• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
Joining the Dots: Integrating High Throughput Small Molecule and RNAi Screens
 

Joining the Dots: Integrating High Throughput Small Molecule and RNAi Screens

on

  • 1,545 views

 

Statistics

Views

Total Views
1,545
Views on SlideShare
1,540
Embed Views
5

Actions

Likes
0
Downloads
15
Comments
0

1 Embed 5

http://www.slideshare.net 5

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    Joining the Dots: Integrating High Throughput Small Molecule and RNAi Screens Joining the Dots: Integrating High Throughput Small Molecule and RNAi Screens Presentation Transcript

    • Joining the Dots: Integra0ng High  Throughput Small Molecule and  RNAi Screens   Rajarshi Guha  NIH Chemical Genomics Center   January 24, 2010  CCMB Seminar Series  
    • Background  •  Primarily cheminforma0cs  –  Data mining, algorithm development, soHware  –  QSAR, diversity analysis, virtual screening,  fragments, polypharmacology, networks  –  Work on a variety of Open Source projects  •  Recently started moving into bioinforma0cs  –  Suppor0ng RNAi screens  •  Integrate small molecule informa1on &  biosystems – systems chemical biology 
    • NIH Chemical Genomics Center   Assay development  Compound  and op1miza1on  Op1miza1on  Small Molecules  Biology  Chemistry  NCGC  Informa0cs  ACOM  Genome wide RNAi  SAR analysis, method &  Automa1on, Compound  tool development  management 
    • Outline  •  Small molecule screening at NCGC  •  The NCGC RNAi infrastructure  •  Making connec0ons  •  RNAi challenges 
    • Small Molecules  
    • Hun0ng for Leads   Target  Lead  Lead  Clinical  Iden0fica0on  Discovery  Op0miza0on  Development  HTS  Primary  Confirma0on  •  Sensi0vity  Screening  •  Select subset  •  Scaling  •  Fluorescence  to follow up  •  Counter  •  High Content  •  Diversity  screen  •  Explore SAR  Assay  Cherry Picking  Op0miza0on 
    • The qHTS Paradigm  •  Tradi0onal single  point screens  can miss useful hits  •  qHTS involves concentra0on response assays  on a high‐throughput scale  •  The CRC allows us to   categorize hits in a more  fine‐grained manner  Inglese, J et al, Proc. Natl. Acad. Sci., 2006, 103, 11473‐11478 
    • Conc. Response Curves  Inac1ve  •  Heuris0c assessment of the significance of a  concentra0on response curve  •  We aggregate certain curve classes into  “ac0ve”, “inconclusive” and “inac0ve”  categories  •  Inconclusive is a “catch all”   Inconclusive  category (i.e., if it not clearly   ‘ac0ve’ or ‘inac0ve’)  Ac1ve  8 
    • Annota0ons   •  NCGC employs a variety of screening libraries  –  MLSMR (~ 300K)  –  LOPAC (~ 1300)  –  Prestwick, Sytravon, …  –  Beyond structures and vendor ID’s, not a whole lot  of annota0on  –  This is a required step for integra0on with RNAi  –  Obviously not possible for large diverse libraries  •  Use target predicBon models? 
