Why are Dog Genetics Interesting?

Loading...

Flash Player 9 (or above) is needed to view presentations.
We have detected that you do not have it on your computer. To install it, go here.

0 comments

Post a comment

    Post a comment
    Embed Video
    Edit your comment Cancel

    Notes on slide 1

    The following slide presentation is target for 60 minutes. I will relate my story of acquiring a pet dog who with a little research and help from my college class opened up a fascinating world of history, AKC registration, breeding, genetics and developmental biology. I hope you find some things interesting enough to read and research your information on your own dog.

    Clearly there are more genetic mechanisms at work if you consider the wide range of phenotypes for the modern dog. All modern dogs have the same number of chromosomes and genetic bases however they can be widely different in physical form and behavioral form.

    Listed here are reasons dogs are interesting to scientists.

    In 2003 Kerstin Lindblad-Toh and her team embarked on developing a map of the dog genome. The published there work in 2005 in Nature. This first map has been used as a basis for much of the recent literature on dog genetics.

    Here are 2 big ideas in genetics. We talked about dominant and recessive traits which was observed by Gregor Mendel. In the 1980’s new observations were made about a sets of genes that control traits. These set of genes were called Quantitative Trait Locus. Sets of genes can control a range of phenotypic expression. For example a tall plant and short plant can produce a medium plant. The structural form of an organism can be the result of many genes that are linked. One gene effects the other gene. What happens when we focus on the form of one gene? Can their be side effects? The reason I mention plants in this example is that a soybean genetist at the University of Utah Karl Gordon Lark realized the techniques he was using for the study of plants could be applied to the population of Portuguese Water Dogs. We are going to talk about his research in a few minutes.

    Here are 2 big ideas in genetics. We talked about dominant and recessive traits which was observed by Gregor Mendel. In the 1980’s new observations were made about a sets of genes that control traits. These set of genes were called Quantitative Trait Locus. Sets of genes can control a range of phenotypic expression. For example a tall plant and short plant can produce a medium plant. The structural form of an organism can be the result of many genes that are linked. One gene effects the other gene. What happens when we focus on the form of one gene? Can their be side effects? The reason I mention plants in this example is that a soybean genetist at the University of Utah Karl Gordon Lark realized the techniques he was using for the study of plants could be applied to the population of Portuguese Water Dogs. We are going to talk about his research in a few minutes.

    Here are 2 big ideas in genetics. We talked about dominant and recessive traits which was observed by Gregor Mendel. In the 1980’s new observations were made about a sets of genes that control traits. These set of genes were called Quantitative Trait Locus. Sets of genes can control a range of phenotypic expression. For example a tall plant and short plant can produce a medium plant. The structural form of an organism can be the result of many genes that are linked. One gene effects the other gene. What happens when we focus on the form of one gene? Can their be side effects? The reason I mention plants in this example is that a soybean genetist at the University of Utah Karl Gordon Lark realized the techniques he was using for the study of plants could be applied to the population of Portuguese Water Dogs. We are going to talk about his research in a few minutes.

    Here is a picture of Georgie from Web site at the University of Utah. There is a great Discovery channel film clip on line at http://www.exn.ca/Stories/2002/12/05/53.asp Which give the background of the project. The following set of slides have also been taken from the Georgie project web site which I recommend to go and read as a follow up to this presentation

    This is a great visual slide from the Georgie project that helps you to comprehend the proliferation of similar sets of genes in a closed breeding system which favors a champion sire. Le-Hi Madeira Lancer is a male that was used to breed with multiple females. Each box represents a puppy that he sired with colors in each line representing litters. Two of his sons were used to breed with multiple females. This clearly illustrates the amplification of the genetic material for certain chosen dogs in selective breeding. Take a second to think about this. Is it clear that conformational breeding can skew a genetic population in favor of a specific dog. This could be done by looks or behavior but which do think are qualities more favored today?

    The Portuguese Water Dog Club of America has an on line database of lineage. Here are 4 generations of MacGyver's family. The well documented history of this breed in America from the early 1970’s is an important aspect of the dog that we will discuss

    Here is an example of the wide phenotypic expression of the PWD’s. Some of these differences are grooming but I have noticed many differences in muzzle shape, eye shape, size and hair type in the PWD’s that I have met.

