Data driven life sciences  
The Pyramids meet the Tower of Babel 
                           Rajarshi Guha 
            NI...
Characteris9cs 

•  Large sizes (but this is rela;ve) 
   –  Chemistry datasets are not really that big 
•  Mul;‐dimension...
How Useful is More Data? 

      •  Alterna;vely, can we stop doing science and 
         just do paMern recogni;on on inc...
How Useful is More Data? 

•  The u;lity of more data is obvious in many 
   scenarios 
  –  Sta;s;cal models on 10 observ...
Big Data for Some Problems 

       •  Halevy et al discuss the effec;veness of 
          extremely large datasets 
      ...
Google Scale in Chemistry? 

       •  What would be the equivalent of an n‐gram 
          corpus in chemistry? 
        ...
Fragment Diversity 

•  Consider a set of bioac;ves such as the LOPAC 
   collec;on, 1280 compounds 
•  Using exhaus;ve  
...
Fragment Diversity 
       6                            All fragments             4
                                      ...
What Do We Do with Fragments? 

  •  Assuming we obtain fragments from a large 
     enough collec;on what do we do? 
    ...
Scaffold Ac9vity Diagrams 

•  Network oriented view of fragment (scaffold) 
   collec;ons 
  –  Similar in idea to 
     Sc...
What Makes a Good Scaffold? 
•  What makes a good 
   scaffold? 
  –  Size, complexity, … 
  –  Do the members 
     represe...
Scaffold QSAR 
                                                            Fit PLS or ridge 
                              ...
Scaffold QSAR ‐ Drawbacks 

•  Many scaffolds have few (5 to 10) members 
•  Invariably, more features than observa;ons 
•  ...
Fragments for Automa9on 
•  What is the mo;va;on for scaffold QSAR? 
•  Automate a high throughput screen 
•  Try and devel...
Big Data and Chemistry  

       •  But in the end, the fundamental problem with 
          big data is the issue of domai...
Processing Large Datasets 

•  Most cheminforma;cs tasks are not 
   algorithmically parallel 
•  Rather, they are applied...
Common HTS Analysis Tasks 
•  Analysis of Ac;vity 
  –    Concentra;on response across mul;ple phenotypes, mul;ple assays ...
A Smorgasbord of Data 
Data Integra9on 

•  It’s nice to simplify data, but we can s;ll be faced 
   with a mul;tude of data types 
•  We want to...
Data Integra9on 
User’s Network 
                           Content: 
                               ‐ Drugs 
            ...
Record View of an Assay 
Access Disease Hierarchy & Network 
Ar9cles, Patents, Drug Labels, … 
Going Beyond Explora9on? 

       •  Simply being able to explore data in an 
          integrated manner is useful  as an...
RNAi & Compound Screens 


                                                                    What targets mediate ac;vit...
Small Molecule HTS Summary 

         •  2,899 FDA‐approved                                                 !
            ...
RNAi HTS Summary 

•  Qiagen HDG library – 6886 genes, 4 siRNA’s 
   per gene 
•  A total of 567 genes were knocked 
   do...
RNAi & Small Molecule 

•  Based on reporter assays, the only conclusions 
   one can draw are the obvious ones 
•  Limite...
Summary 

•  Mul;ple data types are probably the most 
   challenging aspect of data driven discovery 
•  Size issues can ...
Acknowledgements 

•    Ruili Huang 
•    Ajit Jadhav 
•    Trung Ngyuen 
•    Noel Southall 
Job Openings at NCGC/NCTT 

•  Sowware development (focusing on Tripod) 
     –  Java, Swing UI, algorithms 
•  Research I...
Upcoming SlideShare
Loading in...5
×

Data driven life sciences   The Pyramids meet the Tower of Babel 

1,703

Published on

Published in: Technology
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
1,703
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
16
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide

Data driven life sciences   The Pyramids meet the Tower of Babel 

  1. 1. Data driven life sciences   The Pyramids meet the Tower of Babel  Rajarshi Guha  NIH Chemical Genomics Center  2010 ACS Na;onal Mee;ng, Boston, MA 
  2. 2. Characteris9cs  •  Large sizes (but this is rela;ve)  –  Chemistry datasets are not really that big  •  Mul;‐dimensional  •  Mul;ple sources (and hence, types)  •  Challenges  –  Handling and processing large datasets  –  Integra;ng mul;ple data types / sources  –  Get a coherent story out of it all 
  3. 3. How Useful is More Data?  •  Alterna;vely, can we stop doing science and  just do paMern recogni;on on increasingly  large datasets?  •  According to Chris Anderson, yes.  There is now a better way. Petabytes allow us to say: "Correlation is enough." We can stop looking for models. We can analyze the data without hypotheses about what it might show. We can throw the numbers into the biggest computing clusters the world has ever seen and let statistical algorithms find patterns where science cannot. hMp://www.wired.com/science/discoveries/magazine/16‐07/pb_theory 
  4. 4. How Useful is More Data?  •  The u;lity of more data is obvious in many  scenarios  –  Sta;s;cal models on 10 observa;ons is not a good  idea  •  But can there be such a thing as too much  data?  –  Sta;s;cal models on 106 observa;ons may not be  a good idea 
  5. 5. Big Data for Some Problems  •  Halevy et al discuss the effec;veness of  extremely large datasets  •  Their applica;on focuses on machine  transla;on – see the Google n‐gram corpus  •  They suggest that such extremely large datasets  are useful because they effec;vely encompass  all n‐grams (phrases) commonly used  •  Domain is rela;vely constrained  Halevy et al, IEEE Intelligent Systems, 2009, 24, 8‐12 
  6. 6. Google Scale in Chemistry?  •  What would be the equivalent of an n‐gram  corpus in chemistry?  –  Fragments  –  A more direct analogy can be made by using LINGO’s  •  It is possible to generate arbitrarily large (virtual)  compound and  fragment collec;ons  •  But would such a collec;on span all of  “commonly used” chemistry?  –  Depending on the ini;al compound set, yes  –  But we’re also interested in going beyond such a  “commonly used” set  Fink T, Reymond JL, J Chem Inf Model, 2007, 47, 342 
  7. 7. Fragment Diversity  •  Consider a set of bioac;ves such as the LOPAC  collec;on, 1280 compounds  •  Using exhaus;ve   fragmenta;on we get   40 2,460 unique fragments  Percent of Total 30 •  On the MLSMR   (~ 400K compounds),   20 we get  164,583   10 fragments  0 0 1 2 3 4 log Fragment Frequency
  8. 8. Fragment Diversity  6 All fragments  4 Fragments occurring in   5 to 50 molecules  4 2 2 PC 2 0 PC 2 0 -2 -2 -4 -4 -4 -2 0 2 -4 -2 0 2 4 PC 1 PC 1 •  Distribu;on of MLSMR fragments in BCUT  space 
  9. 9. What Do We Do with Fragments?  •  Assuming we obtain fragments from a large  enough collec;on what do we do?  –  Learning from fragments – QSARs, genera;ve  models  –  Use fragments as   filters, alterna;ve   to clustering  –  Explore chemotypes  and ac;vity  White, D and Wilson, RC, J Chem Inf Model, 2010, ASAP 
  10. 10. Scaffold Ac9vity Diagrams  •  Network oriented view of fragment (scaffold)  collec;ons  –  Similar in idea to  Scaffold Hunter etc  –  Not purely hierarchical  •  Color by arbitrary   proper;es  •  Quickly assess u;lity  of a scaffold  •  Try it online  
  11. 11. What Makes a Good Scaffold?  •  What makes a good  scaffold?  –  Size, complexity, …  –  Do the members  represent an SAR or not?  –  Intui;on and experience  also play a role 
  12. 12. Scaffold QSAR  Fit PLS or ridge  regression model  0 ! ! !! ! !2 ! ! ! ! Predicted ! !4 ! ! !! ! Evaluate topological   ! ! and physicochemical   ! !6 descriptors for the   ! ! R‐groups  !8 Characterize the   !8 !6 !4 !2 0 Observed SAR landscape 
  13. 13. Scaffold QSAR ‐ Drawbacks  •  Many scaffolds have few (5 to 10) members  •  Invariably, more features than observa;ons  •  If the number of R‐groups is large, the feature  matrix can be very sparse  –  Less of a problem for combinatorial libraries  •  A linear fit may not be the best approach to  correla;ng R‐groups to the ac;vi;es  –  Difficult to choose a model type a priori  •  S;ll working on it … 
  14. 14. Fragments for Automa9on  •  What is the mo;va;on for scaffold QSAR?  •  Automate a high throughput screen  •  Try and develop heuris;cs  to automa;cally push   chemotypes into secondary   screening 
  15. 15. Big Data and Chemistry   •  But in the end, the fundamental problem with  big data is the issue of domain applicability  •  Tradi;onal models are developed on small  datasets and perform well within the training  domain  •  But models trained on very large datasets will  not necessarily perform well, even though the  training domain is now much larger  Helgee et al, J Chem Inf Model, 2010, 50, 677‐689 
