Revista Elite Nariño - Edición Julio 2013

  • 1,283 views
Uploaded on

Es un gusto presentar nuestra revista ELITE NARIÑO a quienes podemos distinguir por su gran visión Institucional y empresarial. …

Es un gusto presentar nuestra revista ELITE NARIÑO a quienes podemos distinguir por su gran visión Institucional y empresarial.
ELITE NARIÑO es una revista de alto impacto social, sofisticada, diseño vanguardista y muy visual, donde la fotografía y el periodismo de investigación proporcionan un medio de comunicación impreso de excelente calidad con toda la información que le permitirá a los lectores superar sus expectativas.
El propósito de la revista es resaltar a nuestra región destacando tres segmentos que abarcan los ángulos más importantes que acontecen en el departamento de Nariño: EMPRESARIAL, POLITICA Y CULTURAL.

More in: News & Politics
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
1,283
On Slideshare
0
From Embeds
0
Number of Embeds
0

Actions

Shares
Downloads
2
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. ISSN:2256-2814 2256 2814
  • 2. Lo Máximo en Tennis C.C.PASAJEELLICEO-LOCAL103//C.C.PASAJELA17- LOCAL102
  • 3. VISITANUESTRANUEVATIENDAADIDASNEO C . C . G A L E R Í A S LO C A L 1 2 2 Síguenos en: facebook.com/darioo.sport.3 (Para mas información de Promociones y Nuestro Catálogo de Productos)
  • 4. DIRECTOR Gentil Bedoya Enriquez PERIODISTAS Mildred Vergel, Claudio Obando, Rodolfo Pantoja Pantoja, Gerardo Insuasty DEPARTAMENTO COMERCIAL Rosa Adriana Ortíz / 3008488884 Vicky Vargas / 3015767779 Diego Bedoya Revelo 3137904052 / 3162730086 Elizabeth Soledad Ortiz 3177964759 / 3183540190 DISEÑO Y DIAGRAMACION Mario Fernando Benavides Larraniaga COORDINADORA MODELO ELITE NARIÑO Diana Herrera EDICION Julio de 2.013 CONTÁCTENOS Oficinas: Calle 12 No. 21 – 61 Teléfonos: 722 8640 – 722 6071 – 3174351421 - 3176395714 revistaelitenarino@hotmail.com Las opiniones o comentarios expresados por sus columnistas o anunciantes son de responsabilidad de cada autor. Todos los derechos reservados. Prohibida la reproducción total o parcial, no tenemos asociados c 2013 GERENTE GENERAL Harold Bedoya Ortega CONSEJO EDITORIAL Hermes D. Palacios, Luisa Fernanda Suárez, Eduardo Romo Rosero COLUMNISTAS Leonel Chaves, Javier tato Álvarez, Marcial Bedoya, Eduardo Enriquez Maya, Paola Ortiz Zarama, Carlos Álvarez león, Sofonías Rodríguez Montezuma, Natalia Rodríguez, Jaime Erazo López FOTOGRAFIA Carlos Burbano IMPRESION Feriva S.A Ciudad Pasto Pasto Ipiales Tumaco
  • 5. Los mandatarios seccionales de Departamentos fronterizos en Colombia se reunieron nuevamente para analizar aspectos que tienen que ver con la realidad que se vive en estas localidades donde el común denominador son los altos índices de pobreza de sus gentes y el abandono estatal consuetudinario, como si en verdad el Centro del país nunca se preocupara por comprender que ese inmenso conglomerado de colombianos que habitamos los territorios limítrofes, amamos a una misma Patria, la llevamos en el corazón y nos importa muchísimo su suerte. Concretamente en cuanto a la frontera sur, donde vivimos los nariñenses, cada día que pasa podemos registrar con pesadumbre que somos la otra Colombia, la que poco o nada importa a los Gobernantes, prensa y televisión nacional, congreso y embajadores. Una prueba, el paro cafetero que provocó tantas inquietudes por las consecuencias que acarreaba para la industria, la economía y tantos aspectos de la vida cotidiana; allí trazó otra línea divisoria entre esas dos Colombías, ya que únicamente se mencionaba el acontecer y el registro de la gravedad del momento hasta la ciudad de Popayán, puesto que de allí hacia el sur, parecía no haber manifestantes cafeteros reclamando sus derechos con el mismo énfasis que lo hacían sus congéneres de otras comarcas. Y ese episodio, es tan solo un cuadro actualizado de cuanto ocurre desde el Cauca hacia arriba. Da la sensación que todos han olvidado que Colombia comienza en Ipiales y no en el territorio caucano, demostrado con el pésimo estado de la carretera Panamericana y el incumplimiento desde hace seis años por el consorcio DIVINAR, sin terminar el Corredor Vial, Rumichaca- Chachaguí, son testimonios fieles del olvido, la indiferencia y discriminación Estatal que no hace respetar los derechos de sus compatriotas. Cuando se han agitado las banderas de las zonas fronterizas, no se puede concebir que las fórmulas de solución consistan en simples medidas de emergencia, porque con ellas nada habremos logrado si no se enfocan a fondo los problemas y se aplican los correctivos de modo eficaz y definitivo, máxime cuando estamos ya embarcados en los TLC con tantos países y ni siquiera se esbozan las obras de infraestructura que se requieren para hacerle frente a ese fenómeno de la economía. La experiencia decepcionante que nos dejó la llamada “Ley de Fronteras” expedida hace algunos años, no puede repetirse, porque en resumen esa ley que existió en el “Diario Oficial”, no dejó una sola huella de credibilidad y menos práctica, puesto que lo único para lo que sirvió fue para que algún político se escudara en ella para hacerse elegir parlamentario reiteradamente, y nada más. Es de esperar que el Plan Contrato firmado recientemente, no sea tan solo una alborada de buenos propósitos, sino que lleve a concretarlos y plasmarlos en realidad. EDITORIAL LA OTRA COLOMBIA
