• Save
Gutell 069.mpe.2000.15.0083
Upcoming SlideShare
Loading in...5
×
 

Like this? Share it with your network

Share

Gutell 069.mpe.2000.15.0083

on

  • 251 views

 

Statistics

Views

Total Views
251
Views on SlideShare
251
Embed Views
0

Actions

Likes
0
Downloads
0
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

Gutell 069.mpe.2000.15.0083 Document Transcript

  • 1. Phylogenetic Analysis of Molluscan Mitochondrial LSU rDNASequences and Secondary StructuresCharles Lydeard,* Wallace E. Holznagel,* Murray N. Schnare,† and Robin R. Gutell‡*Biodiversity and Systematics, Department of Biological Sciences, University of Alabama, Box 870345, Tuscaloosa, Alabama 35487;†Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia B3H 4H7, Canada; and‡Institute for Cellular and Molecular Biology, University of Texas at Austin, 2500 Speedway, Austin, Texas 78712-1095Received March 30, 1999; revised July 26, 1999Mollusks are an extraordinarily diverse group ofanimals with an estimated 200,000 species, second onlyto the phylum Arthropoda. We conducted a compara-tive analysis of complete mitochondrial ribosomal largesubunit sequences (LSU) of a chiton, two bivalves, sixgastropods, and a cephalopod. In addition, we deter-mined secondary structure models for each of them.Comparative analyses of nucleotide variation revealedsubstantial length variation among the taxa, withstylommatophoran gastropods possessing the shortestlengths. Phylogenetic analyses of the nucleotide se-quence data supported the monophyly of Albinaria,Euhadra herklotsi ؉ Cepaea nemoralis, Stylommato-phora, Cerithioidea, and when only transversions areincluded, the Bivalvia. The phylogenetic limits of themitochondrial LSU rRNA gene within mollusks appearto be up to 400 million years, although this estimatewill have to be tested further with additional taxa. Ourmost novel finding was the discovery of phylogeneticsignal in the secondary structure of rRNA of mollusks.The absence of entire stem/loop structures in DomainsII, III, and V can be viewed as three shared derivedcharacters uniting the stylommatophoran gastropods.The absence of the aforementioned stem/loop struc-ture explains much of the observed length variation ofthe mitochondrial LSU rRNA found within mollusks.The distribution of these unique secondary structurecharacters within mollusks should be examined. ௠ 2000Academic PressKey Words: LSU mitochondrial DNA; 16S mitochon-drial DNA; 23S-like rRNA; ribosomal RNA secondarystructure; mollusks; bivalves; chiton; gastropods; pul-monates; molecular phylogeny; gene utilityINTRODUCTIONMolecular systematics and molecular evolution canbe reciprocally illuminating. Since molecular evolution-ary studies are conducted in a phylogenetic context,tremendous opportunity exists for improving the mod-els and assumptions used for phylogenetic reconstruc-tion. One important challenge is to distinguish phyloge-netically informative changes from potential ‘‘noise’’generated from multiple substitutions that may accrueat a single site. Conservative sites and changes arebetter indicators of phylogenetic history because theyare less likely to experience parallel and back muta-tions. For example, for deep phylogenetic questions, itis often best to downweight or exclude transitions in thethird codon position of a protein-encoding gene (e.g.,Lydeard and Roe, 1997).Knowledge of nucleotide substitution patterns helpsinvestigators make objective decisions regarding weight-ing to increase the likelihood of recovering an accuratephylogeny. Indeed, justification for a variety of com-monly employed weighting strategies was demon-strated in an analysis of linked mitochondrial genes inthe mammalian order Artiodactyla (Miyamoto et al.,1994). In addition to their value for understandingnucleotide substitution patterns, sequence alignmentsare crucial for phylogenetic reconstruction becausepositional homology is assumed to be accurate prior toestimating phylogeny. There are many ways to align anucleotide sequence data matrix: manual (visual) align-ment, a multiple sequence alignment software packagelike CLUSTAL W or MALIGN (Thompson et al., 1994;Wheeler and Gladstein, 1991; respectively), and utiliz-ing information from the structure of the gene. Manystudies have highlighted the importance of alignmenton phylogenetic reconstruction (e.g., Gatesy et al., 1993;Kjer, 1995; Hickson et al., 1996). Indeed, the use of theribosomal RNA (rRNA) secondary structure informa-tion in combination with a computer-assisted optimal-ity approach resulted in a marked increase in thenumber of alignments that recovered a topology congru-ent with a well-corroborated morphological hypothesisin comparison to those alignments based on the com-puter-assisted approach alone (Titus and Frost, 1996).Ribosomal RNA genes have received considerableattention from biologists. Because rRNAs are involvedin the synthesis of proteins and are present in all lifeforms (Woese, 1987; Woese et al., 1990), it was rational-Molecular Phylogenetics and EvolutionVol. 15, No. 1, April, pp. 83–102, 2000doi:10.1006/mpev.1999.0719, available online at http://www.idealibrary.com on831055-7903/00 $35.00Copyright ௠ 2000 by Academic PressAll rights of reproduction in any form reserved.
  • 2. ized that they will have an imprint of their evolutionaryhistory encoded in their sequence. The ribosomal smallsubunit (SSU) contains the 16S rRNA in prokaryotes,the 18S rRNA in the eukaryotic cytoplasm, and the 12SrRNA in animal mitochondria. The ribosomal largesubunit (LSU) contains the 23S rRNA in prokaryotes,the 26S–28S rRNA gene in the eukaryotic cytoplasm,and the 16S rRNA in animal mitochondria.Ribosomal RNA sequences fold into complex second-ary structures based largely on intramolecular basepairing. Experimental methods have elucidated someof the rRNA secondary and tertiary structure (Noller,1984, 1991; Zimmermann and Dahlberg, 1996). How-ever, the vast majority of the rRNA secondary structuremodels have been determined with comparative se-quence analyses (Woese et al., 1980; Noller et al., 1981;Gutell et al., 1994; Gutell, 1996). The comparativeapproach was first used to establish the so-calledcloverleaf configuration of tRNA and is based on posi-tional covariance in an alignment of RNA sequences(Gutell et al., 1994). Two positions covary when nucleo-tide substitutions at one column in a sequence align-ment are correlated with a similar pattern of substitu-tions at another position. The earliest models of rRNAsecondary structure have been improved over the years(see Gutell et al., 1993; Gutell, 1994) and additionalservices are provided by the Ribosomal Database Project(Maidak et al., 1997).Mitochondrial (mt) rRNA genes have attracted agreat deal of attention from molecular systematists(reviews by Mindell and Honeycutt, 1990; Hillis andDixon, 1991). Some of the earliest studies conductedsubstantiated the endosymbiotic model of eukaryoticorigin comparing mitochondrial ribosomal gene se-quences with homologous bacterial and nuclear cyto-plasmic genes of eukaryotes (Yang et al., 1985; Woese,1987). In addition, with the advent of mitochondrial‘‘universal’’ primers (Kocher et al., 1989; Palumbi et al.,1991; Simon et al., 1994), which permit the amplifica-tion of specific gene regions of homologous DNA via thepolymerase chain reaction (PCR) (Saiki et al., 1985),there has been a veritable explosion in studies employ-ing mt rRNA genes for systematic studies. Unfortu-nately, many investigators employing mt rRNA genesequences do not utilize information from the second-ary structure models to aid in the alignment