Hit Triage in RNAi Screens マking Use of Interaction and Pathway Data - Enhance Hit Selection
Upcoming SlideShare
Loading in...5
×

Like this? Share it with your network

Share

Hit Triage in RNAi Screens マking Use of Interaction and Pathway Data - Enhance Hit Selection

  • 1,712 views
Uploaded on

 

More in: Technology
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
No Downloads

Views

Total Views
1,712
On Slideshare
1,707
From Embeds
5
Number of Embeds
2

Actions

Shares
Downloads
14
Comments
0
Likes
2

Embeds 5

http://www.slideshare.net 3
http://localhost 2

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. Hit Triage in RNAi Screens   Making Use of Interac1on and Pathway Data   to Enhance Hit Selec1on  Rajarshi Guha  NIH Chemical Genomics Center   March 18, 2010  GeneGO User Group Mee5ng, Boston, MA 
  • 2. Outline  •  The NCGC RNAi infrastructure  •  Selec:on & Triage  •  Case Studies 
  • 3. Trans‐NIH RNAi Ini6a6ve ‐ Mission  To establish a state of the art RNAi screening facility to perform genome-wide RNAi screens with investigators in the intramural NIH community. •  Gene func:on  •  Pathway analysis  •  Target ID  •  Compound MoA  •  Drug antagonist/ agonist 
  • 4. Pilot Phase Screens  
  • 5. RNAi Informa6cs Toolset  • Local databases (screen data, pathways,  interac:ons, etc).  • Commercial pathway tools.   • Custom soKware for loading, analysis and  visualiza:on. 
  • 6. Back End Services   •  Currently all computa:onal analysis performed  on the backend  •  R & Bioconductor code  •  Custom R package (ncgcrnai) to support NCGC  infrastructure  –  Partly derived from cellHTS2  –  Supports QC metrics, normaliza:on, adjustments,  selec:ons, triage, (sta:c) visualiza:on, reports  •  Some Java tools for  –  Data loading  –  Library and plate registra:on 
  • 7. User Accessible Tools 
  • 8. RNAi Analysis Workflow  Raw and  GO  Processed  annota:ons  Pathways  Data  Interac:ons  • Summary  Normaliza:on  • Thresholding  Hit Triage  sta:s:cs  • Median  • Hypothesis  • GO seman:c  • Correc:ons  • Quar:le  tes:ng  similarity  • Background  • Sum of ranks  • Pathways  • Interac:ons  QC  Hit Selec:on  Follow‐up  Hit List 
  • 9. Hit Selec6on Methods   •  Thresholding  Negative Positive ! ! 150 ! ! ! ! ! Sample ! ! ! ! ! •  Hypothesis tes:ng  ! ! !! ! ! ! ! ! ! ! ! !! ! ! ! ! ! !! ! ! ! ! ! !! ! ! ! ! !! !! ! ! ! ! ! !! ! ! !! ! !! ! ! ! ! ! ! ! ! ! ! !! !! ! !! ! ! ! ! ! ! ! ! !! ! ! !! ! ! ! ! ! ! ! ! ! !! !! !! ! ! !! !! ! ! ! ! !! !! !! ! ! !! !! ! !!! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! !! ! !! ! !! ! ! ! !! !! ! !! ! !! ! ! ! !! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! !! ! ! !! ! ! ! !! ! ! ! !! ! !!! ! ! !! ! !!! ! ! !! !!! ! !! ! ! ! !! ! !!! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! ! ! !! ! ! !! ! ! ! ! ! ! ! ! !! ! !! !! ! ! !! ! ! !! ! ! !! ! ! ! !! ! ! ! !! Signal ! ! ! !! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! !! ! !! !! ! !! !! ! ! !! ! !! ! ! ! !! ! ! !! ! ! ! ! !! 100 ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! !! ! !! !! !! ! ! !!! ! !!!! ! ! ! !! !!!! ! !!! !! !!! ! !!!!!! ! ! ! ! ! ! !!! ! !!! !! !! !! ! ! ! !! ! ! ! ! !! ! ! ! ! !! ! ! ! ! ! ! !! ! ! ! !! ! ! ! ! ! !! !! ! ! ! !! !! !!!!! !! ! ! !!! ! !! ! ! ! ! !!! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! !! ! ! !! ! ! ! ! ! ! ! ! ! !! ! ! !! ! ! ! !! ! !!! !! !! ! ! ! ! !! !! ! !!!!! ! !!! ! ! ! ! !! !!! !! ! ! !!!! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! ! !!!! ! ! ! ! ! ! !! ! ! !!!! !! ! ! ! ! !! ! !! ! !! ! ! ! ! ! ! ! !!! ! ! !! ! ! !! ! ! ! !! ! ! !! ! ! ! ! ! ! ! ! ! !! !! !! !! !! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! !! ! ! ! ! !! !! ! !! ! ! ! ! !!! ! ! !!! ! !! ! !! ! ! !!! ! !!!! ! ! ! ! ! !!!! !!!! !! ! ! ! ! ! ! ! ! !! ! !! !! ! ! !! ! ! ! ! !! ! !!! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! !! ! ! !! ! ! ! ! ! ! ! ! ! ! !!! ! !!! ! ! ! ! !!! ! ! ! ! ! ! ! ! !! !! !!! !! ! ! !! ! ! ! !! ! !!! ! ! ! ! !! ! ! ! ! !! ! !! !! ! ! ! !! !!! ! !!!!!! !!! !! !! ! ! ! ! !!! ! ! ! ! ! !! !! ! ! !! !! !! ! !! ! ! ! !!! ! !! ! !! ! !! ! ! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! !! ! ! !! ! ! ! ! ! ! ! !! ! !! ! ! !! ! ! ! ! ! !! !! ! !! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! !!!! ! ! ! ! ! ! ! !! !! ! !! ! ! ! ! ! !! ! !! !! ! ! ! ! !!! !! ! !! ! !! !! ! ! !!!!!! ! ! !! !!! ! !!! !! ! !! ! !! !! ! ! ! ! !! ! ! ! !! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !!! !!! ! ! ! ! !!!! ! !! ! ! ! !!! ! ! !! ! ! !! ! !! ! ! ! !! ! ! ! ! ! ! ! !! ! ! ! !!!! !!!!! ! !! !!! ! ! !! ! ! ! !!! !! ! !! ! ! ! ! !!! ! ! ! !! !!! ! ! ! !! ! !!! !!!! !! !! ! !! ! !! !! !! ! ! !! !!! ! !! ! !! ! ! !! !!! •  Sum/mean of ranks  ! ! ! ! ! !! ! ! ! ! !! ! !! ! ! !!! ! !! ! !!! ! !! ! ! ! ! ! ! ! !! ! !!! ! ! ! ! ! ! ! !!! ! ! ! !! ! ! ! ! !! ! ! !! !!! !! !! ! ! !!! ! !!!! !! ! !!!! !! ! ! !! ! ! !! !! !!!!! ! !! !! ! ! !! ! ! !! ! ! ! !!! ! ! ! ! ! ! !! !! ! ! !! !! !!! ! !! ! ! ! ! ! ! !! ! ! ! ! ! !! ! ! !! ! ! ! ! ! !! !! ! ! ! !! ! ! ! ! ! ! !! !! ! ! ! !! ! ! ! ! !! ! ! ! ! ! ! ! ! !! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! !! ! ! ! ! ! ! ! ! !!!! ! ! ! !! ! ! ! ! ! ! !! ! ! !!! !!! ! ! ! ! !!! !!! !!!!! ! ! ! !!!! !!! ! !!!!! !!! ! !!! !! !! ! ! ! ! ! ! ! !! !!! ! !! !! ! ! !!! ! ! !!! !! !! ! ! ! ! ! ! ! !! ! ! ! ! !!!! !! ! !! !!! !! !! !!!! !! ! ! !! !! ! ! ! ! ! !!! ! ! ! ! ! ! !!! ! ! !! ! !! ! ! ! ! ! ! ! ! !!!! ! !!! ! ! !! ! ! !!! ! ! !! ! ! ! ! !! ! ! ! ! ! ! ! ! ! !! !! ! ! ! ! ! ! ! !! ! !!! ! !! !! ! ! ! ! !! ! !!!!!!! ! ! ! ! !! ! ! ! !! ! !! ! ! !! ! ! !! ! !!! ! ! ! ! !! ! ! ! !! ! !! ! ! ! ! !! !! !!! ! !! !! ! ! !! ! !! ! ! !! ! ! !! !! ! ! !! ! ! ! ! ! !! ! ! ! ! ! ! ! !! !!! ! ! ! ! !! !! ! !! ! !! !! ! !! ! ! !! ! ! ! ! ! ! !! ! ! ! !! !! !!! ! ! !! !! ! !! ! ! ! ! ! ! !! ! ! !!! ! ! ! ! !! ! ! ! ! !!! ! ! ! ! ! ! ! ! !! ! ! ! !!! !!! ! ! !! !!! ! ! ! !!!! !! !! ! !! ! ! ! !! ! ! ! ! !! ! !! ! ! ! ! ! !! ! !! ! !! ! ! ! ! ! !! !! ! ! ! !!!! !! !! !! ! ! ! ! !! ! !! ! ! !! !! !!! !! ! ! ! !! ! !! ! ! !! ! !! ! ! ! ! !! !! !! ! !! ! ! ! ! ! !! !! !! ! ! ! ! !! !! !!! ! ! ! ! ! !! ! !! ! ! ! !! !!! ! ! ! ! !! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! !! ! ! ! ! ! !! ! ! ! ! ! !! ! !! ! ! ! !! 50 !! ! !!! !! ! ! ! ! ! ! ! ! !! ! !! ! ! ! ! !! ! ! !! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! !! !! ! ! ! ! ! ! ! ! ! ! !!! !! !! !! ! ! ! ! ! ! ! !! ! !! ! ! !! ! ! ! ! ! ! ! ! !! ! ! !!! !! !! !! ! !! !! ! !!! ! ! ! ! !!! !! !! !!! ! ! ! !! ! ! ! ! ! ! ! !! ! ! !! ! ! ! ! !!! !! ! ! ! ! ! ! !! ! ! ! ! !!! ! ! !! ! ! ! ! !! ! !! !! ! ! ! !! !! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! !! !!! !!!! !! !! ! !!!!! ! ! !! ! ! ! !! !! ! !!! ! !!! ! ! ! ! ! !! !! ! ! ! ! ! !! !! !! !! !!! ! ! ! ! !! ! ! ! ! ! ! ! !! !!! ! !! ! ! ! ! !! ! !! ! !! ! !!!!! ! ! ! ! !! ! ! !! ! !! !! ! ! !! ! ! !! ! ! ! ! ! !! ! ! ! !! ! ! ! ! ! ! ! !! ! ! !! !! ! !! ! ! ! ! ! !! ! ! !! ! ! ! ! ! ! ! ! ! !! !! !!! ! !! ! ! !! ! !! ! ! ! ! ! ! ! !! ! ! !!!! ! ! !! !! ! ! !!!! !! !! ! ! !! ! !! ! ! ! ! !! ! !! ! ! !! ! ! ! ! ! !!! !!! ! ! ! ! ! ! !!! ! !!!! ! ! !!! ! !! ! ! ! !! ! ! ! !! ! ! !! ! ! ! ! ! ! ! !! ! ! ! ! ! !! ! ! ! ! !! ! ! ! !! !! ! ! ! ! ! ! ! !! ! !! ! ! ! ! ! !! !! ! ! ! ! !! ! !! ! ! ! ! ! ! !! ! ! ! ! ! ! !! ! !! !! ! ! ! ! !! ! ! ! !! !! ! ! ! ! ! ! ! !! !!! ! ! ! ! !! ! ! !! ! !! ! ! ! !! ! ! ! ! ! ! ! ! ! ! !! !! ! ! ! !! !! !! ! ! !! ! ! ! ! ! !! ! !! ! ! ! ! ! !! ! ! !! ! ! ! !! ! ! ! !!!!! ! ! ! ! ! !! ! ! ! ! !!! ! ! ! !! ! ! !! ! ! ! !! ! ! ! !! !! ! ! !! ! ! ! ! ! !! ! ! ! ! ! ! !!! ! !! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! !! !! ! ! !! !! ! ! ! ! !! ! !!! ! ! ! ! ! ! ! !! ! !! ! ! ! !! !! !! !! ! !!! ! ! ! ! ! ! ! ! ! ! !! !!! ! ! ! ! ! ! ! ! ! !!! !! ! ! ! !! ! ! ! !! ! !! ! ! ! ! ! !! ! !!!! ! ! ! ! ! !! ! ! ! ! !! !!! !! ! !! ! !! ! !!! ! ! !! ! ! ! !! !! !! ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! ! ! ! ! !! ! ! ! ! ! ! ! ! ! ! ! ! !! ! ! !! ! ! ! ! !! ! ! ! !! ! !! ! ! ! ! ! ! ! ! 0 Plate Number •  In all cases, some degree of abitrariness  •  In many cases, poor concordance between  selec:on methods  •  Gives us a selec:on of siRNA’s  •  Iden:fy genes based on number of siRNA’s 
