Joining the Dots: Integrating High Throughput Small Molecule and RNAi Screens
Upcoming SlideShare
Loading in...5
×

Like this? Share it with your network

Share

Joining the Dots: Integrating High Throughput Small Molecule and RNAi Screens

  • 1,636 views
Uploaded on

 

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
1,636
On Slideshare
1,631
From Embeds
5
Number of Embeds
1

Actions

Shares
Downloads
15
Comments
0
Likes
0

Embeds 5

http://www.slideshare.net 5

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Joining the Dots: Integra0ng High  Throughput Small Molecule and  RNAi Screens   Rajarshi Guha  NIH Chemical Genomics Center   January 24, 2010  CCMB Seminar Series  
  • 2. Background  •  Primarily cheminforma0cs  –  Data mining, algorithm development, soHware  –  QSAR, diversity analysis, virtual screening,  fragments, polypharmacology, networks  –  Work on a variety of Open Source projects  •  Recently started moving into bioinforma0cs  –  Suppor0ng RNAi screens  •  Integrate small molecule informa1on &  biosystems – systems chemical biology 
  • 3. NIH Chemical Genomics Center   Assay development  Compound  and op1miza1on  Op1miza1on  Small Molecules  Biology  Chemistry  NCGC  Informa0cs  ACOM  Genome wide RNAi  SAR analysis, method &  Automa1on, Compound  tool development  management 
  • 4. Outline  •  Small molecule screening at NCGC  •  The NCGC RNAi infrastructure  •  Making connec0ons  •  RNAi challenges 
  • 5. Small Molecules  
  • 6. Hun0ng for Leads   Target  Lead  Lead  Clinical  Iden0fica0on  Discovery  Op0miza0on  Development  HTS  Primary  Confirma0on  •  Sensi0vity  Screening  •  Select subset  •  Scaling  •  Fluorescence  to follow up  •  Counter  •  High Content  •  Diversity  screen  •  Explore SAR  Assay  Cherry Picking  Op0miza0on 
  • 7. The qHTS Paradigm  •  Tradi0onal single  point screens  can miss useful hits  •  qHTS involves concentra0on response assays  on a high‐throughput scale  •  The CRC allows us to   categorize hits in a more  fine‐grained manner  Inglese, J et al, Proc. Natl. Acad. Sci., 2006, 103, 11473‐11478 
  • 8. Conc. Response Curves  Inac1ve  •  Heuris0c assessment of the significance of a  concentra0on response curve  •  We aggregate certain curve classes into  “ac0ve”, “inconclusive” and “inac0ve”  categories  •  Inconclusive is a “catch all”   Inconclusive  category (i.e., if it not clearly   ‘ac0ve’ or ‘inac0ve’)  Ac1ve  8 
  • 9. Annota0ons   •  NCGC employs a variety of screening libraries  –  MLSMR (~ 300K)  –  LOPAC (~ 1300)  –  Prestwick, Sytravon, …  –  Beyond structures and vendor ID’s, not a whole lot  of annota0on  –  This is a required step for integra0on with RNAi  –  Obviously not possible for large diverse libraries  •  Use target predicBon models? 
  • 10. RNAi  