of theirdata set and some use models proposed for distantlyrelated taxa. Part of the problem associated with usingsecondary structure models is simply the lack of avail-able rRNA sequences for many taxa. For example, ofthe 40 animal mitochondrial LSU complete or nearcomplete rRNA sequences reported in 1993, 7 are fromarthropods, 28 are from chordates (with ca. 85% of thechordates being mammals), 2 are from echinoderms, 2are from nematodes, and only 1 is from a mollusk(Gutell et al., 1993). One significantly underrepre-sented group is the phylum Mollusca.Mollusks are an extraordinarily diverse group ofanimals with an estimated 200,000 species, second onlyto the phylum Arthropoda. Mollusks constitute anamazing morphological array of species, including thefamiliar gastropods, cephalopods, scaphopods, bi-valves, and chitons and the more obscure Tryblidia,solenogasters, and scutopods. Mollusks made their firstfossil appearance in the Cambrian explosion along withmany other experimental ‘‘phylo-types,’’ and many ofthe classes appear shortly after the Cambrian explo-sion. Surprisingly, despite the ecological and/or eco-nomic importance of many of the species of mollusks,few molecular systematic studies have employed theuseful mt rRNA genes (e.g., Lieberman et al., 1993;Lydeard et al., 1996, 1997, 1998; Mulvey et al., 1997;Douris et al., 1998). The aforementioned studies thathave been conducted relied on arthropod secondarystructure models for alignment purposes.Today there are ca. 180 complete (or nearly so) LSUrRNA animal mitochondrial sequences. Of these, thereare 10 arthropod, 150 chordate, 6 echinoderm, 1 hemi-chordate, 2 annelid, and 10 mollusk sequences. Withinthe mollusks, there are 1 chiton, 2 bivalves, 6 gastro-pods, and 1 cephalopod. In this paper, we conduct acomparative analysis of the complete mollusk mt LSUsequences and determine secondary structure modelsfor them. As in the detailed analysis presented byHickson et al. (1996) on the third domain of animalmitochondrial SSU rRNA, these data will provide animportant foundation for future research on the mol-lusk mt LSU rRNA sequences.MATERIALS AND METHODSTable 1 lists the 10 mollusk species examined in thisstudy and their placement in a classification scheme ofmollusks (Salvini-Plawen and Steiner, 1996; Ponderand Lindberg, 1997; Vaught, 1989). Cacozeliana lac-ertina (New South Wales, Long Reef, collected, N ofSydney, 33°45ЈS, 151°19ЈE upper intertidal under rocksin gutters, 15 April 1996; source Winston Ponder;Sydney Museum, Australia) and Paracrostoma palu-diformis (labeled Brotia sp., Thailand, Field Museum ofNatural History FMNH 15706; species identified byMatthias Glaubrecht, Berlin Museum, Germany) ge-nomic DNA was isolated by standard phenol/chloro-form extraction. Approximately 100 ng of genomic DNAprovided a template for double-stranded reactions viathe PCR in 25 µl of a reaction solution containing eachdNTP at 0.1 mM, a pair of LSU primers at 10 µM, 4.0mM MgCl2, 2.5 µl 10ϫ reaction buffer, and 1.25 units ofAmpliTaq polymerase. DNAwas amplified for 32 cycles,each involving denaturation at 92°C for 45 s, annealingat 52°C for 45 s, and extension at 72°C for 60 s. The mtLSU rRNA amplification primer pairs used were LR-N-12948 and N1-J-12585 (modified from Simon et al.,1994), L2510 and H3080 (Palumbi et al., 1991), and84 LYDEARD ET AL.
  • 3. SR-14231 and SNL002 (Lydeard et al., 1997). Single-stranded DNA was obtained by asymmetric amplifica-tion (Gyllensten and Erlich, 1988) using a single primerin limited quantity, concentrated on Millipore UltrafreeMC filters, and sequenced using the Sequenase version2 kit (Amersham Life Science) with 35S-labeled dATP.In addition to the amplification primers, the followingprimers were used as independent sequencing primersto give overlapping fragment products: SNL-N-003,SNL-N-004, and LR-J-13114. Primer sequences orsources and relative position are provided in Table 2.The complete mtDNA LSU rRNA gene sequences forthe remaining mollusk and outgroup specimens (Table1) were retrieved from GenBank and include the follow-ing: Cepaea nemoralis (Terrett et al., 1996; U23045),Euhadra herklotsi (Yamazaki et al., unpublished;Z71693), Albinaria coerulea (Hatzoglou et al., 1995;X83390), Albinaria turrita (Lecanidou et al., 1994;X71393, X71394), Loligo bleekeri (Tomita et al., 1998;AB009838), Mytilus edulis (Hoffmann et al., 1992;M83756), Pecten maximus (Sellos, D., Mommerot, M.,and Rigaa, A., unpublished; X92688), Katharina tuni-cata (Boore and Brown, 1994; U09810), Lumbricusterrestris (Boore and Brown, 1995; U24570), and Dro-sophila melanogaster (Kobayashi and Okada, 1990;X53506).Secondary structure diagrams for the mollusk mito-chondrial LSU rRNAs were modeled from the current23S rRNA structure model with comparative sequenceanalysis (Gutell, 1996). This method is based on thesimple premise that RNAs within the same family (e.g.,23S rRNAs) have very similar secondary and tertiarystructures, regardless of the differences in their nucleo-tide sequences. Today, the starting point for our analy-sis is the comparatively inferred structure model andour structure-based alignment of 23S and 23S-like(LSU) rRNA sequences. In 1999, both the structuremodel and the alignments are well defined—havingundergone more than 15 years of analysis, evaluation,and refinement. For the current analysis, the mollusksequences were aligned with other invertebrate mito-chondrial sequences with the Escherichia coli 23SrRNA sequence included as a reference. Positions thatcan be aligned with the most confidence were alignedfirst. After the most conserved nucleotides were juxta-posed, positions with less sequence similarity werealigned and evaluated at base-paired positions for theirTABLE 3Summary Statistics of Structural Domains ofMitochondrial LSU rRNA of MollusksDomain RangeaNo. ofnucleotidesb PIcI 49–143 0 0I/II ‘‘link’’ 17–18 18 6II 327–422 218 167II/III ‘‘link’’ 9–14 14 7III 0–54 0 0IV 213–231 221 96IV/V ‘‘link’’ 32–34 34 22V 268–414 279 135VI 44–113 36 21a The min–max range of number of nucleotides within mollusks.b The number of unambiguously aligned nucleotides.c The number of phylogenetically informative sites among all taxawithin unambiguously aligned nucleotides.TABLE 1Representative Taxa and Classification Schemeof Taxa Used in the StudyMolluscaPolyplacophoraKatharina tunicataConchiferaBivalviaPteroideaPecten maximusMytiloideaMytilus edulisCephalopodaLoligo bleekeriGastropodaCaenogastropodaCerithioideaThiaridaeParacrostoma paludiformisBatillariidaeCacozeliana lacertinaHeterobranchiaStylommatophoraClausilioideaClausiliidaeAlbinaria turritaAlbinaria coeruleaHelicoideaBradybaenidaeEuhadra herklotsiHelicidaeCepaea nemoralisTABLE 2Source or Sequence of Amplification and SequencingPrimers Used in the Present StudySource or sequence Location/directionSr-14231 Lydeard et al., 1997 12S rRNA geneSNL-N-003 5Јccttccaagtagaaagatta3Ј tRNA glycine geneSNL-N-004 5Јcyttttgtatcatggtttagc3Ј 135 to 155L2510 Palumbi et al., 1991 642 to 661SNL002 Lydeard et al., 1997 756 to 736LR-J-13114 5Јtgttcctyagtcgccccaac3Ј 962 to 942LR-N-12948 5Јttgtgacctcgatgttggac3Ј 1086 to 1105H3080 Palumbi et al., 1991 1188 to 1167N1-J-12585 5Јggtccttttcgaatttgaatatatcc3Ј ND1 geneNote. Location and direction is relative to the 16S rRNA secondarystructure model of chiton, Katharina tunicata.85MOLLUSCAN MITOCHONDRIAL rDNA SEQUENCES
  • 4. FIG. 1. Secondary structure model of Katharina tunicata mitochondrial LSU rRNA. (A) 5Ј-half including Domains I, II, and III. (B) 3Ј-halfincluding Domains IV, V, and VI. Structural Domains are shaded.86 LYDEARD ET AL.
