACAAUAU AAAA (3)G CUUUUGGUAU CUCGUAAUGU AGAACAAUAU AAAAAAAAAAAAAARNA17 TTTTTGATCC CAGGCTGGTA AAAAATGTAA ACTTTTAGCC CATAAGAATAUUUUUGAUCC CAGGCUGGUA AAAAAUGUAA ACUUUUAGCC AAAAAAARNA18 ATACTTATCG ATAAATGTTC GGTATTGCAT GCCTGGTGTT TTTAATATAG5’ UGUUC GGUAUUGCAU GCCUGGUGUU AAAAAAAAA (2)UGUUC GGUAUUGCAU GCCUGGUGUU AAAAAAAAAAAUGUUC GGUAUUGCAU GCCUGGUGUU AAAAAAAAAAAAUGUUC GGUAUUGCAU GCCUGGUGUU AAAAAAAAAAAAAAA (2)RNA19 TTCCCTAAAA GTTCTTATGT GTTGGCATGG TTACGAGATT AAGGATGTTT5’ GUUCUUAUGU GUUGGCAUGG UUACGAGAUU AAAAAAAAGUUCUUAUGU GUUGGCAUGG UUACGAGAUU AAAAAAAAAGUUCUUAUGU GUUGGCAUGG UUACGAGAUU AAAAAAAAAAAAAGUUCUUAUGU GUUGGCAUGG UUACGAGAUU AAAAAAAAAAAAAAAGUUCUUAUGU GUUGGCAUGG UUACGAGAUU AAAAAAAAAAAAAAAAAA (2)RNA20 ATTGAGTTGA CCGTCAAATC CTTTTCATTA AAAGAGTGGA TTAAATGCCC5’ UGAGUUGA CCGUCAAAUC CUUUUCAUUA AAAGAGUGGA AAAAAAAAAAAUGAGUUGA CCGUCAAAUC CUUUUCAUUA AAAGAGUGGA AAAAAAAAAAAAAAAAAAAA (2)RNA21 AGCATGGGAC TAAAAAATGT TATGTTGTTG GTTTAAGCCC TATTACCATAAGCATGGGAC TAAAAAATGT TATGTTGTTG GTTTAAGCCC AAAAAAAGCATGGGAC TAAAAAATGT TATGTTGTTG GTTTAAGCCC AAAAAAA (2)AGCATGGGAC TAAAAAATGT TATGTTGTTG GTTTAAGCCC AAAAAAAARNA22 GATTAAAAGA CATCGATATA CGGATTTCTC CTGAAAAAAC GCGAAAAACC5’ UUAAAAGA CAUCGAUAUA CGGAUUUCUC CUGAAAAAAC AAThe top sequence (in bold italics) for each set of RACE data corresponds to the genomic DNA sequence.Numbers in parentheses indicate how often that size of tail was found.
  • 52. Table S6. Abutted P. falciparum mt gene setsDescription Members Size (nt)RNA16 to RNA17 4 163RNA8 to RNA13 12 959cox3 to LSUG 6a1205cox1 to RNA4 3 2660aIf RNA23t through RNA27t are included, this run is cox3 to RNA23t, 10 members, 1317 nt.
  • 53. Table S7. Fragment placement in rRNA alignments for covariationanalysisFragmentarRNAbHemosporidianscCoccidiandPiroplasmseSSUA SSU +f+ +SSUB SSU + + +SSUD SSU + + +SSUE SSU + + +SSUF SSU + + +LSUA LSU + + +LSUB LSU + + +LSUC LSU + + +LSUD LSU + + +LSUE LSU + + +LSUF LSU + + +LSUG LSU + + +RNA1 LSU + + +RNA2 LSU + + +RNA3 LSU + + +RNA5 SSU +RNA6 LSU + +RNA8 SSU + + +RNA9 SSU + +RNA10 LSU + + +RNA11 LSU + +RNA12 SSU +RNA13 LSU + + +RNA14 SSU + +RNA17 SSU + + +RNA18 LSU + + +RNA19 SSU +COUNTS 27 20 24aGene names are as defined in Table 1.bLSU, large subunit rRNA; SSU, small subunit rRNA. Fragments not assigned: RNA4, RNA7, RNA15,RNA16, RNA20, RNA21, RNA22, RNA23t, RNA24t, RNA25t, RNA26t, RNA27t.cRNAs from Plasmodium and related species that were used for co-variation analysis.dRNAs from Eimeria tenella that were used for co-variation analysis.eRNAs from Babesia and Theileria that were used for co-variation analysis.f+, present; blank if absent.