  • 11. Trans‐NIH RNAi Ini0a0ve ‐ Mission  To establish a state of the art RNAi screening facility to perform genome-wide RNAi screens with investigators in the intramural NIH community. •  Gene func0on  •  Pathway analysis  •  Target ID  •  Compound MoA  •  Drug antagonist/ agonist 
  • 12. Current Status   •  Using Qiagen libraries (Kinome & HDG)  –  Performing comparisons with other vendors  •  Pilot phase, run 38 screens so far, ranging from  3 plates to 100 plates  •  All screens are currently reporter  0 20 40 60 80 100 indeno!998!40 indeno!998!80 indeno!vo ! ! 0.8 ! ! ! ! ! ! ! ! !! ! ! ! ! ! !! 0.6 ! ! ! ! based  ! 0.4 0.2 cpt!mirna!5nm cpt!mirna!vo indeno!776!10 indeno!776!20 ! ! ! ! 0.8 ! ! ! ! ! •  Will start up phenotypic screens  0.6 ! !! !!! !! ! ! ! ! 0.4 0.2 cpt!hdg!redo!5nm cpt!hdg!redo!vo cpt!hdg!vo cpt!mirna!20nm Z this summer, with new robo0cs  ! ! ! ! ! ! ! ! ! ! ! ! !! ! !! ! ! ! ! !! !! !! ! ! ! !! ! ! !!! ! ! !! ! !!!!! !! !!!! ! !!!! !!! ! ! ! ! ! ! ! !!! ! ! !!!! ! ! ! ! !!! ! ! ! ! ! ! !! ! ! !! ! !! ! ! !! !! !! ! !! !!! ! !! ! ! !! !! ! ! ! !! !!! !! ! ! !! !!! ! ! ! !! ! !! !! ! ! ! 0.8 ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! !! ! ! ! !! ! !! ! !! ! ! !! !! ! ! !! ! ! ! !! ! ! ! ! ! ! ! ! !! !! ! ! !! ! ! ! ! ! ! !! !! ! !! ! !! ! !! ! ! !! ! ! !! ! ! ! !! ! !! !! !! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! ! ! !! ! ! ! ! ! ! ! ! 0.6 ! ! ! ! ! ! ! 0.4 ! 0.2 cpt!hdg!20nm cpt!hdg!5nm cpt!hdg!followup cpt!hdg!redo!20nm ! !! ! !!! !! ! ! ! !! ! !!!! ! 0.8 ! ! ! ! !! ! ! ! !! ! !! ! !!! ! ! ! ! !! ! ! ! ! ! !! ! ! !! ! ! ! ! !!! ! ! !! ! ! ! ! ! !! ! ! ! !! ! ! ! ! ! !!! ! ! ! ! !!! ! ! !!! ! ! !! ! ! !! ! ! !! ! ! ! ! !! ! ! ! ! !! ! ! ! !! ! ! ! !! ! ! ! !! ! !! ! ! !! ! ! ! ! ! ! ! !! ! ! ! ! !! !!!! ! ! ! !! ! ! ! !! !! ! ! ! ! ! !! ! !!! ! ! ! !! ! !! ! !! ! !! ! ! ! !!! ! ! ! ! !!! !!! ! ! ! ! !! ! ! ! ! ! ! !! ! ! !!! ! !! !! ! !! ! ! ! ! ! 0.6 ! ! ! ! ! !! ! ! ! ! ! ! ! !! ! !! ! !! ! !! ! ! ! ! ! !! ! ! !! ! !! ! ! !! ! ! ! ! ! ! ! ! ! ! 0.4 ! ! ! ! ! 0.2 ! 0 20 40 60 80 100 0 20 40 60 80 100 Plate Index
  • 13. RNAi Informa0cs Infrastructure 
  • 14. RNAi Analysis Workflow  Raw and  GO  Processed  annota0ons  Pathways  Data  Interac0ons  • Summary  Normaliza0on  • Thresholding  Hit Triage  sta0s0cs  • Median  • Hypothesis  • GO seman0c  • Correc0ons  • Quar0le  tes0ng  similarity  • Background  • Sum of ranks  • Pathways  • Interac0ons  QC  Hit Selec0on  Follow‐up  Hit List 
  • 15. RNAi Informa0cs Toolset  • Local databases (screen data, pathways,  interac0ons, etc).  • Commercial pathway tools.   • Custom soHware for loading, analysis and  visualiza0on. 
  • 16. Back End Services   •  Currently all computa0onal analysis performed  on the backend  •  R & Bioconductor code  •  Custom R package (ncgcrnai) to support NCGC  infrastructure  –  Partly derived from cellHTS2  –  Supports QC metrics, normaliza0on, adjustments,  selec0ons, triage, (sta0c) visualiza0on, reports  •  Some Java tools for  –  Data loading  –  Library and plate registra0on 