    • RNAi  
    • Trans‐NIH RNAi Ini0a0ve ‐ Mission  To establish a state of the art RNAi screening facility to perform genome-wide RNAi screens with investigators in the intramural NIH community. •  Gene func0on  •  Pathway analysis  •  Target ID  •  Compound MoA  •  Drug antagonist/ agonist 
    • Current Status   •  Using Qiagen libraries (Kinome & HDG)  –  Performing comparisons with other vendors  •  Pilot phase, run 38 screens so far, ranging from  3 plates to 100 plates  •  All screens are currently reporter  0 20 40 60 80 100 indeno!998!40 indeno!998!80 indeno!vo ! ! 0.8 ! ! ! ! ! ! ! ! !! ! ! ! ! ! !! 0.6 ! ! ! ! based  ! 0.4 0.2 cpt!mirna!5nm cpt!mirna!vo indeno!776!10 indeno!776!20 ! ! ! ! 0.8 ! ! ! ! ! •  Will start up phenotypic screens  0.6 ! !! !!! !! ! ! ! ! 0.4 0.2 cpt!hdg!redo!5nm cpt!hdg!redo!vo cpt!hdg!vo cpt!mirna!20nm Z this summer, with new robo0cs  ! ! ! ! ! ! ! ! ! ! ! ! !! ! !! ! ! ! ! !! !! !! ! ! ! !! ! ! !!! ! ! !! ! !!!!! !! !!!! ! !!!! !!! ! ! ! ! ! ! ! !!! ! ! !!!! ! ! ! ! !!! ! ! ! ! ! ! !! ! ! !! ! !! ! ! !! !! !! ! !! !!! ! !! ! ! !! !! ! ! ! !! !!! !! ! ! !! !!! ! ! ! !! ! !! !! ! ! ! 0.8 ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! !! ! ! ! !! ! !! ! !! ! ! !! !! ! ! !! ! ! ! !! ! ! ! ! ! ! ! ! !! !! ! ! !! ! ! ! ! ! ! !! !! ! !! ! !! ! !! ! ! !! ! ! !! ! ! ! !! ! !! !! !! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! ! ! !! ! ! ! ! ! ! ! ! 0.6 ! ! ! ! ! ! ! 0.4 ! 0.2 cpt!hdg!20nm cpt!hdg!5nm cpt!hdg!followup cpt!hdg!redo!20nm ! !! ! !!! !! ! ! ! !! ! !!!! ! 0.8 ! ! ! ! !! ! ! ! !! ! !! ! !!! ! ! ! ! !! ! ! ! ! ! !! ! ! !! ! ! ! ! !!! ! ! !! ! ! ! ! ! !! ! ! ! !! ! ! ! ! ! !!! ! ! ! ! !!! ! ! !!! ! ! !! ! ! !! ! ! !! ! ! ! ! !! ! ! ! ! !! ! ! ! !! ! ! ! !! ! ! ! !! ! !! ! ! !! ! ! ! ! ! ! ! !! ! ! ! ! !! !!!! ! ! ! !! ! ! ! !! !! ! ! ! ! ! !! ! !!! ! ! ! !! ! !! ! !! ! !! ! ! ! !!! ! ! ! ! !!! !!! ! ! ! ! !! ! ! ! ! ! ! !! ! ! !!! ! !! !! ! !! ! ! ! ! ! 0.6 ! ! ! ! ! !! ! ! ! ! ! ! ! !! ! !! ! !! ! !! ! ! ! ! ! !! ! ! !! ! !! ! ! !! ! ! ! ! ! ! ! ! ! ! 0.4 ! ! ! ! ! 0.2 ! 0 20 40 60 80 100 0 20 40 60 80 100 Plate Index
    • RNAi Informa0cs Infrastructure 
    • RNAi Analysis Workflow  Raw and  GO  Processed  annota0ons  Pathways  Data  Interac0ons  • Summary  Normaliza0on  • Thresholding  Hit Triage  sta0s0cs  • Median  • Hypothesis  • GO seman0c  • Correc0ons  • Quar0le  tes0ng  similarity  • Background  • Sum of ranks  • Pathways  • Interac0ons  QC  Hit Selec0on  Follow‐up  Hit List 
    • RNAi Informa0cs Toolset  • Local databases (screen data, pathways,  interac0ons, etc).  • Commercial pathway tools.   • Custom soHware for loading, analysis and  visualiza0on. 
    • Back End Services   •  Currently all computa0onal analysis performed  on the backend  •  R & Bioconductor code  •  Custom R package (ncgcrnai) to support NCGC  infrastructure  –  Partly derived from cellHTS2  –  Supports QC metrics, normaliza0on, adjustments,  selec0ons, triage, (sta0c) visualiza0on, reports  •  Some Java tools for  –  Data loading  –  Library and plate registra0on 