  • 10. Hit Triage Methods   •  Given that we end up with a rela:vely small  number of hit genes, we need to expand it  •  Triage iden:fies other “relevant” or  “borderline” genes to be included for follow‐up  •  Methods  –  Protein‐protein interac:on data  –  Pathway membership data  –  GO terms  –  Network sta:s:cs 
  • 11. CPT Sensi6za6on  TOP1 poisons prevent DNA religation resulting in replication-dependent double strand breaks. Cell activates DNA damage response (e.g. ATR). Pommier, Y., Nat. Rev. Cancer, 2006.
  • 12. Screening Protocol Screen conducted in the human breast cancer cell line MDA-MB-231. Many variables to optimize including transfection conditions, cell seeding density, assay conditions, and the selection of positive and negative controls.
  • 13. Hit Selection Follow-Up Dose Response Analysis ATR Screen #1 siNeg siATR-A Viability (%) siATR-B siATR-C Sensitization Ranked by Log2 Fold Change CPT (Log M) Screen #2 MAP3K7IP2 siNeg siMAP3K7IP2-A Viability (%) siMAP3K7IP2-B siMAP3K7IP2-C siMAP3K7IP2-D Sensitization Ranked by Log2 Fold Change CPT (Log M) Multiple active siRNAs for ATR, MAP3K7IP2, and BCL2L1.
  • 14. Triage  with PPIs   •  For each gene in the hit list iden:fy interac:on  partners  –  Currently using HPRD  –  Will be switching to MIMI  •  This added MAP3K7 to the hit                              list, which   MAP3K7                              reconfirmed nicely  siNeg Viability (%) siMAP3K7-A siMAP3K7-B siMAP3K7-C •                                               siMAP3K7-D CPT (Log M) http://www.eecs.umich.edu/db/mimi/
  • 15. Looking in Pathways   •  Using the ini:al hit list based on differen:al  analysis we get a list of relevant pathways 
  • 16. Looking in Pathways   •  We then iden:fy genes from these pathways  that were not ini:ally selected  •  3 genes from the IL‐10 signalling pathway  were each knocked down by a single siRNA  –  CD14  –  PIK3CD  –  PIK3R3  •  Similarly, we add in  genes from other  pathways 
  • 17. Looking in Pathways   •  The reconfirma:on rate of pathway‐derived  hit list members was low (< 10%)  •  Not too surprising   •  PPI‐derived hit list members worked beger 