  • 17. User Accessible Tools 
  • 18. User Accessible Tools 
  • 19. Deploying Data  •  Small molecule HTS results are available via  PubChem  –  RNAi data is also showing up in PubChem  •  But what do we want to make available?  •  How do we make it available?  –  Standardized format (MIARE)  –  cellHTS2 “format”  –  Custom viewers  –  Raw data? Calls? 
  • 20. Challenge ‐ RNAi & Small  Molecule Screens  What targets mediate activity of siRNA and compound Pathway elucidation, •  Reuse pre-existing MLI data identification of interactions •  Develop new annotated libraries CAGCATGAGTACTACAGGCCA  TACGGGAACTACCATAATTTA  Target ID and validation Link RNAi generated pathway peturbations to small molecule activities. Could provide insight into polypharmacology •  Run parallel RNAi screen Goal: Develop systems level view of small molecule activity
  • 21. HTS for NF‐κB Antagonists   •  NF‐κB controls DNA  transcrip0on   •  Involved in cellular  responses to  s0muli  –  Immune response,  memory forma0on  –  Inflamma0on,  cancer, auto‐ immune diseases  hnp://www.genego.com 
  • 22. HTS for NF‐κB Antagonists   •  ME‐180 cell line  •  S0mulate cells using TNF, leading to NF‐κB  ac0va0on, readout via a β‐lactamase reporter  •  Iden0fy small molecules and siRNA’s that  block the resultant ac0va0on 
  • 23. Small Molecule HTS Summary  Most Potent Actives •  2,899 FDA‐approved  ! ! ! ! Proscillaridin A 0 compounds screened  ! ! !20 Activity ! !40 ! •  55 compounds retested ac0ve  ! ! ! ! ! ! !60 ! !9 !8 !7 !6 !5 log Concentration (uM) Trabectidin •  Which components of the NF‐ ! ! 0 ! ! ! !20 ! Activity κB pathway do they hit?  !60 ! !100 ! ! ! ! ! ! ! ! –  17 molecules have target/ !9 !8 !7 !6 !5 log Concentration (uM) ! ! ! Digoxin 0 ! pathway informa0on in GeneGO  ! ! !20 Activity –  Literature searches list a few  !40 ! ! ! ! ! ! !60 ! ! ! more  !9 !8 !7 !6 !5 log Concentration (uM) Miller, S.C. et al, Biochem. Pharmacol., 2010, ASAP 
  • 24. RNAi HTS Summary  •  Qiagen HDG library – 6886 genes, 4 siRNA’s  per gene  •  A total of 567 genes were knocked  down by 1 or more siRNA’s  –  We consider >= 2 as a “reliable” hit  –  16 reliable hits  –  Added in 66 genes for   follow up via triage procedure 
  • 25. The Obvious Conclusion  •  The ac0ve compounds target the 16 hits (at  least) from the RNAi screen  –  Useful if the RNAi screen was small & focused  •  But what if we’re inves0ga0ng a larger system?  –  Is there a way to get more specific?  –  Can compound data suggest RNAi non‐hits? 
  • 26. Small Molecule Targets   Bortezomib (proteosome inhibitor) ! 0 ! ! ! ! ! !20 ! ! !40 Activity ! !60 ! ! ! !80 ! ! ! !100 !9 !8 !7 !6 !5 log Concentration (uM) •  Some small molecules  interact with core  components  ! ! 0 ! ! ! ! ! ! ! ! ! ! !20 ! !40 Activity !60 !80 ! ! !120 !9 !8 !7 !6 !5 Daunorubicin (IκBα inhibitor) log Concentration (uM)