  • 5. ability to form canonical (G–C, A–U, and G–U) basepairs in the 23S rRNA structure model. Sequences weremanually adjusted with the alignment editor AE2(Maidak et al., 1997; T. Macke at the Scripps Clinic, SanDiego, CA) to minimize the number of insertion/deletion events, to maximize the degree of sequenceidentity, and to maintain our previously proposed basepairings. The secondary structure diagrams were gener-ated with the interactive graphics program XRNA,developed by B. Weiser and H. Noller (ftp://fangio.ucsu.edu/pub/XRNA/), which runs on SUN Microsystemscomputers.Nucleotide variation and substitution patterns wereexamined using the software package MEGA (Kumar etal., 1993; version 1.01). ␹2 test of homogeneity of basefrequencies across taxa was conducted using PAUP*(Phylogenetic Analysis Using Parsimony (*and othermethods), version 4.0b1; Swofford, 1998). Phylogenieswere estimated by maximum-parsimony analysisusing the heuristic search option (25 replicates) ofPAUP*. Bootstrapping (Felsenstein, 1985) was em-ployed to measure the internal stability of the datausing 200 iterations. The skewness of tree lengthdistributions as a measure of phylogenetic informationcontent (Hillis and Huelsenbeck, 1992) was tested bygenerating 10,000 random trees. The two generatedDNA sequences were submitted to GenBank (AccessionNos. AF101007 and AF101008). The secondary struc-ture models are available electronically at http://www.rna.icmb.utexas.edu.FIG. 1— Continued87MOLLUSCAN MITOCHONDRIAL rDNA SEQUENCES
  • 6. FIG. 2. Mollusk consensus diagram based on superimposing the 10 mollusk sequences onto the Katharina tunicata large subunitribosomal RNA secondary structure diagram. Positions with a nucleotide in all 10 sequences are shown in one of four categories. Uppercaseletters are for positions that are conserved in all 10 sequences, lowercase letters are conserved in 9/10 sequences, solid circles are for positionsconserved in 8/10 sequences, and open circles are for positions conserved in less than 8/10 sequences. Positions with at least one deletion areshown with arcs; the arc labels indicate the upper and lower number of nucleotides known to exist within the variable region. We designatedarcs with a range of 4 or more nucleotides as ambiguous (one exception is the arc with a range of 3–25 nt in Domain V, largely due to theabsence of this region in stylommatophoran gastropods).88 LYDEARD ET AL.
  • 7. RESULTS AND DISCUSSIONMitochondrial LSU rRNA VariationThe length of the complete mitochondrial LSU rRNAgene is 1035 nt, Albinaria coerulea; 1077 nt, Albinariaturrita; 1024 nt, Euhadra herklotsi; 1004 nt, Cepaeanemoralis; 1342 nt, Cacozeliana lacertina; 1360 nt,Paracrostoma paludiformis; 1302 nt, Loligo bleekeri;1411 nt, Pecten maximus; 1244 nt, Mytilus edulis; 1275nt, Katharina tunicata; and for the outgroup taxa 1325nt, Drosophila melanogaster and 1245 nt, Lumbricusterrestris. Terrett et al. (1996) reported the gene lengthof Cepaea nemoralis to be 1210 nt, which is due to theirincluding additional sequence at the 5Ј-end of the gene.Determining the exact 5Ј- and 3Ј-terminal ends of thegene can be problematic, but both estimates for Cepaeanemoralis are consistent with the shorter lengths ob-served for other stylommatophoran gastropods. Thestylommatophoran gastropods have the shortest genelengths reported for coelomate metazoans; however,they are longer than those observed in nematodes, ca.960 nt (Wolstenholme, 1992; Okimoto et al., 1992). Theremaining molluscan taxa exhibit lengths that aresomewhat shorter than this sampling of other metazo-ans, including humans, 1558 nt (Anderson et al., 1981);1640 nt in the frog, Xenopus leavis (Roe et al., 1985),and 1525 nt in the sea urchin, Strongylocentrotuspurpuratus (Jacobs et al., 1988).FIG. 2— Continued89MOLLUSCAN MITOCHONDRIAL rDNA SEQUENCES
  • 8. Considerable length variation among mollusks existswithin each of the six structural domains (Table 3).Length variation is exhibited at the 5Ј and 3Ј ends ofthe mitochondrial LSU rRNA (Domains I and VI)among molluscan species. However, considerable lengthvariation among taxa is also attributed to the presenceor absence of entire helical/loop structures within par-ticular domains, including Domains II, III, and V. Thestylommatophoran gastropods consistently possessedshorter domain lengths than all the other molluscantaxa examined. The significance of this variation will bediscussed further under Phylogenetic Content of Second-ary Structural characters.The secondary structure model of Katharina tunicata23S-like rRNA is shown in Fig. 1. Secondary structuremodels for the other mollusk mitochondrial LSU rRNAare available online (http://www.rna.icmb.utexas.edu).The general shape of the six structural domains (seeFig. 1) shows remarkable conservation with those ofother metazoans (e.g., Gutell et al., 1993). The consen-sus of 10 mitochondrial 23S-like rRNA sequences (seeTable 1) was superimposed onto the K. tunicata LSUrRNA secondary structure diagram (Fig. 2). The nucle-otides at the most conserved positions (constant in10/10 and 9/10 sequences) are shown as upper- andlowercase letters. Positions conserved in 8/10 and 7/10and fewer are shown with closed and open circles.Positions in K. tunicata that are deleted in one or moremollusk sequences are shown with an arc line. Fewerconservative sites (90%ϩ) were found in the 5Ј-half (64)than in the 3Ј-half (230) of the gene (Fig. 2).Table 3 provides the number of unambiguouslyaligned nucleotides and phylogenetically informative(PI) sites for each domain. We designated all regionswith a high degree of length variation among taxa (i.e.,4 or more nucleotides) as ambiguous (one exception isthe arc with a range of 3–25 nt in Domain V, due to theabsence of this region in stylommatophoran gastro-pods). These highly variable regions are referred to asarcs on Fig. 2. Ambiguous areas of alignment are datadependent and some of the same regions would notnecessarily be deemed ambiguous in a study focusingon more taxonomically restricted groups (e.g., cerithioi-dean or stylommatophoran gastropods).A scatterplot (Fig. 3) of pairwise genetic sequencedifferences (p-distance) versus the absolute number oftransitions (ts) and absolute number of transversions(tv) among all taxa shows that transversions outnum-ber transitions for all pairwise comparisons. This atypi-cal finding is probably a function of scale and sitesaturation of transitions. Lydeard et al. (1997, 1998)examined an approximately 900-nt section of the mito-chondrial LSU rRNA gene in pleurocerid gastropodsand obtained a typical pattern of ts outnumbering tv upto about 20% sequence difference (p-distance). At ornear the 20% value ts began to level off, and tv began tooutnumber ts, indicating saturation of ts. Although notdirectly comparable, all taxon pairwise comparisons inthe present study are greater than 20% different. Thesame observations of biased sampling of more distantlyrelated taxa influencing the lack of transitional biashas been observed in insects (Derr et al., 1992; Fang etal., 1993; Han and McPheron, 1997).Nucleotide Base CompositionBase compositional bias is common in DNA se-quences. For example, the mitochondrial genome ofinsects is typically very A and T rich (e.g., Simon et al.,FIG. 3. A pairwise sequence comparison scatterplot showing absolute number of transitions and transversions against percentagesequence difference (p-distance; uncorrected for multiple hits). Transitions, closed boxes; transversions, open boxes.90 LYDEARD ET AL.