  • 18. Are These Genes Relevant?  •  Some are well known to be CPT‐sensi:zers  •  Consider a HPRD PPI sub‐network  corresponding to the Qiagen HDG gene set  •  How “central” are these selected genes?  –  Larger values of betweenness  3.0 indicate that the node lies on  2.5 many shortest paths  2.0 log Frequency –  Makes sense ‐ a number of   1.5 them are stress‐related  1.0 –  But some of them have very low  0.5 betweenness values  0.0 0 2 4 6 log Betweenness
  • 19. Are These Genes Relevant?  •  Most selected genes  are densely connected  ACTC1 ! TFPI ! MMP7 ! BAG1 ! ANXA1 ! HAPLN1 ! BCLAF1 BNIP3 ! ! ACTB! THBS2 PLG ! BCL2L14 ! RAD9A ! TEGT BNIP3L ! ! PPHLN1 ! KPNA4! IRS2 ! MMP10 KPNA3 ! PMAIP1 ! ! ! CD44 ! FKBP8 BIK ! BAK1 ! MAP3K12 THBS1 ! ! ! KISS1 ! BCL2L10 VDAC1 ! ! GSTP1 ! HIST2H2BE ! PRSS2 ! IKZF3 ! COL1A1 HRK ! MOAP1 ! ALDOA ! ! BAX ! COL1A2 ! PPP1CA ! BCL2 RTN4 ! ! TUBB ! COL4A5 ANTXR1 BAD •  A few are not  LCN2 ! ITGB1 ! ! BCL2L11 BNIP1 ! ! CXCL5 ! ITGB3 ! IL8 BCL2L1 ! ! ! ! MMP9 ! TGM2 BMF ! BECN1 ! PLCD1 ! ! TWF1 ! FN1 ! BCL2L12! HD ! COL4A4 MAPK8 ! FN1 ! BCAP31 ! ! TIMP3 ! ! ! PSEN1 ! PZP ! CRYAB ! IRS1 ! CYCS ! CASP8 ! CASP3 ! LTBP1! COL4A3 ! SNCA TP53 ! ! COL4A6 ! SPARC ! COL4A1 ! NLRP1 CASP1 ! ! RHOA ! COL4A2 ! CXCL1 ! RB1 SERPINF2 SIVA1 ! ! ! CASP9 ! CFLAR ! RECK ! PSEN2 TMSB4X ! AVEN ! ! –  Generally did not  AREG ! CAPN1 ! EIF5A! BMPR2 ! BTC ! MMP26 ! CRYAA ! HIST1H2BG S100A7 ! ! PRNP ! DMAP1 ! NEK6 ! NR2E3 ! STK11 ! EP300 ! L1CAM ! FGFR1 ! VPS37B ! PPP1R9A reconfirm  ! DAXX ! DNMT1 ! TP53 ! RPS6 ! CDC2 ! NCAN ! PPP1R9B HCK ! ! CREBBP ! BDNF ! AR ! MDM2 ! PDC ! PDCD6IP ! COASY ! EP300 ! POLDIP3 ! MAPK1 ! ST8SIA3 ! TRAF4 ! NCAM1 ! VPS28 ! RPS6KB1 ! CRX ! TSG101 ! GDNF ! PPP2CA ! •  Network metrics   GGA3 ! VPS37D ! NCBP1 ! UBA52 ! EIF4EBP1 ! RAXL1 ! SPTB CDC42 IPO13! ! GFRA1! AATF ! ! AKT1 ! LRSAM1 ! EEF2K! CDKN1A ! HGS ! RAC1 ! PDPK1 ! FRAP1 ! ST8SIA4 ! FYN ! ST8SIA2 ! VPS37A ! VPS37C ! GGA1 ! TERT ! NRL ! BANF1 ! could be used to   FLT1 ! KDR ! RAD17 ! EEF1E1 ! CBLB LAT SHB SH3BP2 VAV1 TUBB PRLR SIT1 TUBA4A ! ! ! ! ! ! ! GNA12 ! RHOA ! GNAQ ! PPARA ! GP1BA ! provide confidence  ! ! SLA PLCG1 CRK ! ! ESR2 ! RHEB ! ! CHEK1 ! ABL1 SOS1 ! ! FCRL3 ! CLSPN PAG1 GRB2 ! PRKAR2A ! ! ! LAX1 ! LCP2 FYN MUC1 ! ! ! GAB2 CBLSHC1 PTK2B ! ! ! ESR1 ! CHD4 ! NFAM1 ! AKAP13 ! ATR ! RASA1 LCK ZAP70 ! ! TP53 ! ! ! SH2B3 ! ACP1 ! CD247 PTPN6 ! CARD11 GP9 ! YWHAB ! ! ! BRCA1 ! PTPRC ! THRA ! in selec:ons  XPA ! SLA2 ! CD5 ! CD3E ! CD79B ! DUSP3 ! MSH2! E2F1 ! FCGR3A ! YWHAG ! YWHAE YWHAZ RXRB ! CHEK2 ! IFNAR1 ! DBNL ! ! ! TREX1 ! DEF6 NBN ! ! PTPN3 ! SLAMF6 ! TYROBP ! XRCC5 ! WIPF1 ! CTNNAL1 ! GP1BB ! RBL2 ! HGS ! LEF1 ! MC3R ! SNTB2 ! RASGRP1 ! HIPK2 ! SMAD3 ! SMAD7 ! FOS ! SMAD6 ! MAPK14 ! SNTB1 ! HRAS ! PPM1L MAP3K7IP1 MAPK8 MAP2K4 ! ! MAP2K6 ! ! ! MC4R ! ! ! IRAK1 ! IL17RD! BIRC4 ! RELA ! RBL1 ! SRC ! PELI3 ! DGKZ ! MAP3K7 ! STAT3 IKBKAP ! ! AGRP ! BIRC1 ! TRAF6 ! SNTG1 ! TNFRSF11A ! MAP3K14 ! PLCG1 ! IKBKB ! PRKCA ! MAP4K4 ! CHUK ! GHRL ! ALS2CR2 MAP3K3 ! ALX4 ! PPM1B ! ! TRAF3IP2 ! DMD ! MAP4K1 ! EIF2AK2 PEBP1 ! ! MAP3K5 ! SNTA1 ! NRIP1 ! BCL10 ! LEPR ! RB1 ! CARD11 ! CART1 ! MC5R !