  • 27. Small Molecule Targets   ! Montelukast (LDT4 antagonist) 0 ! ! ! ! ! ! ! ! ! ! ! !20 ! !40 Activity ! !60 !80 ! !100 !9 !8 !7 !6 !5 log Concentration (uM) •  Others are ac0ve against  upstream targets  •  We also get an idea of off ‐ target effects 
  • 28. Compound Networks ‐ Similarity  •  Evaluate fingerprint‐based similarity matrix for  the 55 ac0ves  •  Connect pairs that   exhibit Tc> 0.7   •  Edges are weighted  by the Tc value   •  Most groupings are  obvious 
  • 29. A “Dic0onary” Based Approach  •  Create a small‐ish annotated library  –  “Seed” compounds  •  Use it in parallel small molecule/RNAi screens  •  Use a similarity based approach to priori0ze  larger collec0ons, in terms of an0cipated  targets  –  Currently, we’d use structural similarity  –  Diversity of priori0zed structures is dependent on  the diversity of the annotated library 
  • 30. Compound Networks ‐ Targets   •  Predict targets for the ac0ves using SEA  •  Target based compound network maps nearly  iden0cally to the   similarity based network   •  But depending on the   predicted target quality  we get poor (or no)   mappings to the   RNAi targeted genes  Keiser, M.J. et al, Nat. Biotech., 2007, 25, 197‐206 
  • 31. Gene Networks ‐ Pathways   •  Nodes are 1374 HDG  genes contained in the  NCI PID   •  Edge indicates two  genes/proteins are  involved in the same  pathway  •  “Good” hits tend to be  very highly connected  Wang, L. et al, BMC Genomics, 2009, 10, 220 
  • 32. (Reduced) Gene Networks – Pathways   •  Nodes are 526 genes  with >= 1 siRNA  showing knockdown   •  Edge indicates two  genes/proteins are  involved in the same  pathway 
  • 33. Pathway Based Integra0on  •  Direct matching of targets is not very useful  •  Try and map compounds to siRNA targets if  the compounds’ predicted target(s) and siRNA  targets are in the same pathway  –  Considering 16 reliable hits, we cover 26 pathways  –  Predicted compound targets cover 131 pathways  •  For 18 out of 41 compounds  –  3 RNAi‐derived pathways not covered by  compound‐derived pathways   •  Rhodopsin, alterna0ve NFkB, FAS 
  • 34. Pathway Based Integra0on  •  S0ll not completely useful, as it only handled  18 compounds  •  Depending on target predic0ons is probably  not a great idea 
  • 35. Integra0on Caveats   •  Biggest bonleneck is lack of resolu0on  •  Currently, both small molecule and RNAi data  are 1‐D  –  Ac0ve or inac0ve, high/low signal  –  CRC’s for small molecules alleviate this a bit  •  High content screens can provide significantly  more informa0on and so bener resolu0on  –  Data size & feature selec0on are of concern 