  • 54. Table S8. Prospective covariations found in fragmented apicomplexan mt rRNA genes.rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgLSU581,1259(LSUA,RNA1)2ug=( 16, 16.00, 94.1%) h, iag=( 1, 1.00, 5.9%)ug=( 16, 16.00, 94.1%) jag=( 1, 1.00, 5.9%)ug=( 16, 12.36, 72.7%)aa=( 5, 1.36, 22.7%)ag=( 1, 4.64, 4.5%)LSU583,1257(LSUA,RNA1)2ac=(192, 192.00, 97.0%)gc=( 6, 6.00, 3.0%)ac=(192, 192.00, 97.0%)gc=( 6, 6.00, 3.0%)ac=(192, 184.54, 93.2%)uu=( 8, 0.31, 3.9%)gc=( 6, 5.77, 2.9%)LSU589,668(LSUA)2cg=(198, 198.00, 100.0%) cg=(199, 199.00, 100.0%) cg=(199, 191.31, 96.1%)au=( 5, 0.19, 2.4%)gu=( 3, 0.12, 1.4%)LSU590,667(LSUA)2au=(198, 198.00, 100.0%) au=(198, 198.00, 99.5%)aa=( 1, 1.00, 0.5%)au=(198, 190.35, 95.7%)ua=( 8, 0.35, 3.9%)aa=( 1, 8.65, 0.5%)LSU591,666(LSUA)2ua=(198, 198.00, 100.0%) ua=(198, 198.00, 99.5%)aa=( 1, 1.00, 0.5%)ua=(198, 190.35, 95.7%)au=( 8, 0.35, 3.9%)aa=( 1, 8.65, 0.5%)LSU672,808(LSUA)1ug=(198, 198.00, 100.0%) ug=(199, 199.00, 100.0%) ug=(199, 191.31, 96.1%)au=( 8, 0.31, 3.9%)LSU679,798(LSUA)2cg=(200, 200.00, 98.5%)-g=( 3, 3.00, 1.5%)cg=(201, 201.00, 98.5%)-g=( 3, 3.00, 1.5%)cg=(201, 193.42, 94.8%)aa=( 8, 0.30, 3.8%)-g=( 3, 2.89, 1.4%)LSU680,797(LSUA)2au=(200, 200.00, 98.5%)-u=( 3, 3.00, 1.5%)au=(201, 201.00, 98.5%)-u=( 3, 3.00, 1.5%)au=(201, 193.42, 94.8%)ua=( 8, 0.30, 3.8%)-u=( 3, 2.89, 1.4%)LSU693,769(LSUA)2au=(200, 200.00, 98.5%)-u=( 3, 3.00, 1.5%)au=(200, 200.00, 98.0%)-u=( 3, 3.00, 1.5%)uu=( 1, 1.00, 0.5%)au=(200, 192.45, 94.3%)ua=( 8, 0.34, 3.8%)-u=( 3, 2.89, 1.4%)uu=( 1, 8.66, 0.5%)LSU694,768(LSUA)2cg=(200, 200.00, 98.5%)-g=( 3, 3.00, 1.5%)cg=(200, 200.00, 98.0%)-g=( 3, 3.00, 1.5%)ag=( 1, 1.00, 0.5%)cg=(200, 192.45, 94.3%)ua=( 8, 0.30, 3.8%)-g=( 3, 2.89, 1.4%)ag=( 1, 0.96, 0.5%)
  • 55. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgLSU695,767(LSUA)2gc=(200, 200.00, 98.5%)-c=( 3, 3.00, 1.5%)gc=(200, 200.00, 98.0%)-c=( 3, 3.00, 1.5%)ac=( 1, 1.00, 0.5%)gc=(200, 192.45, 94.3%)au=( 8, 0.34, 3.8%)-c=( 3, 2.89, 1.4%)ac=( 1, 8.66, 0.5%)LSU696,766(LSUA)2au=(200, 200.00, 98.5%)-u=( 3, 3.00, 1.5%)au=(201, 201.00, 98.5%)-u=( 3, 3.00, 1.5%)au=(201, 193.42, 94.8%)ua=( 8, 0.30, 3.8%)-u=( 3, 2.89, 1.4%)LSU697,765(LSUA)1au=(203, 203.00, 100.0%) au=(204, 204.00, 100.0%) au=(204, 196.30, 96.2%)ua=( 8, 0.30, 3.8%)LSU698,763(LSUA)2cg=(203, 203.00, 97.1%)ug=( 6, 6.00, 2.9%)cg=(204, 204.00, 97.1%)ug=( 6, 6.00, 2.9%)cg=(204, 198.39, 93.6%)ug=( 8, 8.75, 3.7%)au=( 5, 0.11, 2.3%)ua=( 1, 0.04, 0.5%)LSU700,732(LSUA)2gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 205.19, 96.3%)au=( 5, 0.19, 2.3%)ac=( 2, 6.81, 0.9%)gu=( 1, 5.81, 0.5%)LSU701,731(LSUA)1gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 202.29, 96.3%)ua=( 8, 0.29, 3.7%)LSU741,756(LSUA)1gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 202.29, 96.3%)cg=( 8, 0.29, 3.7%)LSU744,753(LSUA)1ua=(209, 209.00, 100.0%) ua=(210, 210.00, 100.0%) ua=(210, 202.29, 96.3%)cg=( 8, 0.29, 3.7%)LSU779,785(LSUA)1ug=(209, 209.00, 100.0%) ug=(210, 210.00, 100.0%) ug=(210, 202.29, 96.3%)au=( 8, 0.29, 3.7%)LSU824,833(LSUA)1ua=(208, 207.00, 99.5%)au=( 1, 0.00, 0.5%)ua=(209, 208.00, 99.5%)au=( 1, 0.00, 0.5%)ua=(217, 216.00, 99.5%)au=( 1, 0.00, 0.5%)LSU946,971(RNA2)1au=(209, 209.00, 100.0%) au=(209, 208.00, 99.5%)gc=( 1, 0.00, 0.5%)au=(209, 200.37, 95.9%)gc=( 9, 0.37, 4.1%)