  • 9. 1994). Table 4 provides the nucleotide composition of all12 taxa examined in this study. The average percentageof each nucleotide among all mollusks is A ϭ 34.5%, T ϭ33.7%, C ϭ 13.1%, and G ϭ 18.7%. There is a deficiencyof G ϩ C (average among all mollusks ϭ 31.8%) and ahigher percentage of A ϩ T (68.2%). The percentage A ϩT in mollusks is higher than that reported in thehuman (57.2%; Anderson et al., 1981), frog (60.8%; Roeet al., 1985), and fish (Notropis atherinoides, 54.5%;Simons and Mayden, 1998) but lower than that ininsects, which are noted for their A ϩ T richness (e.g.,D. melanogaster ϭ 82.9%; this study). Loligo bleekeriexhibits the most divergent nucleotide composition inregard to its extreme deficiency of C (only 7.5%) andhigh percentage of T (40.0%).A␹2 test of homogeneity ofbase frequencies across taxa revealed significant differ-ences (␹2 ϭ 423.68, df ϭ 33, P Ͻ 0.001). Conventionaltree-building methods can be unreliable when the basecomposition of taxa varies between sequences (Penny etal., 1990; Lockhart et al., 1994). However, using theLogDet transformation (Lockhart et al., 1994) imple-mented in PAUP* (Swofford, 1998), which allows tree-selection methods (e.g., neighbor-joining) to consis-tently recover the correct tree in cases of differingnucleotide compositions, did not alter the topology fromthose obtained without the LogDet transformation.Phylogenetic Analyses and Phylogenetic ContentIn an ideal setting, the best way to evaluate thephylogenetic content of a gene tree is to compare it withthe known species tree or at least with a well-corroborated phylogeny based on independently de-rived data. One phylogeny that most malacologicalsystematists agree upon in the context of the taxaincluded in the present study is shown in Fig. 4, whichis based on a cladistic analysis of morphological dataand current views of classification (Vaught, 1989; Sal-vini-Plawen and Steiner, 1996; Ponder and Lindberg,1997). Although the phylogeny has not been substanti-ated by many different studies using both molecularand morphological characters, it provides a compara-tive framework for examining the utility of the LSUmtDNAgene. The estimated time of divergence for eachnode is based on surveying the literature for theearliest known fossil appearance for each higher-ordergroup (e.g., earliest known family for cerithioideangastropods) and not just the taxa included in the study(Albinaria species: Zilch, 1959–1960; Helicoidea fami-lies: Zilch, 1959–1960; Bandel, 1997; Stylommato-phora: Bandel, 1994; Cerithioidean families: Bandel,1993; Heterobranchia–Caenogastropoda divergence:Bandel, 1994; Cephalopoda–Gastropoda–Bivalvia split:Moore, 1969; Runnegar, 1996; Yochelson, 1988; Pterioi-dea–Mytiloidea split: Moore, 1969; Conchifera–Polypla-cophora divergence: Smith, 1960; Annelida–Athropoda–Mollusca divergence: Grotzinger et al., 1995; Valentineet al., 1996). Given the lack of congruence for estimatesof the age of many molluscan taxa among studies,divergence estimates serve only as a crude approxima-tion.The phylogenetic performance of the LSU mtDNAgene was evaluated using taxonomic congruence. Obser-vation of congruent patterns in the molecular phylog-eny and the morphological-based phylogeny indicatesthat the two independently derived phylogenies haveconverged on the best estimate of the true phylogeny.Areas of incongruence in the morphological- and molecu-lar-based phylogenetic hypotheses may be due to sev-eral factors: (1) the gene tree is incorrect and does notprovide useful phylogenetic information, (2) the morpho-logical tree is incorrect, or (3) both trees are incorrectbecause the data are ambiguous. Given the well-corroborated, monophyletic status of the taxa exam-ined in this study (Table 1), however, we will presumethat incongruence is due to the molecular-based phylog-eny being incorrect. Consequently, the nine nodes ofinterest on the morphological-based phylogeny aretreated as the ‘‘expected’’ phylogeny and congruenceindicates ‘‘correct’’clades observed (Cunningham, 1997).This approach allows for an objective evaluation ofphylogenetic content of molecular data (e.g., Graybeal,1994).Phylogenetic analyses were conducted using twodifferent strategies for detecting stability in the resul-tant topologies and for compensating for potential sitesaturation. The following maximum-parsimony analy-ses were conducted: unordered, equal weight for allsubstitutions and transversions only. Phylogeneticanalyses were conducted excluding ambiguous areas ofalignment for each of the two approaches. An alignednexus file with E. coli included as a reference taxon isavailable from the authors. Maximum-parsimony analy-sis using equal weighting yielded one most-parsimoni-ous tree (Fig. 5A) with a total length (TL) of 1911 and aconsistency index (CI) of 0.543, excluding uninforma-tive characters. A constraint tree depicting currentviews of molluscan relationships (Fig. 4) was 60 stepsTABLE 4Percentage Nucleotide Base Compositionof Molluscan Taxa Included in StudyA T C GAlbinaria turrita 36.0 35.6 12.9 15.5Albinaria coerulea 38.5 34.7 12.4 14.5Euhadra herklotsi 35.9 37.0 12.1 15.0Cepaea nemoralis 29.7 31.7 16.6 22.0Cacozeliana lacertina 34.6 28.9 15.9 20.6Paracrostoma paludiformis 36.1 31.0 14.3 18.7Loligo bleekeri 34.4 40.0 7.5 18.0Mytilus edulis 32.0 33.4 13.3 21.4Pecten maximus 28.1 31.8 13.8 26.4Katharina tunicata 40.1 34.0 12.8 13.2Average 34.5 33.7 13.1 18.791MOLLUSCAN MITOCHONDRIAL rDNA SEQUENCES
  • 10. longer, which is significantly different from the most-parsimonious tree based on Templeton’s (1983) Wil-coxon signed-rank test as implemented in PAUP*(P Ͻ 0.001). Four of the nine expected clades are ‘‘cor-rect’’(4/9 ϭ 44.4% ϭ % clades correct (ϭ%CC); see Cun-ningham, 1997). The bootstrapped %CC is the averagebootstrap support for each clade in the expected tree(Cunningham, 1997), which in this case is 44.05%,indicating low bootstrap support for the nine expectednodes. The four correct clades include Albinaria tur-rita ϩ Albinaria coerulea, Euhadra ϩ Cepaea, stylom-matophoran gastropods, and cerithioidean gastropods.A monophyletic Bivalvia was only 2 more steps and notsignificantly longer in length (P ϭ 0.763). Average boot-strap support for the four correct clades is 93.6%.Interestingly, the five expected nodes that failed toappear in the gene tree were the most basal nodes (i.e.,Bivalvia, Gastropoda, Cephalopoda ϩ Gastropoda,Bivalvia ϩ Gastropoda ϩ Cephalopoda, and Mollusca),which diverged within a roughly 150-million-year span.The g1 value is significant (g1 ϭ Ϫ1.133), indicatingstrong phylogenetic signal, likely a response to the fourstrongly supported nodes.The maximum-parsimony analysis of all taxa usingDrosophila and Lumbricus as outgroup taxa and onlytransversions resulted in a single most-parsimonioustree (TL ϭ 1071; g1 ϭ Ϫ1.086) (Fig. 5B). The topologydiffers in the placement of some taxa; however, five ofnine nodes (55.5%) are depicted as correct, with theBivalvia being monophyletic. The other four correctclades were identical to those found in the phylogeneticanalysis using equal weighting (Fig. 5A). The bootstrap%CC for the nine expected nodes is 46.9%, which isslightly higher than the support obtained when transi-tions are included (44.05%). The topology obtaineddiffers significantly from the traditional molluscanphylogeny (P Ͻ 0.01).The four correct clades obtained in both of theFIG. 4. Phylogenetic hypothesis of Mollusca and estimated dates of divergence (millions of years) based on first appearance in fossilrecord. See text for literature examined to obtain phylogeny and estimates of divergence times.92 LYDEARD ET AL.