    • User Accessible Tools 
    • User Accessible Tools 
    • Deploying Data  •  Small molecule HTS results are available via  PubChem  –  RNAi data is also showing up in PubChem  •  But what do we want to make available?  •  How do we make it available?  –  Standardized format (MIARE)  –  cellHTS2 “format”  –  Custom viewers  –  Raw data? Calls? 
    • Challenge ‐ RNAi & Small  Molecule Screens  What targets mediate activity of siRNA and compound Pathway elucidation, •  Reuse pre-existing MLI data identification of interactions •  Develop new annotated libraries CAGCATGAGTACTACAGGCCA  TACGGGAACTACCATAATTTA  Target ID and validation Link RNAi generated pathway peturbations to small molecule activities. Could provide insight into polypharmacology •  Run parallel RNAi screen Goal: Develop systems level view of small molecule activity
    • HTS for NF‐κB Antagonists   •  NF‐κB controls DNA  transcrip0on   •  Involved in cellular  responses to  s0muli  –  Immune response,  memory forma0on  –  Inflamma0on,  cancer, auto‐ immune diseases  hnp://www.genego.com 
    • HTS for NF‐κB Antagonists   •  ME‐180 cell line  •  S0mulate cells using TNF, leading to NF‐κB  ac0va0on, readout via a β‐lactamase reporter  •  Iden0fy small molecules and siRNA’s that  block the resultant ac0va0on 
    • Small Molecule HTS Summary  Most Potent Actives •  2,899 FDA‐approved  ! ! ! ! Proscillaridin A 0 compounds screened  ! ! !20 Activity ! !40 ! •  55 compounds retested ac0ve  ! ! ! ! ! ! !60 ! !9 !8 !7 !6 !5 log Concentration (uM) Trabectidin •  Which components of the NF‐ ! ! 0 ! ! ! !20 ! Activity κB pathway do they hit?  !60 ! !100 ! ! ! ! ! ! ! ! –  17 molecules have target/ !9 !8 !7 !6 !5 log Concentration (uM) ! ! ! Digoxin 0 ! pathway informa0on in GeneGO  ! ! !20 Activity –  Literature searches list a few  !40 ! ! ! ! ! ! !60 ! ! ! more  !9 !8 !7 !6 !5 log Concentration (uM) Miller, S.C. et al, Biochem. Pharmacol., 2010, ASAP 
    • RNAi HTS Summary  •  Qiagen HDG library – 6886 genes, 4 siRNA’s  per gene  •  A total of 567 genes were knocked  down by 1 or more siRNA’s  –  We consider >= 2 as a “reliable” hit  –  16 reliable hits  –  Added in 66 genes for   follow up via triage procedure 
    • The Obvious Conclusion  •  The ac0ve compounds target the 16 hits (at  least) from the RNAi screen  –  Useful if the RNAi screen was small & focused  •  But what if we’re inves0ga0ng a larger system?  –  Is there a way to get more specific?  –  Can compound data suggest RNAi non‐hits? 
    • Small Molecule Targets   Bortezomib (proteosome inhibitor) ! 0 ! ! ! ! ! !20 ! ! !40 Activity ! !60 ! ! ! !80 ! ! ! !100 !9 !8 !7 !6 !5 log Concentration (uM) •  Some small molecules  interact with core  components  ! ! 0 ! ! ! ! ! ! ! ! ! ! !20 ! !40 Activity !60 !80 ! ! !120 !9 !8 !7 !6 !5 Daunorubicin (IκBα inhibitor) log Concentration (uM)
