Glioblastoma

666 views
522 views

Published on

Published in: Health & Medicine, Technology
0 Comments
2 Likes
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total views
666
On SlideShare
0
From Embeds
0
Number of Embeds
3
Actions
Shares
0
Downloads
39
Comments
0
Likes
2
Embeds 0
No embeds

No notes for slide

Glioblastoma

  1. 1. Glioblastoma
  2. 2. Its an abnormal Growth tissue in the brain  non – cancerous Primary : originate in the brain itself  cancerous ( Malignant ) Metastatic or Secondary : come from another part of the body ( e.g. lung or breast etc )
  3. 3. • A normal brain cell ( Glial Cell : which are supportive cells that surround) becomes malignant and is called a Glioma . • Gliomas , are subdivided in : Glioblastoma ( GBM ) Ependymoma Astrocytoma Oligodendroglioma
  4. 4.  myelin producing cells of the CNS  one oligodendroglial cell can myelinate more than one axon
  5. 5.  These cells line ventricles of brain and spinal canal  They have Cilia on their luminal surface  Pathological changes to the ependyma include infections and tumor formation
  6. 6.  "star-shaped" glial cells that are the majority cell type in the CNS  involved in metabolic exchange between neurons and blood  support and improving conduction in neurons  uptake and/or breakdown of some neurotransmitters and formation of the blood-brain-barrier
  7. 7. ¾ of all gliomas  More than  For astrocytomas, there are 4 general grades : 1 - 2 : Low Grade & Pilocytic Astrocytoma more commonly in children and its Benign They also have a more favorable prognosis The most common symptoms are Headache, Nausea etc
  8. 8. 3 : Anaplastic Astrocytoma ( AA ) AA is a malignant type and more commonly in Adult Symptoms may include , speech problems , headaches , visual loss etc (MRI) is the preferred imaging technique for diagnosis
  9. 9. 4 : Glioblastoma Multiform(GBM) Harvey Cushing and Percival Bailey coined the term in 1926 Scherer first classified GBMs into primary and secondary tumors in 1940 Ted Kennedy  at age 77  Seizure  Parietal lobe  He survived 14 months after he was diagnosed
  10. 10. Primary Secondary De novo
  11. 11. In The USA GBM is 2.5 times higher in European Americans Than in African Americans and 60% higher in Men than in Women . 2nd most common cause of death due to intracranial disease after stroke . 10% of children brain tumors More prevalent in developed countries and caucasian  Incidence is approximately 5-8 new cases per 100,000 people per year Annual Incidence 24,000 Annual deaths 14,000
  12. 12. 10 Year 5 Year
  13. 13. Geographic Variation I
  14. 14. Geographic Variation II
  15. 15. Chromosomal Abnormality Loss 13q and 10q gain 1p, 2q, 3q and 17q Loss = left Gain = right
  16. 16. Results of LOH 10q assay for individual cases with the four microsatellite markers. (B - Blood DNA, T - Tumor DNA, LOH - Loss of heterozygosity, NLOH - No loss of heterozygosity, NI Noninformative)
  17. 17. Pathway Alterations in GBM
  18. 18. receive signals from growth factors activation of the RAS and PI3K pathways cell proliferation, survival, and migration
  19. 19. 1. mutation or deletion of p53 2.overexpression of p53 inhibitors (MDM2 and MDM4) 3. indirectly, deletion of CDKN2A, an MDM2 inhibitor
  20. 20. 1 . direct mutation of gene Rb1 2 . overexpression of cyclin-dependent kinase 4 (CDK4) 3 . deletion of CDKN2A
  21. 21. Micro RNA Alteration in GMB Targets miR-21 up RECKd-TIMP3d APAF1-Caspases PTEN HNRPK-TAp63, LRRFIP1- PDCD4 miR-124 down CDK6 miR-137 down CDK6 miR-128 down WEE1- p70S6K1 Msi1- E2F3a- Bmi-1, EGFR- PDGFRAd miR-7 down EGFR
  22. 22.  the most extensively investigated miRNA is Mir 21  Transfection with antisense-miR-21 has been shown to significantly increase GBM cell line sensitivity to both radio- and chemotherapy .
  23. 23.  It is capable of suppressing tumor growth  miR-128 is a good candidate for repressing GBM growth and invasion
  24. 24. Interaction of SOX6 in GBM  TF expressed in CNS  More prevalent in GBM than in normal brain tissue  Come from a family of proteins called the SOX gene family  SOX6 is an glioblastoma-associated antigen; it helps distinguish a glioblastoma from normal cells  This suggests that SOX6 is more involved in the genesis of GBM than in their proliferation * SOX gene family encodes proteins that bind to a groove in the DNA and cause local bends and changes
  25. 25. 4 1. Pathogenic Chr 10 , 7 2 . Non-Pathogenic 3 . Other (http:// www.ncbi.nlm.nih.gov ) Chr 3 Chr 17 rs121909218 [Homo sapiens] AGCAATTCACTGTAAAGCTGGAAAGG[A/G]ACGAACTGGTGTAATGATATGTGCA rs3856806 [Homo sapiens] GACCTCAGACAGATTGTCACGGAACA[C/T]GTGCAGCTACTGCAGGTGATCAAGA
  26. 26.  TMZ alkylates/methylate the O6-position in guanine replication  MGMT(O6-methylguanine-DNA methyltransferase) remove alkyl groups Expressing in GBM cell line  Methylated MGMT = making TMZ more efficient cell
  27. 27. memory loss speech difficulty changes in sight , sound or smell headaches
  28. 28. MRI (CT) scan Positron emission tomography (PET) Needle biopsy •* Needle inserted through a burr hole and tissue extracted for tissue diagnosis
  29. 29. It is very difficult to treat GBM due to several complicating factors :  Resistant to conventional therapies  Limited capacity of brain to repair itself  Blood-brain barrier  Surgery : the first stage of treatment Complete removal is impossible - a reduction of 98% GBM tumor cells (it is located near the parts of the brain that control important functions such as language ) near-complete removal of a tumor 5-aminolevulinic acid (5-ALA) Fluorescent dye red/pink fluorescence under a blue light from an operating microscope distinguish glioblastoma from normal tissue
  30. 30.  Radiation therapy In addition to surgery Prolong survival ( 7 – 12 Months ) 1.Conventional fractionated external beam radiation “standard” • 5 days a week for 5 or 6 weeks • aimed at the tumor site and the area around the tumor 2 . Photodynamic therapy ( PDT ) uses a sensitizing drug and laser light to destroy tumor cells Monoclonal antibodies or Nanocarrier
  31. 31. 1. Temozolomide (TMZ) : oral alkylating agent With radiation overall survival (12.1 - 14.6 months) induces DNA methylation of guanine O6 position O6-MG incorrectly pairs with thymine and triggers the mismatch repair (MMR) system leading to double strand break arrest of cell cycle and induction of apoptosis 2. Carmustine and cis -platinum (cisplatin) primary chemotherapeutic for malignant gliomas. 3. Nitrosoureas
  32. 32. Novel Biologic therapies  Dendritic cell vaccination
  33. 33. Using a attenuated virus (such as the Adeno virus) genetically engineered to produce a human antigen .
  34. 34. Conclusions  GMB is the highest glioma (grade4) tumor  Specific symptoms depend on the size and location of GBM  GBM occurs at any age but is most common after 50 years  Genetic alteration can be seen in GBM  Diagnosis (MRI,CT scan and…)  Treatment( surgery, radiotherapy and chemotherapy )

×