  16. 16. Processing Large Datasets  •  Most cheminforma;cs tasks are not  algorithmically parallel  •  Rather, they are applied to large numbers of  inputs and hence embarrassingly parallel  –  Start up lots of jobs  •  Hadoop is useful technology for those problems  that follow the map/reduce paradigm  –  Not aware of cheminforma;cs methods that work in  this manner  –  But can also be used like a job submission system 
  17. 17. Common HTS Analysis Tasks  •  Analysis of Ac;vity  –  Concentra;on response across mul;ple phenotypes, mul;ple assays  –  Assay interference (differen;a;ng ac;vity from ar;facts)  –  Assay ontology (biological rela;onships, assay plaqorms)  –  Compound annota;ons, known ligand‐target network, prior art assessment  –  Profile data (PubChem, BindingDB, ChEMBL, PDSP, etc, physical proper;es)  •  Iden;fica;on of Series and Singletons  –  Clustering of ac;ves, iden;fica;on of top scaffolds  –  Profiling of series across all assays  –  Series and singleton priori;za;on  •  Compound Selec;on for Followup  –  Assessment of structure ac;vity rela;onships   –  Rapid iden;fica;on of key compounds to confirm, new compounds to test  –  Mining of commercially available chemical libraries  How do we beMer automate such tasks? 
  18. 18. A Smorgasbord of Data 
  19. 19. Data Integra9on  •  It’s nice to simplify data, but we can s;ll be faced  with a mul;tude of data types  •  We want to explore these data in a linked fashion  •  How we explore and what we explore is generally  influenced by the task at hand  •  At one point, make inferences over all the data 
  20. 20. Data Integra9on  User’s Network  Content:  ‐ Drugs  ‐ Compounds  ‐ Scaffolds  ‐ Assays  ‐ Genes  ‐ Targets  ‐ Pathways  ‐ Diseases  ‐ Clinical Trials  ‐ Documents  Links:  Network of Public Data  ‐Manually curated  ‐Derived from algorithms 
  21. 21. Record View of an Assay 
  22. 22. Access Disease Hierarchy & Network 
  23. 23. Ar9cles, Patents, Drug Labels, … 
  24. 24. Going Beyond Explora9on?  •  Simply being able to explore data in an  integrated manner is useful  as an idea  generator  •  Can we integrate heterogenous data types &  sources to get a systems level view?  –  Current research problem in genomics and  systems biology  –  Some aMempts have been made to merge  chemical data with other data types  Young, D.W. et al, Nat. Chem. Biol., 2008, 4, 59‐68 
  25. 25. RNAi & Compound Screens  What targets mediate ac;vity of  siRNA  and compound  Pathway elucida;on, iden;fica;on  •  Reuse pre‐exis;ng MLI data  of interac;ons  •  Develop new annotated libraries  CAGCATGAGTACTACAGGCCA  TACGGGAACTACCATAATTTA  Target ID and valida;on  Link RNAi generated pathway  peturba;ons to small molecule  ac;vi;es. Could provide insight into  polypharmacology  •  Run parallel RNAi screen  Goal: Develop systems level view of small molecule acDvity 
  26. 26. Small Molecule HTS Summary  •  2,899 FDA‐approved  ! Most Potent AcDves  ! ! ! Proscillaridin A  compounds screened  0 ! ! !20 Activity •  55 compounds retested ac;ve  ! !40 ! ! ! ! ! ! ! !60 ! !9 !8 !7 !6 !5 •  Which components of the NF‐ log Concentration (uM) ! ! Trabec;din  0 ! ! ! !20 κB pathway do they hit?  ! Activity !60 ! –  17 molecules have target/ !100 ! ! ! ! ! ! ! ! !9 !8 !7 !6 !5 pathway informa;on in GeneGO  log Concentration (uM) ! ! ! Digoxin  0 ! ! –  Literature searches list a few  ! !20 Activity more  !40 ! ! ! ! ! ! !60 ! ! ! !9 !8 !7 !6 !5 log Concentration (uM) Miller, S.C. et al, Biochem. Pharmacol., 2010, ASAP 
  27. 27. RNAi HTS Summary  •  Qiagen HDG library – 6886 genes, 4 siRNA’s  per gene  •  A total of 567 genes were knocked  down by 1 or more siRNA’s  –  We consider >= 2 as a “reliable” hit  –  16 reliable hits  –  Added in 66 genes for   follow up via triage procedure 
  28. 28. RNAi & Small Molecule  •  Based on reporter assays, the only conclusions  one can draw are the obvious ones  •  Limited by 1‐D signal  •  Going to high content gives us much richer  data, but more complexity  –  Shown to be useful for compounds  –  Much more difficult when the phenotypic  parameters come from different systems 
  29. 29. Summary  •  Mul;ple data types are probably the most  challenging aspect of data driven discovery  •  Size issues can be addressed with more  hardware or wai;ng (a bit) longer  •  Integra;on issues require new approaches  both at the presenta;on & algorithmic levels 
  30. 30. Acknowledgements  •  Ruili Huang  •  Ajit Jadhav  •  Trung Ngyuen  •  Noel Southall 
  31. 31. Job Openings at NCGC/NCTT  •  Sowware development (focusing on Tripod)  –  Java, Swing UI, algorithms  •  Research Informa;cs Scien;st    –  Generalist, cheminforma;cs, comp chem, med  chem  •  Collaborate with chemists, biologists  •  Cuxng edge problems  •  Lots of fresh data  •  Fun! 
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×