  • 11. aforementioned maximum-parsimony analyses spanan estimated range of less than 360 million yearsamong the gastropods (Fig. 4), based on the first fossilappearance. Using an annelid and an arthropod asoutgroups extends the divergence time back to 525–545mya, which appears to be beyond the resolving power ofthe mitochondrial LSU gene. Kumazawa and Nishida(1993) examined the phylogenetic utility of the mito-chondrial cytochrome b (cyt b) gene by looking at thephylogenetic relationships among a mouse, rat, cow,human, chicken, and frog using a sea urchin to root thetree. Kumazawa and Nishida (1993) obtained highbootstrap support for the mouse–rat clade and mam-mal clade (nearly 95%); however, the frog was sister tothe mammals instead of the chicken, suggesting prob-lems associated with rooting the tree. Reanalysis exclud-ing the sea urchin, however, resulted in the correcttopology and high bootstrap values, supporting thenotion that the cyt b gene simply could not resolverelationships for nodes deeper than 525 mya. Likewise,we were interested in determining whether the lack ofresolution was due to a rooting problem (i.e., too deep ofa node to properly root the tree). The lack of a monophy-letic Mollusca supports this contention. Therefore, weconducted a maximum-parsimony analysis excludingDrosophila, Lumbricus, and Katharina tunicata, whichdiverged over 500 mya, and used the two bivalvespecies to root the tree.Maximum-parsimony analysis using transitions andtransversions (equal weight) resulted in a single most-parsimonious tree with TL ϭ 1440 and CI ϭ 0.652 (Fig.6A). The %CC ϭ 4/6 ϭ 66.66% and the bootstrap%CC ϭ 71.66%. The most-parsimonious topology is notsignificantly different from the traditional molluscanphylogeny (P ϭ 0.272). The g1 value was significant(g1 ϭ Ϫ1.075). Maximum-parsimony analysis of onlytransversions yielded a single most-parsimonious tree(TL ϭ 785; g1 ϭ Ϫ0.942). The topology is shown in Fig.6B. The %CC ϭ 5/6 ϭ 83.33% and the bootstrap %CC ϭ68.5%. The topology is not statistically different fromthe traditional molluscan phylogeny (P ϭ 0.134). Thetopology obtained using only transversions results in aCephalopoda ϩ Gastropoda clade; however, gastropodsare still not rendered monophyletic. The %CC andbootstrap %CC values were higher for the analyseswithout Katharina tunicata, Lumbricus terrestris, andDrosophila melanogaster than the values obtainedwhen including all taxa in the analyses. These findingsare partly due to the exclusion of ‘‘expected’’ or correctclades that were not observed in the phylogeneticanalysis that included all taxa (e.g., the Mollusca andBivalvia ϩ Gastropoda ϩ Cephalopoda clades). Be-cause of the weak support for the Gastropoda ϩ Cepha-lopoda clade and the failure to obtain a monophyleticGastropoda, it appears that the limits of resolvingpower of the mitochondrial LSU rRNA gene may befewer than 400 million years but certainly greater thanthe 80 mya estimate suggested by Graybeal (1994).Obviously, this estimate will have to be further testedwhen additional sequences are available and otherfactors are examined, including rate variation amongsites as well as lineages and the effects of long branches(Abouheif et al., 1998; Philiippe and Laurent, 1998).Most previous molluscan molecular systematic stud-ies have used either partial (e.g., Field et al., 1988;Ghiselin, 1988; Adamkewicz et al., 1997; Harasewych etal., 1997a,b, 1998) or complete (e.g., Winnepenninckx etal., 1994, 1996, 1998; Steiner and Mu¨ller, 1996) eukary-otic nuclear cytoplasmic SSU rRNA sequences or par-tial (Ͻ200 nucleotides) eukaryotic nuclear cytoplasmicLSU rRNA sequences (e.g., Tillier et al., 1992; Rosen-berg et al., 1994). Support for monophyly of Molluscaand various classes within the phylum differs amongstudies (see Winnepenninckx et al., 1996 for review ofresults). Perhaps the most striking difference is the factthat a phylogeny based on complete SSU rRNA se-quences supports the monophyly of mollusks, gastro-pods, and bivalves in one study (Winnepenninckx et al.,1994) and fails to recover molluscan, gastropod, andbivalve monophyly in another (Winnepenninckx et al.,1996). The only substantial differences between the twostudies are the number of taxa and taxonomic sam-pling, which have been shown to be significant factorsin phylogenetic reconstruction (e.g., Lecointre et al.,1993; Hillis, 1998; Graybeal, 1998). Winnepenninckx etal., 1996) suggest that the rapid radiation of phyla andmolluscan classes has resulted in short internodaldifferences and the inability to fully resolve relation-ships. Our results support their hypothesis. In con-trast, the eukaryotic nuclear cytoplasmic LSU and SSUrRNA genes seem to be useful for resolving relation-ships within molluscan classes, including bivalves(Steiner and Mu¨ller, 1996; Adamkewicz et al., 1997)and gastropods (e.g., Tillier et al., 1992; Harasewych etal., 1997a,b, 1998).Stems and LoopsSome ribosomal RNAinvestigators choose to compart-mentalize the RNA into two components—stems (ϭhe-lices) and loops (ϭunpaired regions)—operating underthe assumption that the regions behave differently(e.g., Ortı´ et al., 1996). This appears to be an oversimpli-fication because some nucleotides within stems andloops are highly conserved and others are highly vari-able (see Fig. 2 this study; Gutell et al., 1985; Hickson etal., 1996; Vawter and Brown, 1993; and consensusdiagrams posted at http://www.rna.icmb.utexas.edu).Of the 64 positions conserved in more than 90% of themollusk sequences in the 5Ј-half, 23 (35.9%) are inshort unpaired regions and bulges, 20 (31.3%) are inunpaired regions linking Domains I–II and II–III, 12(18.8%) are in loops, 8 (12.5%) are in internal stems(i.e., strands separated by at least one other set ofstem–loop structures), and 1 is in hairpin regions93MOLLUSCAN MITOCHONDRIAL rDNA SEQUENCES
  • 12. FIG. 5. The single most-parsimonious phylogram obtained based on maximum-parsimony analysis of the complete mitochondrial LSUrRNA gene, excluding ambiguously aligned regions based on (A) equal weighting (TL ϭ 1911; CI ϭ 0.54) and (B) transversions only(TL ϭ 1071). Bootstrap values are shown above nodes having support of greater than 50%. Lumbricus and Drosophila were treated asoutgroup taxa.94 LYDEARD ET AL.
  • 13. FIG. 5— Continued95MOLLUSCAN MITOCHONDRIAL rDNA SEQUENCES
  • 14. FIG. 6. The single most-parsimonious phylogram obtained based on maximum-parsimony analysis of the complete mitochondrial LSUrRNA gene, excluding ambiguously aligned regions based on (A) equal weighting (TL ϭ 1440; CI ϭ 0.65) and (B) transversions only(TL ϭ 785). Bootstrap values are shown above nodes having support of greater than 50%. The two bivalve species (Mytilus edulis and Pectenmaximus) were treated as outgroup taxa.96 LYDEARD ET AL.