    • Small Molecule Targets   ! Montelukast (LDT4 antagonist) 0 ! ! ! ! ! ! ! ! ! ! ! !20 ! !40 Activity ! !60 !80 ! !100 !9 !8 !7 !6 !5 log Concentration (uM) •  Others are ac0ve against  upstream targets  •  We also get an idea of off ‐ target effects 
    • Compound Networks ‐ Similarity  •  Evaluate fingerprint‐based similarity matrix for  the 55 ac0ves  •  Connect pairs that   exhibit Tc> 0.7   •  Edges are weighted  by the Tc value   •  Most groupings are  obvious 
    • A “Dic0onary” Based Approach  •  Create a small‐ish annotated library  –  “Seed” compounds  •  Use it in parallel small molecule/RNAi screens  •  Use a similarity based approach to priori0ze  larger collec0ons, in terms of an0cipated  targets  –  Currently, we’d use structural similarity  –  Diversity of priori0zed structures is dependent on  the diversity of the annotated library 
    • Compound Networks ‐ Targets   •  Predict targets for the ac0ves using SEA  •  Target based compound network maps nearly  iden0cally to the   similarity based network   •  But depending on the   predicted target quality  we get poor (or no)   mappings to the   RNAi targeted genes  Keiser, M.J. et al, Nat. Biotech., 2007, 25, 197‐206 
    • Gene Networks ‐ Pathways   •  Nodes are 1374 HDG  genes contained in the  NCI PID   •  Edge indicates two  genes/proteins are  involved in the same  pathway  •  “Good” hits tend to be  very highly connected  Wang, L. et al, BMC Genomics, 2009, 10, 220 
    • (Reduced) Gene Networks – Pathways   •  Nodes are 526 genes  with >= 1 siRNA  showing knockdown   •  Edge indicates two  genes/proteins are  involved in the same  pathway 
    • Pathway Based Integra0on  •  Direct matching of targets is not very useful  •  Try and map compounds to siRNA targets if  the compounds’ predicted target(s) and siRNA  targets are in the same pathway  –  Considering 16 reliable hits, we cover 26 pathways  –  Predicted compound targets cover 131 pathways  •  For 18 out of 41 compounds  –  3 RNAi‐derived pathways not covered by  compound‐derived pathways   •  Rhodopsin, alterna0ve NFkB, FAS 
    • Pathway Based Integra0on  •  S0ll not completely useful, as it only handled  18 compounds  •  Depending on target predic0ons is probably  not a great idea 
    • Integra0on Caveats   •  Biggest bonleneck is lack of resolu0on  •  Currently, both small molecule and RNAi data  are 1‐D  –  Ac0ve or inac0ve, high/low signal  –  CRC’s for small molecules alleviate this a bit  •  High content screens can provide significantly  more informa0on and so bener resolu0on  –  Data size & feature selec0on are of concern 