  • 56. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgLSU950,967(RNA2)1cg=(208, 207.00, 99.5%)ua=( 1, 0.00, 0.5%)cg=(209, 208.00, 99.5%)ua=( 1, 0.00, 0.5%)cg=(209, 200.37, 95.9%)au=( 8, 0.29, 3.7%)ua=( 1, 0.00, 0.5%)LSU953,964(RNA2)2gg=(209, 209.00, 100.0%) gg=(209, 209.00, 99.5%)ug=( 1, 1.00, 0.5%)gg=(209, 201.33, 95.9%)ua=( 8, 0.33, 3.7%)ug=( 1, 8.67, 0.5%)LSU976,987(RNA2)1ug=(209, 209.00, 100.0%) ug=(210, 210.00, 100.0%) ug=(210, 202.29, 96.3%)au=( 6, 0.17, 2.8%)gc=( 2, 0.02, 0.9%)LSU977,986(RNA2)1gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 202.29, 96.3%)cg=( 8, 0.29, 3.7%)LSU1002,1153(RNA2,RNA11)1cg=(209, 209.00, 100.0%) cg=(209, 209.00, 100.0%) cg=(209, 201.29, 96.3%)aa=( 8, 0.29, 3.7%)LSU1164,1185(RNA11)1au=(209, 209.00, 100.0%) au=(209, 209.00, 100.0%) au=(209, 201.29, 96.3%)ua=( 8, 0.29, 3.7%)LSU1166,1183(RNA11)2au=(209, 209.00, 100.0%) au=(209, 209.00, 100.0%) au=(209, 203.22, 96.3%)gc=( 6, 0.22, 2.8%)gu=( 2, 7.78, 0.9%)LSU1196,1250(RNA11,RNA1)2gu=(207, 207.00, 99.0%)uu=( 2, 2.00, 1.0%)gu=(207, 207.00, 99.0%)uu=( 2, 2.00, 1.0%)gu=(207, 199.37, 95.4%)ua=( 8, 0.37, 3.7%)uu=( 2, 9.63, 0.9%)LSU1198,1247(RNA11,RNA1)2ua=(208, 208.00, 99.5%)ug=( 1, 1.00, 0.5%)ua=(208, 208.00, 99.5%)ug=( 1, 1.00, 0.5%)ua=(208, 200.33, 95.9%)au=( 8, 0.29, 3.7%)ug=( 1, 0.96, 0.5%)LSU1656,2004(RNA3,LSUE)2ca=(202, 202.00, 96.7%)ua=( 6, 6.00, 2.9%)aa=( 1, 1.00, 0.5%)ca=(203, 203.00, 96.7%)ua=( 6, 6.00, 2.9%)aa=( 1, 1.00, 0.5%)ca=(203, 195.55, 93.1%)au=( 8, 0.33, 3.7%)ua=( 6, 5.78, 2.8%)aa=( 1, 8.67, 0.5%)LSU1658,2002(RNA3,LSUE)1au=(209, 209.00, 100.0%) au=(210, 210.00, 100.0%) au=(210, 202.29, 96.3%)ua=( 8, 0.29, 3.7%)
  • 57. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgLSU1659,2001(RNA3,LSUE)2cg=(198, 189.47, 94.7%)ua=( 4, 0.11, 1.9%)au=( 4, 0.08, 1.9%)ug=( 2, 5.74, 1.0%)gc=( 1, 0.00, 0.5%)cg=(199, 190.47, 94.8%)ua=( 4, 0.11, 1.9%)au=( 4, 0.08, 1.9%)ug=( 2, 5.74, 1.0%)gc=( 1, 0.00, 0.5%)cg=(199, 183.48, 91.3%)ua=( 12, 0.77, 5.5%)au=( 4, 0.07, 1.8%)ug=( 2, 12.91, 0.9%)gc=( 1, 0.00, 0.5%)LSU1661,1999(RNA3,LSUE)2ug=(209, 209.00, 100.0%) ug=(209, 209.00, 99.5%)ua=( 1, 1.00, 0.5%)ug=(209, 201.33, 95.9%)gc=( 8, 0.29, 3.7%)ua=( 1, 0.96, 0.5%)LSU1663,1997(RNA3,LSUE)1au=(209, 209.00, 100.0%) au=(210, 210.00, 100.0%) au=(210, 202.29, 96.3%)gc=( 8, 0.29, 3.7%)LSU1766,1986(LSUD,LSUE)1gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 202.29, 96.3%)au=( 8, 0.29, 3.7%)LSU1767,1985(LSUD,LSUE)1gc=(208, 207.00, 99.5%)au=( 1, 0.00, 0.5%)gc=(208, 206.02, 99.0%)au=( 2, 0.02, 1.0%)gc=(216, 214.02, 99.1%)au=( 2, 0.02, 0.9%)LSU1794,1825(LSUD)1ua=(209, 