  • 36. Integra0on Caveats   •  Compound annota0ons are key  •  More comprehensive pathway data will be  required  •  RNAi and small molecule inhibi0on do not  always lead to the same phenotype  –  Could be indica0ve of promiscuity  –  Could indicate true biological differences  Weiss, W.A. et al, Nat. Chem. Biol., 2007, 12, 739-744
  • 37. CPT Sensi0za0on & “Central” Genes   Yves Pommier, Nat. Rev. Cancer, 2006. TOP1 poisons prevent DNA religation resulting in replication-dependent double strand breaks. Cell activates DNA damage response (e.g. ATR).
  • 38. Screening Protocol Screen conducted in the human breast cancer cell line MDA-MB-231. Many variables to optimize including transfection conditions, cell seeding density, assay conditions, and the selection of positive and negative controls.
  • 39. Hit Selection Follow-Up Dose Response Analysis ATR Screen #1 siNeg siATR-A Viability (%) siATR-B siATR-C Sensitization Ranked by Log2 Fold Change CPT (Log M) Screen #2 MAP3K7IP2 siNeg siMAP3K7IP2-A Viability (%) siMAP3K7IP2-B siMAP3K7IP2-C siMAP3K7IP2-D Sensitization Ranked by Log2 Fold Change CPT (Log M) Multiple active siRNAs for ATR, MAP3K7IP2, and BCL2L1.
  • 40. Are These Genes Relevant?  •  Some are well known to be CPT‐sensi0zers  •  Consider a HPRD PPI sub‐network  corresponding to the Qiagen HDG gene set  •  How “central” are these selected genes?  –  Larger values of betweenness  3.0 indicate that the node lies on  2.5 many shortest paths  2.0 log Frequency –  Makes sense ‐ a number of   1.5 them are stress‐related  1.0 –  But some of them have very low  0.5 betweenness values  0.0 0 2 4 6 log Betweenness
  • 41. Are These Genes Relevant?  •  Most selected genes  are densely connected  ACTC1 ! TFPI ! MMP7 ! BAG1 ! ANXA1 ! HAPLN1 ! BCLAF1 BNIP3 ! ! ACTB! THBS2 PLG ! BCL2L14 ! RAD9A ! TEGT BNIP3L ! ! PPHLN1 ! KPNA4! IRS2 ! MMP10 KPNA3 ! PMAIP1 ! ! ! CD44 ! FKBP8 BIK ! BAK1 ! MAP3K12 THBS1 ! ! ! KISS1 ! BCL2L10 VDAC1 ! ! GSTP1 ! HIST2H2BE ! PRSS2 ! IKZF3 ! COL1A1 HRK ! MOAP1 ! ALDOA ! ! BAX ! COL1A2 ! PPP1CA ! BCL2 RTN4 ! ! TUBB ! COL4A5 ANTXR1 BAD •  A few are not  LCN2 ! ITGB1 ! ! BCL2L11 BNIP1 ! ! CXCL5 ! ITGB3 ! IL8 BCL2L1 ! ! ! ! MMP9 ! TGM2 BMF ! BECN1 ! PLCD1 ! ! TWF1 ! FN1 ! BCL2L12! HD ! COL4A4 MAPK8 ! FN1 ! BCAP31 ! ! TIMP3 ! ! ! PSEN1 ! PZP ! CRYAB ! IRS1 ! CYCS ! CASP8 ! CASP3 ! LTBP1! COL4A3 ! SNCA TP53 ! ! COL4A6 ! SPARC ! COL4A1 ! NLRP1 CASP1 ! ! RHOA ! COL4A2 ! CXCL1 ! RB1 SERPINF2 SIVA1 ! ! ! CASP9 ! CFLAR ! RECK ! PSEN2 TMSB4X ! AVEN ! ! –  Generally did not  AREG ! CAPN1 ! EIF5A! BMPR2 ! BTC ! MMP26 ! CRYAA ! HIST1H2BG S100A7 ! ! PRNP ! DMAP1 ! NEK6 ! NR2E3 ! STK11 ! EP300 ! L1CAM ! FGFR1 ! VPS37B ! PPP1R9A reconfirm  ! DAXX ! DNMT1 ! TP53 ! RPS6 ! CDC2 ! NCAN ! PPP1R9B HCK ! ! CREBBP ! BDNF ! AR ! MDM2 ! PDC ! PDCD6IP ! COASY ! EP300 ! POLDIP3 ! MAPK1 ! ST8SIA3 ! TRAF4 ! NCAM1 ! VPS28 ! RPS6KB1 ! CRX ! TSG101 ! GDNF ! PPP2CA ! •  Network metrics   GGA3 ! VPS37D ! NCBP1 ! UBA52 ! EIF4EBP1 ! RAXL1 ! SPTB CDC42 IPO13! ! GFRA1! AATF ! ! AKT1 ! LRSAM1 ! EEF2K! CDKN1A ! HGS ! RAC1 ! PDPK1 ! FRAP1 ! ST8SIA4 ! FYN ! ST8SIA2 ! VPS37A ! VPS37C ! GGA1 ! TERT ! NRL ! BANF1 ! could be used to   FLT1 ! KDR ! RAD17 ! EEF1E1 ! CBLB LAT SHB SH3BP2 VAV1 TUBB PRLR SIT1 TUBA4A ! ! ! ! ! ! ! GNA12 ! RHOA ! GNAQ ! PPARA ! GP1BA ! provide confidence  ! ! SLA PLCG1 CRK ! ! ESR2 ! RHEB ! ! CHEK1 ! ABL1 SOS1 ! ! FCRL3 ! CLSPN PAG1 GRB2 ! PRKAR2A ! ! ! LAX1 ! LCP2 FYN MUC1 ! ! ! GAB2 CBLSHC1 PTK2B ! ! ! ESR1 ! CHD4 ! NFAM1 ! AKAP13 ! ATR ! RASA1 LCK ZAP70 ! ! TP53 ! ! ! SH2B3 ! ACP1 ! CD247 PTPN6 ! CARD11 GP9 ! YWHAB ! ! ! BRCA1 ! PTPRC ! THRA ! in selec0ons  XPA ! SLA2 ! CD5 ! CD3E ! CD79B ! DUSP3 ! MSH2! E2F1 ! FCGR3A ! YWHAG ! YWHAE YWHAZ RXRB ! CHEK2 ! IFNAR1 ! DBNL ! ! ! TREX1 ! DEF6 NBN ! ! PTPN3 ! SLAMF6 ! TYROBP ! XRCC5 ! WIPF1 ! CTNNAL1 ! GP1BB ! RBL2 ! HGS ! LEF1 ! MC3R ! SNTB2 ! RASGRP1 ! HIPK2 ! SMAD3 ! SMAD7 ! FOS ! SMAD6 ! MAPK14 ! SNTB1 ! HRAS ! PPM1L MAP3K7IP1 MAPK8 MAP2K4 ! ! MAP2K6 ! ! ! MC4R ! ! ! IRAK1 ! IL17RD! BIRC4 ! RELA ! RBL1 ! SRC ! PELI3 ! DGKZ ! MAP3K7 ! STAT3 IKBKAP ! ! AGRP ! BIRC1 ! TRAF6 ! SNTG1 ! TNFRSF11A ! MAP3K14 ! PLCG1 ! IKBKB ! PRKCA ! MAP4K4 ! CHUK ! GHRL ! ALS2CR2 MAP3K3 ! ALX4 ! PPM1B ! ! TRAF3IP2 ! DMD ! MAP4K1 ! EIF2AK2 PEBP1 ! ! MAP3K5 ! SNTA1 ! NRIP1 ! BCL10 ! LEPR ! RB1 ! CARD11 ! CART1 ! MC5R !
  • 42. Challenge ‐ miRNA Target ID  •  Screened a set of 885 human miRNA’s  for CPT sensi0za0on  •  Iden0fied 23 sensi0zing miRNA’s  •  But, we don’t have target informa0on  –  Predic0ons aren’t par0cularly helpful  –  Poor overlap with siRNA hits   miRAnda  TargetScan  •  Link pathogenic  miRNA’s to human   targets? 
  • 43. Challenge – RNAi Meta Analyses   •  Building up a collec0on of screens  –  Across cell lines, species, …  –  Not necessarily “designed”  •  What do we do with this?  –  Iden0fy consistent markers   –  Characterize differences between  cell lines   –  Extrapolate from gene knockdown to pathway  and higher level differences  –  Merge with gene expression data 
  • 44. Challenge – Combinatorial RNAi   •  Elegant way to probe gene interac0ons  •  Extend to network interac0ons  •  Requires efficient experimental design  •  Could lead to enhanced target iden0fica0on  for polypharmacology  Nir, O. et al, Genome. Res., 2010, ASAP Sahin, O. et al, Proc. Natl. Acad. Sci., 2007,104, 6579-6584 Tischler, J. et al, Genome Biol., 2006, 7, R69
  • 45. Conclusions   •  Building up a wealth of small molecule and RNAi  data  •  “Standard” analysis of RNAi screens rela0vely  straighxorward  •  Challenges involve integra0ng RNAi data with  other sources  •  Primary bonleneck is dimensionality of the data  –  Simple flourescence‐based approaches do not provide  sufficient resolu0on  –  High‐content is required 
  • 46. The People  •  Scon Mar0n  RNAi •  Pinar Tuzmen  •  Dac Trung Nguyen  •  Yuhong Wang  Small Molecules •  Ruili Huang