    • Integra0on Caveats   •  Compound annota0ons are key  •  More comprehensive pathway data will be  required  •  RNAi and small molecule inhibi0on do not  always lead to the same phenotype  –  Could be indica0ve of promiscuity  –  Could indicate true biological differences  Weiss, W.A. et al, Nat. Chem. Biol., 2007, 12, 739-744
    • CPT Sensi0za0on & “Central” Genes   Yves Pommier, Nat. Rev. Cancer, 2006. TOP1 poisons prevent DNA religation resulting in replication-dependent double strand breaks. Cell activates DNA damage response (e.g. ATR).
    • Screening Protocol Screen conducted in the human breast cancer cell line MDA-MB-231. Many variables to optimize including transfection conditions, cell seeding density, assay conditions, and the selection of positive and negative controls.
    • Hit Selection Follow-Up Dose Response Analysis ATR Screen #1 siNeg siATR-A Viability (%) siATR-B siATR-C Sensitization Ranked by Log2 Fold Change CPT (Log M) Screen #2 MAP3K7IP2 siNeg siMAP3K7IP2-A Viability (%) siMAP3K7IP2-B siMAP3K7IP2-C siMAP3K7IP2-D Sensitization Ranked by Log2 Fold Change CPT (Log M) Multiple active siRNAs for ATR, MAP3K7IP2, and BCL2L1.
    • Are These Genes Relevant?  •  Some are well known to be CPT‐sensi0zers  •  Consider a HPRD PPI sub‐network  corresponding to the Qiagen HDG gene set  •  How “central” are these selected genes?  –  Larger values of betweenness  3.0 indicate that the node lies on  2.5 many shortest paths  2.0 log Frequency –  Makes sense ‐ a number of   1.5 them are stress‐related  1.0 –  But some of them have very low  0.5 betweenness values  0.0 0 2 4 6 log Betweenness
    • Are These Genes Relevant?  •  Most selected genes  are densely connected  ACTC1 ! TFPI ! MMP7 ! BAG1 ! ANXA1 ! HAPLN1 ! BCLAF1 BNIP3 ! ! ACTB! THBS2 PLG ! BCL2L14 ! RAD9A ! TEGT BNIP3L ! ! PPHLN1 ! KPNA4! IRS2 ! MMP10 KPNA3 ! PMAIP1 ! ! ! CD44 ! FKBP8 BIK ! BAK1 ! MAP3K12 THBS1 ! ! ! KISS1 ! BCL2L10 VDAC1 ! ! GSTP1 ! HIST2H2BE ! PRSS2 ! IKZF3 ! COL1A1 HRK ! MOAP1 ! ALDOA ! ! BAX ! COL1A2 ! PPP1CA ! BCL2 RTN4 ! ! TUBB ! COL4A5 ANTXR1 BAD •  A few are not  LCN2 ! ITGB1 ! ! BCL2L11 BNIP1 ! ! CXCL5 ! ITGB3 ! IL8 BCL2L1 ! ! ! ! MMP9 ! TGM2 BMF ! BECN1 ! PLCD1 ! ! TWF1 ! FN1 ! BCL2L12! HD ! COL4A4 MAPK8 ! FN1 ! BCAP31 ! ! TIMP3 ! ! ! PSEN1 ! PZP ! CRYAB ! IRS1 ! CYCS ! CASP8 ! CASP3 ! LTBP1! COL4A3 ! SNCA TP53 ! ! COL4A6 ! SPARC ! COL4A1 ! NLRP1 CASP1 ! ! RHOA ! COL4A2 ! CXCL1 ! RB1 SERPINF2 SIVA1 ! ! ! CASP9 ! CFLAR ! RECK ! PSEN2 TMSB4X ! AVEN ! ! –  Generally did not  AREG ! CAPN1 ! EIF5A! BMPR2 ! BTC ! MMP26 ! CRYAA ! HIST1H2BG S100A7 ! ! PRNP ! DMAP1 ! NEK6 ! NR2E3 ! STK11 ! EP300 ! L1CAM ! FGFR1 ! VPS37B ! PPP1R9A reconfirm  ! DAXX ! DNMT1 ! TP53 ! RPS6 ! CDC2 ! NCAN ! PPP1R9B HCK ! ! CREBBP ! BDNF ! AR ! MDM2 ! PDC ! PDCD6IP ! COASY ! EP300 ! POLDIP3 ! MAPK1 ! ST8SIA3 ! TRAF4 ! NCAM1 ! VPS28 ! RPS6KB1 ! CRX ! TSG101 ! GDNF ! PPP2CA ! •  Network metrics   GGA3 ! VPS37D ! NCBP1 ! UBA52 ! EIF4EBP1 ! RAXL1 ! SPTB CDC42 