209.00, 100.0%) ua=(209, 208.00, 99.5%)au=( 1, 0.00, 0.5%)ua=(209, 200.37, 95.9%)au=( 9, 0.37, 4.1%)LSU1795,1824(LSUD)2cu=(208, 208.00, 99.5%)uu=( 1, 1.00, 0.5%)cu=(209, 209.00, 99.5%)uu=( 1, 1.00, 0.5%)cu=(213, 209.09, 97.7%)ua=( 3, 0.07, 1.4%)uc=( 1, 0.02, 0.5%)uu=( 1, 4.91, 0.5%)LSU1797,1822(LSUD)1cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(210, 202.29, 96.3%)au=( 8, 0.29, 3.7%)LSU1800,1817(LSUD)1au=(209, 209.00, 100.0%) au=(209, 208.00, 99.5%)cg=( 1, 0.00, 0.5%)au=(209, 200.37, 95.9%)cg=( 9, 0.37, 4.1%)LSU1804,1813(LSUD)2ua=(202, 201.03, 96.7%)ca=( 6, 6.97, 2.9%)cg=( 1, 0.03, 0.5%)ua=(202, 200.08, 96.2%)ca=( 6, 7.92, 2.9%)cg=( 2, 0.08, 1.0%)ua=(202, 192.73, 92.7%)gc=( 8, 0.29, 3.7%)ca=( 6, 7.63, 2.8%)cg=( 2, 0.07, 0.9%)LSU1805,1812(LSUD)1ua=(209, 209.00, 100.0%) ua=(210, 210.00, 100.0%) ua=(210, 202.29, 96.3%)au=( 8, 0.29, 3.7%)
  • 58. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgLSU1806,1811(LSUD)2cg=(208, 207.00, 99.5%)ua=( 1, 0.00, 0.5%)cg=(208, 207.01, 99.0%)ua=( 1, 0.01, 0.5%)ug=( 1, 1.99, 0.5%)cg=(208, 199.41, 95.4%)ua=( 9, 0.41, 4.1%)ug=( 1, 9.59, 0.5%)LSU1830,1975(LSUD,LSUE)1cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(211, 204.22, 96.8%)ua=( 7, 0.22, 3.2%)LSU1831,1974(LSUD,LSUE)1au=(209, 209.00, 100.0%) au=(210, 210.00, 100.0%) au=(217, 216.00, 99.5%)gc=( 1, 0.00, 0.5%)LSU1836,1904(LSUD,LSUE)1cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(210, 206.07, 98.1%)uu=( 4, 0.07, 1.9%)LSU1837,1903(LSUD,LSUE)1cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(210, 206.07, 98.1%)uu=( 4, 0.07, 1.9%)LSU1843,1897(LSUD,LSUE)1ua=(209, 209.00, 100.0%) ua=(209, 208.00, 99.5%)cg=( 1, 0.00, 0.5%)ua=(209, 208.00, 99.5%)cg=( 1, 0.00, 0.5%)LSU1906,1924(LSUE)2gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 206.07, 98.1%)a-=( 2, 0.02, 0.9%)ua=( 2, 0.02, 0.9%)LSU1907,1923(LSUE)2gu=(209, 209.00, 100.0%) gu=(210, 210.00, 100.0%) gu=(210, 205.12, 97.7%)cg=( 2, 0.05, 0.9%)ug=( 2, 0.05, 0.9%)ag=( 1, 0.02, 0.5%)LSU1909,1921(LSUE)2ug=(209, 209.00, 100.0%) ug=(210, 210.00, 100.0%) ug=(211, 204.22, 96.8%)au=( 2, 0.05, 0.9%)a-=( 2, 0.05, 0.9%)ca=( 2, 0.03, 0.9%)aa=( 1, 0.07, 0.5%)LSU1925,1929(LSUE)2cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(210, 202.29, 96.3%)ac=( 3, 0.04, 1.4%)uu=( 3, 0.07, 1.4%)ua=( 2, 0.05, 0.9%)LSU1945,1961(LSUE)1gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 202.29, 96.3%)au=( 8, 0.29, 3.7%)
  • 59. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgLSU1947,1959(LSUE)2cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(210, 203.26, 96.3%)ua=( 7, 0.26, 3.2%)ug=( 1, 7.74, 0.5%)LSU1948,1958(LSUE)1gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(214, 210.07, 98.2%)au=( 4, 0.07, 1.8%)LSU1949,1957(LSUE)1gc=(208, 207.00, 99.5%)au=( 1, 0.00, 0.5%)gc=(209, 208.00, 99.5%)au=( 1, 0.00, 0.5%)gc=(209, 200.37, 95.9%)ua=( 8, 0.29, 3.7%)au=( 1, 0.00, 0.5%)LSU1950,1956(LSUE)2gu=(206, 204.03, 98.6%)aa=( 2, 0.03, 1.0%)ga=( 