    Since the breed was so well documented in the US it was possible for the Utah research team to reach out to breeders and owners. Owners were very willing to participate in the project by providing, health information, skeletal measurements and vials of blood. Each dog was then tracked in a database of genotype of hundreds of genetic markers and phenotype of consanguity and health problems. This allowed the research team to statistically evaluate sub-groups of related dogs for the presence of Quantitative Trait Loci

    The database of information showed a significant correlation between the genetic markers or genotype and the breeding records provided by owners. It was as reliable predicting how related 2 dogs were by the information on a section of their DNA as it was by looking at their pedigree breeding charts. Sub-groups of dogs could be isolated for homologous genetic traits. The research team could hunt for genetic markers that produced certain phenotypes such as muzzle length, hip structure, retinal problems or defective adrenal glands.

    I would like to point out the elegance of the Georgie experiment. This experimentation was done using dogs living as “free” animals. Much of this type of research is not published because researchers use laboratory colonies of dogs. Many of these dogs are well treated because they are very expensive to produce. This picture may be an over dramatization however these dogs live their lives confined to the laboratory or farm colony.

    This project personally “hits home” when I look at the pictures of Georgie and MacGyver. The bottom line - Does my dog have “base sequences of DNA” that Georgie also had that will lead to a similar autoimmune disease? Is there anyway to prevent this for MacGyver? Is there anyway to prevent this for the breed?

    Let’s look at where a LIMS may be found in a typical workflow. Depending on the business or organization, you will typically find a LIMS in either a laboratory or a production line. A LIMS installed in a laboratory setting can be part of an integrated environment consisting of sample prep, sample handling, freezers for sample storage, sample testing and data gathering and analysis. Our company has a clear advantage in that it provides all of the tools necessary for a modern laboratory to function: from laboratory consumables, analytical equipment and software to integration solutions. As our customers look to build their laboratories, Thermo Scientific LIMS play a critical role in solidifying the Thermo Scientific brand as the premier source for integrated laboratory workflow solutions. In the Pharmaceutical industry, which includes CROs (also known as Contract Research Organizations), a LIMS is a critical component of each phase of the drug development process. Thermo Scientific LIMS are considered the benchmark in drug discovery, development and manufacturing R&D and QA/QC. Our LIMS are purpose-built to reflect the specific workflow in each stage of the drug development process, which simplifies training and user acceptance because the LIMS mirrors the established workflow for that specific part of the laboratory. Our purpose-built LIMS also ensure that the software is ready to use right out of the box, with as much as 85% of the required functionality built in. Competitive LIMS are generic and not purpose-built, and they usually require costly customization and the long-term use of valuable IT resources to reflect the workflow they support.

    Karl Lark and his team was able to contribute a great deal of useful information in the current scientific literature. Here are some examples of published papers that will become invaluable to scientists all over the world studying genetics. Let me point out the paper defining a QTL that links cranial size and formation of the hip joint.

    Lets me point out the paper on the possible linkage of behavior and genotype

    Let me point out the paper linking the study of Portuguese water dogs and cardiomyopathy.