  • 15. FIG. 6— Continued97MOLLUSCAN MITOCHONDRIAL rDNA SEQUENCES
  • 16. 987
  • 17. (strands separated by a single, unpaired loop struc-ture). Of the 230 90%ϩ conserved sites in the 3Ј-half, 86(37.4%) are in short unpaired regions and bulges, 4(1.7%) are in unpaired regions linking Domain IV–V, 31(13.5%) are in loops, 39 (17.0%) are in internal stems,and 73 (30.4%) are in hairpin regions.Molecular systematists are interested in discoveringmolecular characters that are going to yield a robustphylogeny. One question that we examined was whetherthere was any pattern in where the most conservativephylogenetically informative sites were located in thecontext of the ribosomal RNA secondary structuremodel. This issue was investigated by generating amolecular phylogeny constraining the topology to pro-duce the ‘‘correct’’ tree shown in Fig. 4 and mapping thecharacters with a retention index (RI) of 1.0 (fromunambiguously aligned regions) on the ribosomal RNAsecondary structure model of Katharina tunicata. Theretention index expresses the fraction of apparentsynapomorphy in the character that is retained assynapomorphy on the tree (Farris, 1989). A synapomor-phy is a shared-derived character. Forty-nine charac-ters were found that had a retention index of 1.0. Thevast majority of the 49 characters represented synapo-morphies for the stylommatophoran gastropods, thecerithioidean gastropods, and the bivalves revealed inthe unconstrained phylogeny. Of the 15 characters thathad an RI of 1.0 in the 5Ј-half, 4 are in short unpairedregions and bulges, 2 are in unpaired regions linkingDomain I–II, 2 are in loops, 4 are in internal stems, and3 are in hairpin regions. Of the 34 characters that hadan RI of 1.0 in the 3Ј-half, 4 are in short unpairedregions and bulges, 3 are in unpaired regions linkingDomain IV–V, 2 are in loops, 8 are in internal stems,and 17 are in hairpin regions. Interestingly, 25 of 49characters with an RI of 1.0 were located within threenucleotides of an invariant character, suggesting thatthe most conservative phylogenetically informative sitesare located in highly conservative regions of the gene.Phylogenetic Content of SecondaryStructural CharactersWoese (1987) and later Gutell (1992) envisioned thepossible reconstruction of a phylogenetic tree of metazo-ans based on a phylogenetic analysis of secondarystructure of rRNA. During our comparative analysis ofFIG. 7. (a) Ribosomal RNA secondary structure models of two regions from Domain II (ϭcharacter 1) and Domain V (ϭcharacter 2),showing variation among taxa. (b) Data matrix based on the qualitative coding of three characters. Character 1 ϭ Domain II, presence (1) orabsence (0) of stem-loop structure; character 2 ϭ Domain V, stem/bulge/stem/loop structure (0), stem/bulge/stem/bulge/stem/loop structure (1);character 3 (not shown) ϭ presence of Domain III (1) or absence of Domain III (0). (c) Placement of three characters in the context of the entireribosomal rRNA secondary structure of K. tunicata.99MOLLUSCAN MITOCHONDRIAL rDNA SEQUENCES
  • 18. molluscan secondary structure models, it became appar-ent that there may be phylogenetic signal. To examinethe phylogenetic content in the secondary structuremodels, a data matrix was constructed based on aqualitative analysis of variable stem/loop structures.We chose to code only potentially phylogeneticallyinformative sites and excluded autapomorphies (charac-ters unique to a single taxon). The final data matrix andtwo of the three characters are presented in Fig. 7(character 3 is the presence or absence of Domain III). Amaximum-parsimony analysis of the three ribosomalRNAsecondary structural characters (unordered; equalweight), including all taxa with Drosophila and Lumbri-cus as outgroups, yielded a single most-parsimonioustree (TL ϭ 3; CI ϭ 1.0) with characters 1 (loss of stemloop structure in Domain II) and 2 (stem/bulge/stem/loop structure in Domain V) uniting the stylommatopho-ran gastropods and character 3 (absence of Domain III)uniting stylommatophoran gastropods ϩ Drosophila.Obviously, if we constrained the monophyly of theMollusca, the loss of Domain III would be depicted astwo independent evolutionary events. Given that thethree coded characters yielded synapomorphies forstylommatophoran gastropods, it appears that there isindeed phylogenetic signal in the secondary structureof rRNA that is worthy of future investigation not onlyin mollusks but in all metazoans.ACKNOWLEDGMENTSThanks are extended to R. Minton, K. Roe, P. J. West, and theAdvanced Systematics Discussion Group at U.A. for helpful com-ments on the manuscript and to R. Minton for assistance with Figs. 5and 7 and J. Cannone for Figs. 1 and 2. Thanks are also given to M.Glaubrecht, W. Ponder, and B. Roth for help finding relevant litera-ture on molluscan fossils. This research was supported in part by aResearch Grants Committee Award (2-67858) from the University ofAlabama and the National Science Foundation (DEB-9707623) toC.L. and the National Institutes of Health (GM48207) to R.R.G.REFERENCESAbouheif, E., Zardoya, R., and Meyer, A. (1998). Limitations ofmetazoan 18S rDNA sequence data: Implications for reconstruct-ing a phylogeny of the animal kingdom and inferring the reality ofthe Cambrian explosion. J. Mol. Evol. 47: 394–405.Adamkewicz, S. L., Harasewych, M. G., Black, J., Saudek, D., andBult, C. J. (1997). A molecular phylogeny of the bivalve mollusks.Mol. Biol. Evol. 14: 619–629.Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijn, M. H. L.,Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A.,Sanger, F., Schreier, P. H., Smith, A. J. H., Staden, R., and Young,I. G. (1981). Sequence and organization of the human mitochon-drial genome. Nature 290: 457–465.Bandel, K. (1993). Caenogastropoda during Mesozoic times. In ‘‘Mol-luscan Palaeontology’’ (A. W. Janssen and R. Janssen, Eds.), pp.7–56. 11th International Malacological Congress Siena, Italy,Symposium Proceedings. Scripta Geologica, Special Issue 2, Leiden.Bandel, K. (1994). Triassic euthyneura (Gastropoda) from St. CassianFormation (Italian Alps) with a discussion on the evolution of theHeterostropha. Freiberger Forschungshefte C 452: 79–100.Bandel, K. (1997). Higher classification and pattern of evolution ofthe Gastropoda: A synthesis of biological and paleontological data.Cour. Forsch. Inst. Senckenberg 201: 57–81.Boore, J. L., and Brown, W. M. (1994). Complete DNA sequence of themitochondrial genome of the black chiton, Katharina tunicata.Genetics 138: 423–443.Boore, J. L., and Brown, W. M. (1995). Complete sequence of themitochondrial DNA of the annelid worm Lumbricus terrestris.Genetics 141: 305–319.Cunningham, C. W. (1997). Can three incongruence tests predictwhen data should be combined? Mol. Biol. Evol. 14: 733–740.Derr, J. N., Davis, S. K., Woolley, J. B., and Whartono, R. A. (1992).Reassessment of the 16S rRNA nucleotide sequence from membersof the parasitic Hymenoptera. Mol. Phylogenet. Evol. 1: 338–341.Douris, V., Giokas, S., Lecanidou, R., Mylonas, M., and Rodakis, G. C.(1998). Phylogenetic analysis of mitochondrial DNA and morpho-logical characters suggest a need for taxonomic re-evaluationwithin the Alopiinae (Gastropoda: Clausiliidae). J. Moll. Stud. 64:81–92.Fang, Q., Black, W. C., Blocker, H. D., IV, and Whitcomb, R. F. (1993).A phylogeny of New World Deltocephalus-like leafhopper generabased on mitochondrial 16S ribosomal DNA sequences. Mol. Phylo-genet. Evol. 2: 119–131.Farris, J. S. (1989). The retention index and the rescaled consistencyindex. Cladistics 5: 417–419.Felsenstein, J. F. (1985). Confidence limits on phylogenies: Anapproach using the bootstrap. Evolution 39: 783–791.Field, K. G., Olsen, G. J., Lane, D. J., Giovannoni, S. J., Ghiselin,M. T., Raff, E. C., Pace, N. R., and Raff, R. A. (1988). Molecularphylogeny of the animal kingdom. Science 239: 748–753.Gatesy, J., Desalle, R., and Wheeler, W. (1993). Alignment-ambiguousnucleotide sites and the exclusion of systematic data. Mol. Phylo-genet. Evol. 2: 152–157.Ghiselin, M. T. (1988). The origin of molluscs in the light of molecularevidence. In ‘‘Oxford Surveys in Evolutionary Biology’’ (P. H.Harvey and L. Partridge, Eds.), Vol. 5, pp. 66–95. Oxford Univ.Press, New York.Graybeal, A. (1994). Evaluating the phylogenetic utility of genes: Asearch for genes informative about deep divergences among verte-brates. Syst. Biol. 43: 174–193.Graybeal, A. (1998). Is it better to add taxa or characters to a difficultphylogenetic problem? Syst. Biol. 47: 9–17.Grotzinger, J. P., Bowring, S. A., Saylor, B., and Kauffman, A. J.(1995). New biostratigraphic and geochronologic constraints onearly animal evolution. Science 270: 598–604.Gutell, R. R. (1992). Evolutionary characteristics of 16S and 23SrRNA structures. In ‘‘The Origin and Evolution of the Cell’’ (H.Hartman and K. Matsuno, Eds.), pp. 243–309. World Scientific,Singapore.Gutell, R. R. (1994). Collection of small subunit (16S- and 16S-like)ribosomal RNA structures: 1994. Nucleic Acids Res. 22: 3502–3507.Gutell, R. R. (1996). Comparative sequence analysis and the struc-ture of 16S and 23S RNA. In ‘‘Ribosomal RNA: Structure, Evolu-tion, Processing and Function in Protein Biosynthesis’’ (R. A.Zimmermann and A. E. Dahlberg, Eds.), pp. 111–128. CRC Press,New York.Gutell, R. R., Weiser, B., Woese, C. R., and Noller, H. F. (1985).Comparative anatomy of 16S-like ribosomal RNA. Prog. NucleicAcid Res. Mol. Biol. 32: 155–216.Gutell, R. R., Gray, M. W., and Schnare, M. N. (1993). Compilation oflarge subunit (23S- & 23S-like) ribosomal RNA structures: 1993.Nucleic Acids Res. 21: 3055–3074.Gutell, R. R., Larsen, N., and Woese, C. R. (1994). Lessons from anevolving rRNA: 16S and 23S rRNA structures from a comparativeperspective. Microbiol. Rev. 58: 10–26.100 LYDEARD ET AL.