1, 2.97, 0.5%)gu=(207, 205.03, 98.6%)aa=( 2, 0.03, 1.0%)ga=( 1, 2.97, 0.5%)gu=(207, 197.50, 95.0%)ca=( 8, 0.40, 3.7%)aa=( 2, 0.10, 0.9%)ga=( 1, 10.50, 0.5%)LSU2024,2039(LSUE)2ua=(208, 208.00, 99.5%)ug=( 1, 1.00, 0.5%)ua=(209, 209.00, 99.5%)ug=( 1, 1.00, 0.5%)ua=(209, 201.33, 95.9%)gc=( 8, 0.29, 3.7%)ug=( 1, 0.96, 0.5%)LSU2025,2038(LSUE)1cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(213, 208.11, 97.7%)au=( 5, 0.11, 2.3%)LSU2026,2037(LSUE)1cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(210, 202.29, 96.3%)ua=( 8, 0.29, 3.7%)LSU2027,2036(LSUE)1au=(209, 209.00, 100.0%) au=(209, 208.00, 99.5%)ua=( 1, 0.00, 0.5%)au=(209, 200.37, 95.9%)ua=( 9, 0.37, 4.1%)LSU2047,2621(LSUE,LSUG)2cg=(208, 207.00, 99.5%)ua=( 1, 0.00, 0.5%)cg=(208, 206.02, 99.0%)ua=( 2, 0.02, 1.0%)cg=(208, 198.46, 95.4%)ua=( 9, 0.41, 4.1%)uu=( 1, 0.05, 0.5%)LSU2048,2620(LSUE,LSUG)2gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 202.29, 96.3%)au=( 7, 0.26, 3.2%)aa=( 1, 0.04, 0.5%)LSU2049,2619(LSUE,LSUG)1gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 202.29, 96.3%)cg=( 8, 0.29, 3.7%)LSU2080,2240(LSUE,RNA13)2ua=(209, 209.00, 100.0%) ua=(210, 210.00, 100.0%) ua=(216, 215.01, 99.1%)cg=( 1, 0.01, 0.5%)ug=( 1, 1.99, 0.5%)
  • 60. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgLSU2461,2489(LSUF)1gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(213, 208.11, 97.7%)au=( 5, 0.11, 2.3%)LSU2462,2488(LSUF)1ua=(206, 203.04, 98.6%)au=( 3, 0.04, 1.4%)ua=(206, 202.08, 98.1%)au=( 4, 0.08, 1.9%)ua=(206, 194.66, 94.5%)au=( 12, 0.66, 5.5%)LSU2463,2487(LSUF)1au=(209, 209.00, 100.0%) au=(210, 210.00, 100.0%) au=(210, 202.09, 96.3%)ua=( 8, 0.29, 3.7%)LSU2466,2484(LSUF)2ua=(209, 209.00, 100.0%) ua=(209, 209.00, 99.5%)ug=( 1, 1.00, 0.5%)ua=(209, 201.33, 95.9%)au=( 8, 0.29, 3.7%)ug=( 1, 0.96, 0.5%)LSU2470,2480(LSUF)2gc=(207, 205.02, 99.0%)au=( 2, 0.02, 1.0%)gc=(208, 206.02, 99.0%)au=( 2, 0.02, 1.0%)gc=(208, 198.46, 95.4%)au=( 4, 0.11, 1.8%)ug=( 3, 0.06, 1.4%)aa=( 2, 0.08, 0.9%)ua=( 1, 0.06, 0.5%)LSU2514,2570(LSUF,LSUG)1ua=(209, 209.00, 100.0%) ua=(210, 210.00, 100.0%) ua=(210, 202.29, 96.3%)cg=( 8, 0.29, 3.7%)LSU2516,2568(LSUF,LSUG)1gc=(209, 209.00, 100.0%) gc=(209, 208.00, 99.5%)au=( 1, 0.00, 0.5%)gc=(209, 200.37, 95.9%)au=( 9, 0.37, 4.1%)LSU2517,2567(LSUF,LSUG)1cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(210, 202.29, 96.3%)ua=( 8, 0.29, 3.7%)LSU2524,2539(LSUG)2gc=(208, 208.00, 99.5%)gu=( 1, 1.00, 0.5%)gc=(209, 209.00, 99.5%)gu=( 1, 1.00, 0.5%)gc=(209, 201.33, 95.9%)au=( 8, 0.33, 3.7%)gu=( 1, 8.67, 0.5%)LSU2527,2536(LSUG)1cg=(195, 181.94, 93.3%)ua=( 14, 0.94, 6.7%)cg=(196, 182.93, 93.3%)ua=( 14, 0.93, 6.7%)cg=(204, 190.90, 93.6%)ua=( 14, 0.90, 6.4%)LSU2547,2561(LSUG)1au=(207, 205.02, 99.0%)ua=( 2, 0.02, 1.0%)au=(208, 206.02, 99.0%)ua=( 2, 0.02, 1.0%)au=(216, 214.02, 99.1%)ua=( 2, 0.02, 0.9%)LSU2594,2599(LSUG)1cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(213, 208.11, 97.7%)ua=( 5, 0.11, 2.3%)