  • 20. Literature Novelty  •  For selected genes, we evaluate to what  extent it has been discussed in the literature  •  Makes use of pre‐processed NCBI PubMed  annota:ons on gene  iden:fiers  •  Lower scores indicate  novelty (or lack of   interest!)  •  Priori:za:on method 
  • 21. RNAi & Small Molecule Screens  What targets mediate activity of siRNA and compound Pathway elucidation, •  Reuse pre-existing MLI data identification of interactions •  Develop new annotated libraries CAGCATGAGTACTACAGGCCA  TACGGGAACTACCATAATTTA  Target ID and validation Link RNAi generated pathway peturbations to small molecule activities. Could provide insight into polypharmacology •  Run parallel RNAi screen Goal: Develop systems level view of small molecule activity
  • 22. HTS for NF‐κB Antagonists   •  NF‐κB controls DNA  transcrip:on   •  Involved in cellular  responses to  s:muli  –  Immune response,  memory forma:on  –  Inflamma:on,  cancer, auto‐ immune diseases  hgp://www.genego.com 
  • 23. HTS for NF‐κB Antagonists   •  ME‐180 cell line  •  S:mulate cells using TNF, leading to NF‐κB  ac:va:on, readout via a β‐lactamase reporter  •  Iden:fy small molecules and siRNA’s that  block the resultant ac:va:on 
  • 24. Small Molecule HTS Summary  Most Potent Actives •  2,899 FDA‐approved  ! ! ! ! Proscillaridin A 0 compounds screened  ! ! !20 Activity ! !40 ! •  55 compounds retested ac:ve  ! ! ! ! ! ! !60 ! !9 !8 !7 !6 !5 log Concentration (uM) Trabectidin •  Which components of the NF‐ ! ! 0 ! ! ! !20 ! Activity κB pathway do they hit?  !60 ! !100 ! ! ! ! ! ! ! ! –  17 molecules have target/ !9 !8 !7 !6 !5 log Concentration (uM) ! ! ! Digoxin 0 ! pathway informa:on in GeneGO  ! ! !20 Activity –  Literature searches list a few  !40 ! ! ! ! ! ! !60 ! ! ! more  !9 !8 !7 !6 !5 log Concentration (uM) Miller, S.C. et al, Biochem. Pharmacol., 2010, ASAP 
  • 25. RNAi HTS Summary  •  Qiagen HDG library – 6886 genes, 4 siRNA’s  per gene  •  A total of 567 genes were knocked  down by 1 or more siRNA’s  –  We consider >= 2 as a “reliable” hit  –  16 reliable hits  –  Added in 66 genes for   follow up via triage procedure 
  • 26. The Obvious Conclusion  •  The ac:ve compounds target the one or more  of the 16 hits (at least) from the RNAi screen  –  Useful if the RNAi screen was small & focused  •  But what if we’re inves:ga:ng a larger system?  –  Is there a way to get more specific?  –  Can compound data suggest RNAi non‐hits?  –  Can RNAi hits suggest compound targets? 