  • 19. Gyllensten, U. B., and Erlich, H. A. (1988). Generation of single-stranded DNA by the polymerase chain reaction and its applicationto direct sequencing of the HLA-DQA locus. Proc. Natl. Acad. Sci.USA 85: 7652–7656.Han, H., and McPheron, B. A. (1997). Molecular phylogenetic study ofTephritidae (Insecta: Diptera) using partial sequences of themitochondrial 16S ribosomal DNA. Mol. Phylogenet. Evol. 7:17–32.Harasewych, M. G., Adamkewicz, S. L., Blake, J. A., Saudek, D.,Spriggs, T., and Bult, C. J. (1997a). Neogastropod phylogeny: Amolecular perspective. J. Moll. Stud. 63: 327–351.Harasewych, M. G., Adamkewicz, S. L., Blake, J. A., Saudek, D.,Spriggs, T., and Bult, C. J. (1997b). Phylogeny and relationships ofpleurotomariid gastropods (Mollusca: Gastropoda): An assessmentbased on partial 18S rDNA and cytochrome c oxidase I sequences.Mol. Mar. Biol. Biotechnol. 6: 1–20.Harasewych, M. G., Adamkewicz, S. L., Plassmeyer, M., and Gillevet,P. M. (1998). Phylogenetic relationships of the lower caenogas-tropoda (Mollusca, Gastropoda, Architaenioglossa, Campaniloidea,Cerithioidea) as determined by partial 18S rDNA sequences. Zool.Scripta 27: 361–372.Hatzoglou, E., Rodakis, G. C., and Lecanidou, R. (1995). Completesequence and gene organization of the mitochondrial genome of theland snail Albinaria coerulea. Genetics 140: 1353–1366.Hickson, R. E., Simon, C., Cooper, A., Spicer, G. S., Sullivan, J., andPenny, D. (1996). Conserved sequence motifs, alignment, andsecondary structure for the third domain of animal 12S rRNA. Mol.Biol. Evol. 13: 150–169.Hillis, D. M. (1998). Taxonomic sampling, phylogenetic accuracy, andinvestigator bias. Syst. Biol. 47: 3–8.Hillis, D. M., and Huelsenbeck, J. P. (1992). Signal, noise, andreliability in molecular phylogenetic analyses. J. Hered. 83: 189–195.Hillis, D. M., and Dixon, M. T. (1991). Ribosomal DNA: Molecularevolution and phylogenetic inference. Q. Rev. Biol. 66: 411–453.Hoffmann, R. J., Boore, J. L., and Brown, W. M. (1992). A novelmitochondrial genome organization for the blue mussel, Mytilusedulis. Genetics 131: 397–412.Jacobs, H. T., Elliott, D. J., Math, V. B., and Farquarson, A. (1988).Nucleotide sequence and gene organization of sea urchin mitochon-drial DNA. J. Mol. Biol. 202: 185–217.Kjer, K. M. (1995). Use of rRNA secondary structure in phylogeneticstudies to identify homologous positions: An example of alignmentand data presentation from the frogs. Mol. Phylogenet. Evol. 4:314–330.Kobayashi, S., and Okada, M. (1990). Complete cDNA sequenceencoding mitochondrial large ribosomal RNAof Drosophila melano-gaster. Nucleic Acids Res. 18: 4592.Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Pa¨a¨bo, S.,Villablanca, F. X., and Wilson, A. C. (1989). Dynamics of mitochon-drial DNA evolution in animals: Amplification and sequencing withconserved primers. Proc. Natl. Acad. Sci. USA 86: 6196–6200.Kumar, S., Tamura, K., and Nei, M. (1993). MEGA: Molecularevolutionary genetics analysis. Institute of Molecular EvolutionaryGenetics. Pennsylvania State Univ., University Park, PA.Kumazawa, Y., and Nishida, M. (1993). Sequence evolution of mito-chondrial tRNA genes and deep-branch animal phylogenetics. J.Mol. Evol. 37: 380–398.Lecanidou, R., Douris, V., and Rodakis, G. C. (1994). Novel features ofmetazoan mtDNA revealed from sequence analysis of three mito-chondrial DNA segments of the land snail Albinaria turrita(Gastropoda: Clausiliidae). J. Mol. Evol. 38: 369–382.Lecointre, G., Philippe, H., Vaˆn Leˆ, H. L., and Le Guyader, H. (1993).Species sampling has a major impact on phylogenetic inference.Mol. Phylogenet. Evol. 2: 205–224.Lieberman, B. S., Allmon, W. D., and Eldredge, N. (1993). Levels ofselection and macroevolutionary patterns in the turritellid gastro-pods. Paleobiology 19: 205–215.Lockhart, P. J., Steel, M. A., Hendy, M. D., and Penny, D. (1994).Recovering evolutionary trees under a more realistic model ofsequence evolution. Mol. Biol. Evol. 11: 605–612.Lydeard, C., and Roe, K. J. (1997). The phylogenetic utility of themitochondrial cytochrome b gene for inferring relationships amongactinopterygian fishes. In ‘‘Molecular Systematics of Fishes’’ (T. D.Kocher and C. A. Stepien, Eds.), pp. 285–303. Academic Press, NewYork.Lydeard, C., Mulvey, M., and Davis, G. M. (1996). Molecular system-atics and evolution of reproductive traits of North Americanfreshwater unionacean mussels (Mollusca: Bivalvia) as inferredfrom 16S rRNA gene sequences. Philos. Trans. R. Soc. Lond. B 351:1593–1603.Lydeard, C., Holznagel, W. E., Garner, J., Hartfield, P., and Pierson,J. M. (1997). A molecular phylogeny of Mobile River drainage basinpleurocerid snails (Caenogastropoda: Cerithioidea). Mol. Phylo-genet. Evol. 7: 117–128.Lydeard, C., Yoder, J. H., Holznagel, W. E., Thompson, F. G., andHartfield, P. (1998). Phylogenetic utility of the 5Ј-half of mitochon-drial 16S rDNA gene sequences for inferring relationships ofElimia (Cerithioidea: Pleuroceridae). Malacologia 39: 183–193.Maidak, B. L., Olsen, G. J., Larsen, N., Overbeek, R., McCaughey,M. J., and Woese, C. R. (1997). The RDP (Ribosomal DatabaseProject). Nucleic Acids Res. 25: 109–111.Mindell, D. P., and Honeycutt, R. L. (1990). Ribosomal RNA invertebrates: Evolution and phylogenetic applications. Annu. Rev.Ecol. Syst. 21: 541–566.Miyamoto, M. M., Allard, M. W., Adkins, R. M., Janecek, L. L., andHoneycutt, R. L. (1994). A congruence test of reliability usinglinked mitochondrial DNA sequences. Syst. Biol. 43: 236–249.Moore, R. C., Ed. (1969). ‘‘Treatise on Invertebrate Paleontology.Bivalvia. Mollusca 6, Part N, 1,’’ Geol. Soc. Am. and Univ. Press ofKansas, Lawrence.Mulvey, M., Lydeard, C., Pyer, D. L., Hicks, K. M., Brim-Box, J.,Williams, J. D., and Butler, R. S. (1997). Conservation genetics ofNorth American freshwater mussels Amblema and Megalonaias.Conserv. Biol. 11: 868–878.Noller, H. F. (1984). Structure of ribosomal RNA. Annu. Rev. Bio-chem. 53: 119–162.Noller, H. F. (1991). Ribosomal RNA and translation. Annu. Rev.Biochem. 60: 191–227.Noller, H. F., Kop, J., Wheaton, V., Brosius, J., Gutell, R. R., Kopylov,A. M., Dohme, F., and Herr, W. (1981). Secondary structure modelfor 23S ribosomal RNA. Nucleic Acids Res. 9: 6167–6189.Okimoto, R., Macfarlane, J. L., Clary, D. O., and Wolstenholme, D. R.