  • 61. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgLSU2742,2762(RNA6)2ug=(195, 195.00, 93.3%)cg=( 14, 14.00, 6.7%)ug=(195, 195.00, 93.3%)cg=( 14, 14.00, 6.7%)ug=(195, 187.81, 89.9%)cg=( 14, 13.48, 6.5%)au=( 8, 0.29, 3.7%)LSU2743,2761(RNA6)2au=(206, 206.00, 98.6%)uu=( 3, 3.00, 1.4%)au=(206, 206.00, 98.6%)uu=( 3, 3.00, 1.4%)au=(206, 198.41, 94.9%)ug=( 8, 0.41, 3.7%)uu=( 3, 10.59, 1.4%)LSU2744,2760(RNA6)2gu=(209, 209.00, 100.0%) gu=(209, 209.00, 100.0%) gu=(209, 201.29, 96.3%)aa=( 8, 0.29, 3.7%)SSU27,556(RNA14,SSUA)2gc=(208, 208.00, 99.5%)ac=( 1, 1.00, 0.5%)gc=(208, 208.00, 99.5%)ac=( 1, 1.00, 0.5%)gc=(208, 200.33, 95.9%)aa=( 8, 0.33, 3.7%)ac=( 1, 8.67, 0.5%)SSU28,555(RNA14,SSUA)1gc=(209, 209.00, 100.0%) gc=(209, 209.00, 100.0%) gc=(209, 201.29, 96.3%)ua=( 8, 0.29, 3.7%)SSU30,553(RNA14,SSUA)2ua=(209, 209.00, 100.0%) ua=(209, 209.00, 100.0%) ua=(209, 202.26, 96.3%)cg=( 7, 0.26, 3.2%)ug=( 1, 7.74, 0.5%)SSU32,552(RNA14,SSUA)1au=(209, 209.00, 100.0%) au=(209, 209.00, 100.0%) au=(209, 201.29, 96.3%)ua=( 8, 0.29, 3.7%)SSU39,403(RNA14)2cg=(205, 205.00, 98.1%)gg=( 3, 3.00, 1.4%)ag=( 1, 1.00, 0.5%)cg=(205, 205.00, 98.1%)gg=( 3, 3.00, 1.4%)ag=( 1, 1.00, 0.5%)cg=(205, 197.44, 94.5%)gc=( 5, 0.18, 2.3%)au=( 3, 0.06, 1.4%)gg=( 3, 7.71, 1.4%)ag=( 1, 3.85, 0.5%)SSU40,402(RNA14)2cg=(206, 206.00, 98.6%)ag=( 3, 3.00, 1.4%)cg=(206, 206.00, 98.6%)ag=( 3, 3.00, 1.4%)cg=(206, 198.41, 94.9%)ua=( 8, 0.29, 3.7%)ag=( 3, 2.89, 1.4%)SSU41,401(RNA14)1ua=(209, 209.00, 100.0%) ua=(209, 209.00, 100.0%) ua=(214, 211.04, 98.6%)au=( 3, 0.04, 1.4%)SSU293,304(RNA17)2gc=(209, 209.00, 100.0%) gc=(209, 209.00, 99.5%)ga=( 1, 1.00, 0.5%)gc=(209, 201.33, 95.9%)au=( 8, 0.29, 3.7%)ga=( 1, 0.96, 0.5%)
  • 62. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgSSU504,541(SSUA)2ug=(110, 110.00, 52.6%)cg=( 98, 98.00, 46.9%)gg=( 1, 1.00, 0.5%)ug=(111, 111.00, 52.9%)cg=( 98, 98.00, 46.7%)gg=( 1, 1.00, 0.5%)ug=(111, 106.93, 50.9%)cg=( 98, 94.40, 45.0%)au=( 8, 0.29, 3.7%)gg=( 1, 0.96, 0.5%)SSU505,526(SSUA)2ga=(207, 207.00, 99.0%)aa=( 2, 2.00, 1.0%)ga=(208, 208.00, 99.0%)aa=( 2, 2.00, 1.0%)ga=(208, 200.37, 95.4%)ac=( 8, 0.37, 3.7%)aa=( 2, 9.63, 0.9%)SSU507,524(SSUA)2ua=(209, 209.00, 100.0%) ua=(209, 208.00, 99.5%)ag=( 1, 0.00, 0.5%)ua=(209, 200.37, 95.9%)ag=( 9, 0.37, 4.1%)SSU511,540(SSUA)2ug=(209, 209.00, 100.0%) ug=(209, 208.00, 99.5%)cu=( 1, 0.00, 0.5%)ug=(210, 209.04, 96.3%)ua=( 7, 6.97, 3.2%)cu=( 1, 0.00, 0.5%)SSU513,538(SSUA)2cu=(209, 209.00, 100.0%) cu=(209, 208.00, 99.5%)aa=( 1, 0.00, 0.5%)cu=(209, 208.04, 95.9%)cg=( 8, 7.96, 3.7%)aa=( 1, 0.00, 0.5%)SSU585,756(SSUA,RNA8)2ug=(206, 206.00, 99.0%)ua=( 2, 2.00, 1.0%)ug=(207, 207.00, 99.0%)ua=( 2, 2.00, 1.0%)ug=(207, 199.37, 95.4%)gu=( 8, 0.29, 3.7%)ua=( 2, 1.93, 0.9%)SSU772,807(RNA8)2ug=(207, 207.00, 99.5%)ua=( 1, 1.00, 0.5%)ug=(207, 207.00, 99.0%)ag=( 1, 1.00, 0.5%)ua=( 1, 1.00, 0.5%)ug=(207, 199.37, 95.4%)gc=( 5, 0.18, 2.3%)gu=( 3, 0.11, 1.4%)ag=( 1, 0.96, 0.5%)ua=( 1, 0.96, 