The Trans-NIH RNAi Initiative : Informatics

  • 978 views
Uploaded on

 

More in: Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
978
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
5
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. The Trans‐NIH RNAi Ini0a0ve  Informa(cs  Rajarshi Guha 
  • 2. Mission  To establish a state of the art RNAi screening facility to perform genome-wide RNAi screens with investigators in the intramural NIH community. •  Gene func0on  •  Pathway analysis  •  Target ID  •  Compound MoA  •  Drug antagonist/ agonist 
  • 3. RNAi Informa0cs Infrastructure 
  • 4. RNAi Analysis Workflow  Raw and  GO  Processed  annota0ons  Pathways  Data  Interac0ons  • Summary  Normaliza0on  • Thresholding  Hit Triage  sta0s0cs  • Median  • Hypothesis  • GO seman0c  • Correc0ons  • Quar0le  tes0ng  similarity  • Background  • Sum of ranks  • Pathways  • Interac0ons  QC  Hit Selec0on  Follow‐up  Hit List 
  • 5. RNAi Informa0cs Toolset  • Local databases (screen data, pathways,  interac0ons, etc).  • Commercial pathway tools.   • Custom soUware for loading, analysis and  visualiza0on. 
  • 6. Back End Services   •  Currently all computa0onal analysis performed  on the backend  •  R & Bioconductor code  •  Custom R package (ncgcrnai) to support NCGC  infrastructure  –  Partly derived from cellHTS2  –  Supports QC metrics, normaliza0on, adjustments,  selec0ons, triage, (sta0c) visualiza0on, reports  •  Some Java tools for  –  Data loading  –  Library and plate registra0on 
  • 7. User Accessible Tools 
  • 8. User Accessible Tools 
  • 9. Challenge – siRNA Design &  Valida5on  •  We mostly depend on quality controls  implemented by vendor  –  siRNA design algorithms not a high priority  •  Always interested in extra filters that help us  get a reliable hit list  •  Would like to have measures of   –  Off‐target effects  –  Protein half lives 
  • 10. Challenge ‐ miRNA Target ID  •  Screened a set of 885 human miRNA’s  for CPT sensi0za0on  •  Iden0fied 23 sensi0zing miRNA’s  •  But, we don’t have target informa0on  –  Predic0ons aren’t par0cularly helpful  –  Poor overlap with siRNA hits   miRAnda  TargetScan  •  Link pathogenic  miRNA’s to human   targets 
  • 11. Challenge ‐ RNAi & Small  Molecule Screens  What targets mediate activity of siRNA and compound Given a set of siRNA hits and their targets, is there a •  Reuse pre-existing MLI data compound showing similar •  Develop new annotated libraries inhibition CAGCATGAGTACTACAGGCCA  TACGGGAACTACCATAATTTA  Target ID and validation Link RNAi generated pathway peturbations to small molecule activities. Could provide insight into polypharmacology •  Run parallel RNAi screen Goal: Develop systems level view of small molecule activity
  • 12. Challenge – RNAi Meta Analyses   •  Building up a collec0on of screens  –  Across cell lines, species, …  –  Not necessarily “designed”  •  What do we do with this?  –  Iden0fy consistent markers   –  Characterize differences between  cell lines   –  Extrapolate from gene knockdown to pathway  and higher level differences  –  Merge with gene expression data 
  • 13. The People  •  Scoh Mar0n  RNAi •  Pinar Tuzmen  •  Dac Trung Nguyen  Small Molecules •  Yuhong Wang