(1992). The mitochondrial genomes of two nematodes, Caenorhab-ditis elegans and Ascaris suum. Genetics 130: 471–498.Ortı´, G., Petry, P., Porto, J. I. R., Je´gu, M., and Meyer, A. (1996).Patterns of nucleotide change in mitochondrial ribosomal RNAgenes and the phylogeny of piranhas. J. Mol. Evol. 42: 169–182.Palumbi, S. R., Martin, A. P., Romano, S. L., McMillan, W. O., Stice,L., and Grabowski, G. (1991). ‘‘The Simple Fool’s Guide to PCR,’’Univ. of Hawaii Press, Honolulu.Penny, D., Hendy, M. D., Zimmer, E. A., and Hamby, R. I. (1990).Trees from sequences: Panacea or Pandora’s box? Aust. Syst. Bot. 3:21–38.Philippe, H., and Laurent, J. (1998). How good are deep phylogenetictrees? Curr. Opin. Genet. Dev. 8: 616–623.Ponder, W. F., and Lindberg, D. R. (1997). Towards a phylogeny ofgastropod molluscs: An analysis using morphological characters.Zool. J. Linn. Soc. 119: 83–265.Roe, B. A., Ma, D. P., Wilson, R. K., and Wong, J. F. H. (1985). The101MOLLUSCAN MITOCHONDRIAL rDNA SEQUENCES
  • 20. complete nucleotide sequence of the Xenopus laevis mitochondrialgenome. J. Biol. Chem. 260: 9759–9774.Rosenberg, G., Kuncio, G. S., Davis, G. M., and Harasewych, M. G.(1994). Preliminary ribosomal RNA phylogeny of gastropod andunionoidean bivalve mollusks. Nautilus Suppl. 2: 111–121.Runnegar, B. (1996). Early evolution of the Mollusca: the fossilrecord. In ‘‘Origin and Evolutionary Radiation of the Mollusca’’(J. D. Taylor, Ed.), pp. 77–87. Oxford Univ. Press, Oxford.Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich,H. A., and Arnheim, N. (1985). Enzymatic amplification of ␤-globingenomic sequences and restriction site analysis for diagnosis ofsickle cell anemia. Science 230: 1350–1354.Salvini-Plawen, L. V., and Steiner, G. (1996). Synapomorphies andplesiomorphies in higher classification of mollusca. In ‘‘Origin andEvolutionary Radiation of the Mollusca’’ (J. D. Taylor, Ed.), pp.29–51. Oxford Univ. Press, Oxford.Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., and Flook, P.(1994). Evolution, weighting, and phylogenetic utility of mitochon-drial gene sequences and a compilation of conserved polymerasechain reaction primers. Ann. Entomol. Soc. Am. 87: 651–701.Simons, A. M., and Mayden, R. L. (1998). Phylogenetic relationshipsof the western North American phoxinins (Actinopterygii: Cyprini-dae) as inferred from mitochondrial 12S and 16S ribosomal RNAsequences. Mol. Phylogenet. Evol. 9: 308–329.Smith, A. G. (1960). Amphineura. In ‘‘Treatise on InvertebratePaleontology. Part I, Mollusca 1’’ (R. C. Moore, Ed.), pp. I41–I76.Geol. Soc. Am. and Univ. Press of Kansas, Lawrence.Steiner, G., and Mu¨ller, M. (1996). What can 18S rDNA do for bivalvephylogeny? J. Mol. Evol. 43: 58–70.Swofford, D. L. (1998). PAUP*. Phylogenetic Analysis Using Par-simony (*and Other Methods). Version 4.0b1. Sinauer, Sunder-land, MA.Templeton, A. R. (1983). Convergent evolution and non-parametricinferences from restriction fragment and DNA sequence data. In‘‘Statistical Analysis of DNA Sequence Data’’ (B. Weir, Ed.), pp.151–179. Dekker, New York.Terrett, J. A., Miles, S., and Thomas, R. H. (1996). Complete DNAsequence of the mitochondrial genome of Cepaea nemoralis (Gas-tropoda: Pulmonata). J. Mol. Evol. 42: 160–168.Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994). CLUSTALW: Improving the sensitivity of progressive multiple sequencealignment through sequence weighting, positions-specific gap pen-alties and weight matrix choice. Nucleic Acids Res. 22: 4673–4680.Tomita, K., Ueda, T., and Watanabe, K. (1998). 7-Methylguanosine atthe anticodon wobble position of squid mitochondrial tRNA(Ser)GCU: Molecular basis for assignment of AGA/AGG codons asserine in invertebrate mitochondria. Biochim. Biophys. Acta 1399:78–82.Tillier, S., Masselot, M., Philippe, H., and Tillier, A. (1992). Phylog-e´nie mole´culaire des gastropoda (Mollusca) fonde´e sur le se´quen-cage partiel de l’ARN ribosominque 28S. C. R. Acad. Sci. Paris 314:79–85.Titus, T. A., and Frost, D. R. (1996). Molecular homology assessmentand phylogeny in the lizard family Opluridae (Squamata: Iguania).Mol. Phylogenet. Evol. 6: 49–62.Valentine, J. W., Erwin, D. H., and Jablonski, D. (1996). Developmen-tal evolution of metazoan bodyplans: The fossil evidence. Dev. Biol.173: 373–381.Vaught, K. C. (1989). ‘‘A Classification of the Living Mollusca,’’ Am.Malacol. Inc. Melbourne, FL.Vawter, L., and Brown, W. M. (1993). Rates and patterns of basechange in the small subunit ribosomal RNA gene. Genetics 134:597–608.Wheeler, W. C., and Gladstein, D. (1991). MALIGN (Multiple align-ment). Privately distributed.Winnepenninckx, B., Backeljau, T., and De Wachter, R. (1994). Smallribosomal subunit RNA and the phylogeny of Mollusca. NautilusSuppl. 2: 98–110.Winnepenninckx, B., Backeljau, T., and De Wachter, R. (1996).Investigation of molluscan phylogeny on the basis of 18S rRNAsequences. Mol. Biol. Evol. 13: 1306–1317.Winnepenninckx, B., Steiner, G., Backeljau, T., and De Wachter, R.(1998). Details of gastropod phylogeny inferred from 18S rRNAsequences. Mol. Phylogenet. Evol. 9: 55–63.Woese, C. R. (1987). Bacterial evolution. Microbiol. Rev. 51: 221–271.Woese, C. R., Magrum, L. J., Gupta, R., Siegel, R. B., and Stahl, D. A.(1980). Secondary structure model for bacterial 16S ribosomalRNA: Phylogenetic, enzymatic and chemical evidence. NucleicAcids Res. 8: 2275–2293.Woese, C. R., Kandler, O., and Wheelis, M. L. (1990). Towards anatural system of organisms: Proposal for the domains Archaea,Bacteria, and Eucarya. Proc. Natl. Acad. Sci. USA 87: 4576–4579.Wolstenholme, D. R. (1992). Animal mitochondrial DNA: Structureand evolution. Int. Rev. Cytol. 141: 173–216.Yang, D., Oyaizu, Y., Olsen, G. J., and Woese, C. R. (1985). Mitochon-drial origins. Proc. Natl. Acad. Sci. USA 82: 4443–4447.Yochelson, E. L. (1988). A new genus of Patellacea (Gastropoda) fromthe Middle Ordovician of Utah: The oldest known example of thesuperfamily. New Mexico Bur. Mines Min. Res. Mem. 44: 195–200.Zilch, A. (1959–1960). Gastropoda, Teil 2, Euthyneura. Handb.Paleozool. 6(2)1: 1–400 [1959]; 2: 401–834 [1960].Zimmermann, R. A., and Dahlberg, A. E., Eds. (1996). ‘‘RibosomalRNA: Structure, Evolution, Processing and Function in ProteinBiosynthesis,’’ CRC Press, New York.102 LYDEARD ET AL.