0.5%)SSU774,805(RNA8)2ac=(208, 208.00, 100.0%) ac=(208, 208.00, 99.5%)uc=( 1, 1.00, 0.5%)ac=(208, 200.33, 95.9%)uu=( 8, 0.33, 3.7%)uc=( 1, 8.67, 0.5%)SSU778,804(RNA8)2gc=(206, 206.00, 99.0%)gu=( 2, 2.00, 1.0%)gc=(207, 207.00, 99.0%)gu=( 2, 2.00, 1.0%)gc=(207, 199.37, 95.4%)ua=( 8, 0.29, 3.7%)gu=( 2, 1.93, 0.9%)SSU784,798(RNA8)2ug=(201, 201.00, 96.6%)ua=( 7, 7.00, 3.4%)ug=(201, 201.00, 96.2%)ua=( 8, 8.00, 3.8%)ug=(201, 193.59, 92.6%)au=( 8, 0.29, 3.7%)ua=( 8, 7.71, 3.7%)
  • 63. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgSSU885,912(SSUB)2gc=(209, 209.00, 100.0%) gc=(209, 209.00, 99.5%)gu=( 1, 1.00, 0.5%)gc=(209, 201.33, 95.9%)ua=( 8, 0.29, 3.7%)gu=( 1, 0.96, 0.5%)SSU894,905(SSUB)2gu=(208, 208.00, 99.5%)gc=( 1, 1.00, 0.5%)gu=(209, 209.00, 99.5%)gc=( 1, 1.00, 0.5%)gu=(209, 201.33, 95.9%)ua=( 8, 0.29, 3.7%)gc=( 1, 0.96, 0.5%)SSU895,904(SSUB)2ug=(207, 207.00, 99.0%)ua=( 2, 2.00, 1.0%)ug=(208, 208.00, 99.0%)ua=( 2, 2.00, 1.0%)ug=(208, 204.18, 95.4%)ua=( 5, 4.91, 2.3%)au=( 4, 0.09, 1.8%)uu=( 1, 4.91, 0.5%)SSU930,1387(SSUB,SSUD)2cg=(208, 208.00, 99.5%)ug=( 1, 1.00, 0.5%)cg=(208, 208.00, 99.0%)ug=( 2, 2.00, 1.0%)cg=(208, 200.37, 95.4%)ua=( 8, 0.37, 3.7%)ug=( 2, 9.63, 0.9%)SSU931,1386(SSUB,SSUD)1au=(209, 209.00, 100.0%) au=(210, 210.00, 100.0%) au=(213, 208.11, 97.7%)gc=( 5, 0.11, 2.3%)SSU933,1384(SSUB,SSUD)1ag=(209, 209.00, 100.0%) ag=(209, 209.00, 100.0%) ag=(209, 201.29, 96.3%)ga=( 8, 0.29, 3.7%)SSU939,1344(SSUB,SSUD)2gu=(208, 208.00, 99.5%)au=( 1, 1.00, 0.5%)gu=(208, 208.00, 99.0%)au=( 2, 2.00, 1.0%)gu=(208, 200.37, 95.4%)ua=( 8, 0.29, 3.7%)au=( 2, 1.93, 0.9%)SSU941,1342(SSUB,SSUD)1gc=(209, 209.00, 100.0%) gc=(210, 210.00, 100.0%) gc=(210, 202.29, 96.3%)au=( 8, 0.29, 3.7%)SSU962,973(SSUB)1ua=(106, 53.76, 50.7%)cg=(103, 50.76, 49.3%)ua=(106, 53.50, 50.5%)cg=(104, 51.50, 49.5%)ua=(114, 59.61, 52.3%)cg=(104, 49.61, 47.7%)SSU986,1219(SSUB,RNA9)1au=(209, 209.00, 100.0%) au=(209, 209.00, 100.0%) au=(209, 201.29, 96.3%)ga=( 8, 0.29, 3.7%)SSU989,1216(SSUB,RNA9)2cg=(207, 205.02, 99.0%)au=( 1, 0.00, 0.5%)ua=( 1, 0.00, 0.5%)cg=(207, 205.02, 99.0%)au=( 1, 0.00, 0.5%)ua=( 1, 0.00, 0.5%)cg=(207, 197.46, 95.4%)aa=( 8, 0.37, 3.7%)au=( 1, 0.04, 0.5%)ua=( 1, 0.04, 0.5%)
  • 64. rRNAaPairb(Fragmentsc)CategorydHemosporidiane+ Coccidianf+ PiroplasmgSSU1411,1489(SSUE,SSUF)1cg=(209, 209.00, 100.0%) cg=(210, 210.00, 100.0%) cg=(210, 202.29, 96.3%)ua=( 8, 0.29, 3.7%)SSU1514,1521(SSUF)1au=(209, 209.00, 100.0%) au=(209, 208.00, 99.5%)gc=( 1, 0.00, 0.5%)au=(217, 216.00, 99.5%)gc=( 1, 0.00, 0.5%)aLSU, large subunit ribosomal RNA; SSU, small subunit ribosomal RNA.bBase pairs with significant potential covariation are shown. Pairs are named using the E. coli rRNA reference structure model numbering.cFragment containing each position (not repeated if both positions are in the same fragment).dCategory 1, strong covariation signal without exceptions (red in Figures S9-S11); 2, covariation signal with exceptions (blue