IPO13! ! GFRA1! AATF ! ! AKT1 ! LRSAM1 ! EEF2K! CDKN1A ! HGS ! RAC1 ! PDPK1 ! FRAP1 ! ST8SIA4 ! FYN ! ST8SIA2 ! VPS37A ! VPS37C ! GGA1 ! TERT ! NRL ! BANF1 ! could be used to   FLT1 ! KDR ! RAD17 ! EEF1E1 ! CBLB LAT SHB SH3BP2 VAV1 TUBB PRLR SIT1 TUBA4A ! ! ! ! ! ! ! GNA12 ! RHOA ! GNAQ ! PPARA ! GP1BA ! provide confidence  ! ! SLA PLCG1 CRK ! ! ESR2 ! RHEB ! ! CHEK1 ! ABL1 SOS1 ! ! FCRL3 ! CLSPN PAG1 GRB2 ! PRKAR2A ! ! ! LAX1 ! LCP2 FYN MUC1 ! ! ! GAB2 CBLSHC1 PTK2B ! ! ! ESR1 ! CHD4 ! NFAM1 ! AKAP13 ! ATR ! RASA1 LCK ZAP70 ! ! TP53 ! ! ! SH2B3 ! ACP1 ! CD247 PTPN6 ! CARD11 GP9 ! YWHAB ! ! ! BRCA1 ! PTPRC ! THRA ! in selec0ons  XPA ! SLA2 ! CD5 ! CD3E ! CD79B ! DUSP3 ! MSH2! E2F1 ! FCGR3A ! YWHAG ! YWHAE YWHAZ RXRB ! CHEK2 ! IFNAR1 ! DBNL ! ! ! TREX1 ! DEF6 NBN ! ! PTPN3 ! SLAMF6 ! TYROBP ! XRCC5 ! WIPF1 ! CTNNAL1 ! GP1BB ! RBL2 ! HGS ! LEF1 ! MC3R ! SNTB2 ! RASGRP1 ! HIPK2 ! SMAD3 ! SMAD7 ! FOS ! SMAD6 ! MAPK14 ! SNTB1 ! HRAS ! PPM1L MAP3K7IP1 MAPK8 MAP2K4 ! ! MAP2K6 ! ! ! MC4R ! ! ! IRAK1 ! IL17RD! BIRC4 ! RELA ! RBL1 ! SRC ! PELI3 ! DGKZ ! MAP3K7 ! STAT3 IKBKAP ! ! AGRP ! BIRC1 ! TRAF6 ! SNTG1 ! TNFRSF11A ! MAP3K14 ! PLCG1 ! IKBKB ! PRKCA ! MAP4K4 ! CHUK ! GHRL ! ALS2CR2 MAP3K3 ! ALX4 ! PPM1B ! ! TRAF3IP2 ! DMD ! MAP4K1 ! EIF2AK2 PEBP1 ! ! MAP3K5 ! SNTA1 ! NRIP1 ! BCL10 ! LEPR ! RB1 ! CARD11 ! CART1 ! MC5R !
    • Challenge ‐ miRNA Target ID  •  Screened a set of 885 human miRNA’s  for CPT sensi0za0on  •  Iden0fied 23 sensi0zing miRNA’s  •  But, we don’t have target informa0on  –  Predic0ons aren’t par0cularly helpful  –  Poor overlap with siRNA hits   miRAnda  TargetScan  •  Link pathogenic  miRNA’s to human   targets? 
    • Challenge – RNAi Meta Analyses   •  Building up a collec0on of screens  –  Across cell lines, species, …  –  Not necessarily “designed”  •  What do we do with this?  –  Iden0fy consistent markers   –  Characterize differences between  cell lines   –  Extrapolate from gene knockdown to pathway  and higher level differences  –  Merge with gene expression data 
    • Challenge – Combinatorial RNAi   •  Elegant way to probe gene interac0ons  •  Extend to network interac0ons  •  Requires efficient experimental design  •  Could lead to enhanced target iden0fica0on  for polypharmacology  Nir, O. et al, Genome. Res., 2010, ASAP Sahin, O. et al, Proc. Natl. Acad. Sci., 2007,104, 6579-6584 Tischler, J. et al, Genome Biol., 2006, 7, R69
    • Conclusions   •  Building up a wealth of small molecule and RNAi  data  •  “Standard” analysis of RNAi screens rela0vely  straighxorward  •  Challenges involve integra0ng RNAi data with  other sources  •  Primary bonleneck is dimensionality of the data  –  Simple flourescence‐based approaches do not provide  sufficient resolu0on  –  High‐content is required 
    • The People  •  Scon Mar0n  RNAi •  Pinar Tuzmen  •  Dac Trung Nguyen  •  Yuhong Wang  Small Molecules •  Ruili Huang