  • 27. Small Molecule Targets   Bortezomib (proteosome inhibitor) ! 0 ! ! ! ! ! !20 ! ! !40 Activity ! !60 ! ! ! !80 ! ! ! !100 !9 !8 !7 !6 !5 log Concentration (uM) •  Some small molecules  interact with core  components  ! ! 0 ! ! ! ! ! ! ! ! ! ! !20 ! !40 Activity !60 !80 ! ! !120 !9 !8 !7 !6 !5 Daunorubicin (IκBα inhibitor) log Concentration (uM)
  • 28. Small Molecule Targets   ! Montelukast (LDT4 antagonist) 0 ! ! ! ! ! ! ! ! ! ! ! !20 ! !40 Activity ! !60 !80 ! !100 !9 !8 !7 !6 !5 log Concentration (uM) •  Others are ac:ve  against upstream  targets  •  We also get an idea  of off ‐target effects 
  • 29. Compound Networks ‐ Similarity  •  Evaluate fingerprint‐based similarity matrix for  the 55 ac:ves  •  Connect pairs that   exhibit Tc> 0.7   •  Edges are weighted  by the Tc value   •  Most groupings are  obvious 
  • 30. Compound Networks ‐ Targets   •  Predict targets for the ac:ves using SEA  •  Target based compound network maps nearly  iden:cally to the   similarity based network   •  But depending on the   predicted target quality  we get poor (or no)   mappings to the   RNAi targeted genes  Keiser, M.J. et al, Nat. Biotech., 2007, 25, 197‐206 
  • 31. (Reduced) Gene Networks – Pathways   •  Nodes are 526 genes  with >= 1 siRNA  showing knockdown   •  Edge indicates two  genes/proteins are  involved in the same  pathway 
  • 32. Pathway Based Integra6on  •  Direct matching of targets is not very useful  •  Try and map compounds to siRNA targets if  the compounds’ predicted target(s) and siRNA  targets are in the same pathway  –  Considering 16 reliable hits, we cover 26 pathways  –  Predicted compound targets cover 131 pathways  •  For 18 out of 41 compounds  –  3 RNAi‐derived pathways not covered by  compound‐derived pathways   •  Rhodopsin, alterna:ve NFkB, FAS 
  • 33. The Use of GeneGO  •  Excellent resource!  •  The web interface is nice for simple/few  queries, visualiza:on  •  Programma:c access could be improved  –  REST interface  –  Access to algorithms, datasets via REST interface 
  • 34. Conclusions   •  Hit triage is a necessary step in our screening pipeline  •  Have mul:ple methods and data sources to consider.  •  Building up a wealth of small molecule and RNAi data  •  Challenges involve integra:ng RNAi data with other  sources  •  Primary bogleneck is dimensionality of the data  –  Simple flourescence‐based approaches do not provide  sufficient resolu:on  –  High‐content is required 
  • 35. Acknowledgements   •  Scog Mar:n  •  Pinar Tuzmen