    1 Favorite

    Why are Dog Genetics Interesting? - Presentation Transcript

    1. What can your Dog teach you about Molecular Genetics?
    2. April 16 2009
      • Intended to supplement Genetics Class lectures
      • Posted with additional information and ppt on website:
        • http:// sites.google.com/site/eleaningmodulesinbiology /
      • Material was assembled for a project for Harvard Extension “The Cognitive Dog” Class
    3. This is what I want you to know
      • Why are geneticists interested in dogs?
      • What is a QTL?
      • What is the relationship between QTL’s and phenotypic change?
      • Why is a SNP an effective Genetic Marker?
      • Explain how a gene pool becomes bottlenecked.
      • What is the effect of inbreeding on SNP differences between individual breeds?
      • Why does both a pedigree family chart and genetic markers combine for a powerful tool for gene investigation?
    4. Why have dogs become very interesting to molecular geneticists?
    5. Dogs on the cutting edge of genetic research
      • Dog breeds represent a genetic bottleneck that decrease recombinant variability
      • Genetic diseases are problematic with inbred dogs. ( At least 350 that are found in humans have been identified in different breeds)
      • Many breeds have many generations of breeding documentation
    6. Canine Genetic Screening
      • Progressive Retinal Atrophy ( PRA )
      • Hypothyroidism with Goiter  ( HTG ) (Congenital Hypothyroidism)
      • Cystinuria ( CYST )
      • Globoid Cell Leucodystrophy ( GCL )
      • Neuronal Ceroid Lipofuscinosis ( NCL )
      • Phosphofructosokinase Deficiency ( PFK )
      • Von Willebrand Disease ( vWD )
      • Narcolepsy ( NARC )
      • Cone degeneration ( CD )
      • Canine Leucocyte Adhesion Deficiency ( CLAD )
      • Hemophilia B ( HmB )
      • Muscular Dystrophy ( MD )
      • Myotonia Congenita ( MC )
      • GMI Gangliosidosis ( GMIG )
      • Retinal Dystrophy ( prad )
      • SCID ( DNA- PKc & DNA PKc2 )
      • Mucopolysaccharidosis Type VII ( GUSB_NOSVVIII )
      • Thrombasthenic Thrombopathia (  THROM)
      • Congenital Cardiac Defects
      • OFA Elbow & Hip Dysplasia
    7. High quality map of Dog Genome
      • Tasha the boxer
      • 2005 map of her genome at the Broad Institute.
      • Map of 2,400 million bases
      • ATTTACGGATTACACGGAGG
      • representing 18,846 genes
      http://www.biologycorner.com/bio1/DNA.html http://www.broad.mit.edu/media/2004/doggenome_0714.html
    8. Quick Review of Genetic Terms and Principles Review of Genetics Terms and Principles
    9. Review - Big Ideas in Genetics One gene – One phenotypic trait Recessive genes can hide under Dominant Dominant phenotype One phenotype – different genotypes! or BB Bb
    10. Review - Big Ideas in Genetics * http://en.wikipedia.org/wiki/Qtl QTL – Quantitative Trait Loci 1908 Nilson-Ehle Many genes + environment One quantitative trait =
    11. Review - Big Ideas in Genetics Single Nucleotide Polymorphism * http://en.wikipedia.org/wiki/Qtl Animation http://www.dnai.org/text/mediashowcase/index2.html?id=1083
    12. only P1 and P4 have the DNA from grandparents G1 and G4 and thus, it is possible that the disease gene might be somewhere near ? . ~85% probability of finding a simple recessive trait. Review - Gene Markers for Beginners Now imagine that grandparents G1 and G4 and puppies P1 and P4 have the disease and we're looking at a recessive mode of inheritance. We would then look at the DNA markers we have and see that at position ?
    13. Let’s go to the Movies
      • Look for the following
        • Perfect Population
        • Bottleneck
        • Regulatory Gene
      • Describe the 3 sets of data necessary for this experimental design?
      http://watch.discoverychannel.ca/daily-planet/february-2009/daily-planet-february-26-2009/#clip144136
    14. Founders Effect Original Population Survivors are selected for breeding New Population
    15. Population BottleNeck
    16. Bottlenecked Gene Pool Wolf Dog AKC Breeds Wade “The Dog Genome:Sequence, Evolution, and Haplotype Structure” Broad Institute MIT
    17. The Georgie Project
      • Karl G Lark University of Utah Biology Depart
      Georgie 1986-1996
    18. Why is PWD population perfect for a genetics study?
      • Inbreeding results in less recombination
      • Less recombination results in fewer SNPs
      • Fewer SNPS make it easier to identify genetic locations
      • Documented phenotype of size, disease, hair, color in pedigree charts from breeders
      • Easier to uncover loci for base sequences responsible for phenotype
    19. Documented PWD breeding lines Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm
    20. Who’s your Daddy’s Daddy’s Daddy?