in Figures S9-S11).e200 sequences from Plasmodium and nine related hemosporidians, for a total of 209 sequences.fAll sequences from the hemosporidian alignment, plus one coccidian sequence, for a total of 210 sequences.gAll sequences from the hemosporidian and coccidian alignment, plus eight piroplasm sequences, for a total of 218 sequences.hBackground shading: red, invariant; green, coccidian does not add information to hemosporidian; blue, piroplasm does not add information to coccidian.iCovariation data: <base pair type>=(<number of occurrences observed in dataset>, <number of occurrences expected based upon random distribution ofobserved nucleotides at the two positions>, <percentage of sequences containing the base pair type>).jText color: green, coccidian has that combination at that base pair (may overlap with hemosporidian); blue, at least one of the eight piroplasm sequenceshas that combination at that base pair (may overlap with hemosporidian and/or coccidian).
  • 65. Table S9. Correspondence of P. falciparum and C. elegans mt rRNAs.SSUhelixaP. falciparumbC. elegansb9 missing present17 missing present27 RNA14:SSUA present39 RNA14 present122 RNA12 missing240 RNA12 missing289 RNA17 missing500 SSUA present505 SSUA present511 SSUA present567 SSUA:SSUB present575 SSUA:SSUB present577 SSUA:RNA8 present655 missing present; short673 missing present722 missing present769 RNA8 present821 RNA8:SSUB missing885 SSUB present921 SSUB:SSUE present939 SSUB:SSUD present944 SSUB:RNA9 present960 SSUB present984 SSUB:RNA9 present1047 RNA19:RNA9; short present1068 missing present1074 missing present1303 SSUD:RNA5 present1350 SSUD present1399 SSUE:SSUF; short present; short1506 SSUF present5’ LSUhelixaP. falciparumbC. elegansb563 missing present579 LSUA:RNA1 present589 LSUA; short present; short671 LSUA present687 LSUA present700 LSUA: short missing736 LSUA present777 LSUA present812 LSUA present822 LSUA missing946 RNA2 missing976 RNA2 missing991 RNA2:RNA11 unstructured1030 missing present, short1057 LSUB present1082 LSUB:LSUC missing1087 LSUC present1164 RNA11 missing1196 RNA11:RNA1, short present; short1262 RNA1:LSUE present1276 RNA1 missing1295 RNA1:RNA3 missingaHelix numbers correspond to the first nt in thecorresponding helices in E. coli rRNA secondarystructures3’LSUhelixaP. falciparumbC. elegansb1648 RNA3:LSUE missing1764 LSUD:LSUE present1775 LSUD present1782 LSUD present1792 LSUD present; short1830 LSUD:LSUE present1835 LSUD:LSUE; short present; short1906 LSUE present1925 LSUE present1935 LSUE present2023 LSUE present2043 LSUE:LSUG present2064 LSUE:LSUF present2077 LSUE:RNA13 present2246 RNA13 present2455 LSUF present2507 LSUF:LSUG present2520 LSUF:LSUG present2547 LSUG present2588 LSUG present2646 RNA10 present2675 RNA10/RNA18:RNA6 present; short2735 RNA6 presentbSignificant differences between P. falciparumand C. elegans rRNA structure (absence oraltered size) are in bold italic font