    21. With high level of inbreeding all dog would look the same? Polymorphic
    22. Genetic Resource Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm
    23. Zero Correlation Pedigree Markers
    24. Is there a correlation between genetic markers in PWD and breeding lineage? Lark Web Site: Genetics of quantitative traits in Portuguese Water Dogs http://64.226.94.9/npwd.htm
    25. Results - QTL linking the skull, legs ,hip Courtesy Sanger Inst http://www.georgieproject.com/x-ray/x-ray.htm
    26. Results - QTL Size IGF1 Chrom 15 http:// www.ncbi.nlm.nih.gov/mapview/map_search.cgi?taxid =9615&build= current&advsrch = off&query =igf1
    27. Elegance of the Georgie experiment Free living population of animals versus a colony of laboratory dogs that are inbred.
    28. Georgie and my dog Are there similar DNA sequences in my dog that will make him susceptible to autoimmune disease? Georgie McGyver
    29. If you can find a population
    30. If you can build a database of BioMarkers
    31. Biomarker Research Protein Identification Protein Digest Sample Handling Data Analysis Peptide Separation Data Storage Cells or Tissue Thermo Scientific Laboratory Workflow Sample Preparation Data Interpretation & Storage Sample Analysis Robotics Centrifuges Concentrators Liquid Chromatography/Mass Spectrometry Lab Information Management System Microplate Readers Software Xcalibur Protein Fractionation Freezers Biomarker Identified
    32. You can crack the code of life’s form and function
      • Genetic regulation of osteoarthritis: A QTL regulating cranial and caudal acetabular osteophyte formation in the hip joint of the dog (Canis familiaris). Amer. J. Med. Genet. 135A(3):334-335. http://www3.interscience.wiley.com/cgi-bin/jtoc/33129/ Carrier DR, Chase K, Lark KG.
      • Genetics of canid skeletal variation: size and shape of the pelvis. Genome Res. 2005 Dec;15(12):1825-30. PMID: 16339381 [PubMed - indexed for MEDLINE] Chase K, Carrier DR, Adler FR, Ostrander EA, Lark KG .
      • Interaction between the X chromosome and an autosome regulates size sexual dimorphism in Portuguese Water Dogs. Genome Res. 2005 Dec;15(12):1820-4. PMID: 16339380 [PubMed - indexed for MEDLINE] Lark, K.G., Chase, K., Carrier, D.R. and F.R. Adler (2005)
    33. Wealth of research
      • Genetic analysis of the canid skeleton: Analysis of morphological loci (QTLs) in the Portuguese Water Dog population. In: "The Genome of the Domestic Dog" (Cold Spring Harbor Monograph Series 44). pp. 67-80. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Trut, L.N., Kharlamova, A.V., Carrier, D.R., Chase, K., Kukekova, A.V., Acland, G.M. and K.G. Lark (2005)
      • Morphology and behavior: Are they coupled at the genome level? In: "The Genome of the Domestic Dog² (Cold Spring Harbor Monograph Series 44). pp. 81-93. Editors: E.A. Ostrander, U. Giger, and K. Lindblad-Toh. Cold Spring Harbor Press, Cold Spring Harbor, NY. Lark KG, Chase K, Sutter NB .
      • Genetic architecture of the dog: sexual size dimorphism and functional morphology. Trends Genet. 2006 Oct;22(10):537-44. Epub 2006 Aug 24 PMID: 16934357 [PubMed - in process
    34. Wealth of research
      • Chase K, Lawler DF, Adler FR, Ostrander EA, Lark KG. Bilaterally asymmetric effects of quantitative trait loci (QTLs): QTLs that affect laxity in the right versus left coxofemoral (hip) joints of the dog (Canis familiaris). Am J Med Genet A. 2004 Jan 30;124(3):239-47. PMID: 14708095 [PubMed - indexed for MEDLINE] Chase K, Carrier DR, Adler FR, Jarvik T, Ostrander EA, Lorentzen TD, Lark KG.
      • Inherited infantile dilated cardiomyopathy in dogs: genetic, clinical, biochemical, and morphologic findings. Am J Med Genet. 2000 Nov 6;95(1):57-66. PMID: 11074496 [PubMed - indexed for MEDLINE] Chase K, Adler FR, Miller-Stebbings K, Lark KG.
      • Teaching a new dog old tricks: identifying quantitative trait loci using lessons from plants. J Hered. 1999 Jan-Feb;90(1):43-51. PMID: 9987902 [PubMed - indexed for MEDLINE]

    + richielearnrichielearn, 7 months ago

    custom

    479 views, 1 favs, 0 embeds more stats

    Used in High Biology to reinforce concepts in Genet more

    More info about this document

    © All Rights Reserved

    Go to text version

    • Total Views 479
      • 479 on SlideShare
      • 0 from embeds
    • Comments 0
    • Favorites 1
    • Downloads 5
    Most viewed embeds

    more

    All embeds

    less

    Flagged as inappropriate Flag as inappropriate
    Flag as inappropriate

    Select your reason for flagging this presentation as inappropriate. If needed, use the feedback form to let us know more details.

    Cancel
    File a copyright complaint
    Having problems? Go to our helpdesk?

    Categories