  • 6. 20 24 14 34 8 10 14 16 18 20 22 24 26 27 28 34 32 36 38 40 No asoma la renovación, se imponen congresistas repitentes Carta al viejo maestro Presidente Juan Manuel Santos visitó a Diario Del Sur con motivo de sus 30 años de fundación La soberanía regional, contra el asfixiante centralismo Fundación Hospital San Pedro, moderniza sus servicios Asegurado recursos para diferentes obras en Nariño 4350 Cupos de vivienda de interés prioritario Reflexiones sobre “INDIGNAOS” La revolucionaria presencia de la nanotecnología La nostalgia por las añoradas casas viejas Presidente Juan Manuel Santos se comprometió con la seguridad e importante inversión social Obras de Avante para reconstruir Pasto Cofinal crece a pasos agigantados, brindando servicios a los sectores más vulnerables SUMARIO Contralor municipal de Pasto denuncia contaminación de “La Cocha” Reflexiones y análisis del sector agropecuario Presidente JUAN MANUEL SANTOS se comprometió con la seguridad e importante inversión social Contralor Municipal de Pasto denuncia contaminación de “LA COCHA” Esperanza Rojas de Bastidas mujer líder en el sector solidario en Nariño Obras de AVANTE para reconstruir pasto Reflexiones y análisis del sector agropecuario
  • 7. TUMACO un paraiso entre playa, brisa y mar 68 4240 42 46 50 60 66 68 71 73 76 82 85 88 90 92 93 94 Un trabajo silencioso, pero firme del alcalde de Ipiales En Tumaco hay tres tesoros por descubrir Directora general del Sena comprometida con el desarrollo de tumaco Sandoná ciudad dulce de Colombia, territorio de grandes proyecciones Navegación a vela en “La Coha” Queremos un Skatepark en Pasto Eudoro Efraín Lucero Burgos un Gualmatense de talla internacional El Cristo más grande de Colombia Fundación Hospital San Pedro, una obra de fé y perseverancia Descubramos la nueva faceta de Tumaco, un paraiso entre brisa, playa y mar Seis obras de acuerdos binacionales se desarrollan en la frontera Colombo - Ecuatoriana Colombianadas Selección Nariño de fútbol juvenil, un proceso de verdad 25 años de elección popular La movilidad es una acción compartida Peatones, pasajeros, conductores y autoridad a un solo paso 25 Años de elección popular de Alcaldes 46 Trío Magia Blanca COFINAL crece a pasos agigantados, brindando servicios a los sectores más vulnerables y contribuyendo a la solución de los problemas socio - económicos de sus asociados FUNDACIÓN HOSPITAL SAN PEDRO 1886 - 2013 “Una Obra De Fe Y Perseverancia”
  • 8. l Derecho a indignarse es sagrado, como el derecho a la protesta, a la vida, a la resistencia civil y por supuesto Francia, cuna de los Derechos Universales, con su autor Hessel, junto a los líderes del Consejo Nacional de Resistencia durante la ocupación nazi lograron la conquista de principios que transformaron la historia del mundo. Ciertamente después del horror de la guerra, la vida y los ojos de Hessel, lograron ver y disfrutar las grandes transformaciones y las conquistas ganadas después de la Segunda Guerra Mundial, los derechos universales, la seguridad social, la pensión digna, la libertad entre otras, pero también el derecho a INDIGNARSE. En los países del viejo continente hay lugar al diálogo, a los acuerdos, a la conciliación, debido a que la opinión y los derechos de los demás son sagrados, conquistados por héroes, porque hay una tradición cultural con respaldo de 2000 años de historia. Dos Guerras Mundiales sin contar los innumerables conflictos bélicos internos de cada nación Europea, la cultura y los derechos se cocinaron al fragor de sangre y fuego y en medio de dolorosas experiencias y el sacrificio de millones de valiosas vidas. Conversando por skype con mi hija Julieta Romo Mosquera, quien se encuentra en la Universidad de Cataluña, Barcelona, haciendo su especialización en Psicología Forense, sostiene que el movimiento de los Indignados basado en el extraordinario escrito de Stephane Hessel “INDIGNAOS” tiene su razón de ser por motivos de orden cultural. Mi querida Julieta, dice: “Tantos años de violencia han dejado una marca invisible en nuestra capacidad de crítica. Si bien muchos de nosotros somos capaces de ver la realidad y hacer una crítica, ésta no dura por mucho tiempo pues al momento la hacemos a un lado y continuamos con nuestra vida, por algo somos considerados como uno de los países más felices del mundo. Esta falta de memoria se ha ido incrustando en nuestras vidas que sin darnos cuenta no solo se aplica en el contexto político, sino que además en nuestro día a día no somos capaces de decir muchas cosas que pensamos o quisiéramos que cambien.” La reflexión, es que la gente en mi país parece que hubiera perdido la capacidad de protesta, es tanta la violencia y el dolor del pueblo Colombiano como afirma Hessel: “Nos han exasperado tanto que hemos perdido la esperanza”. Nada nos conmueve en un Estado casi enfermizo de total indiferencia, El profesor Hessel propone INDIGNARNOS, pero recurriendo a la “Protesta Pacífica” porque según él y Sartre: “La violencia no nos conduce a nada”, dice más adelante que: “El porvenir pertenece a la no violencia, a la conciliación de las diferencias culturales. La violencia cualquiera que sea la forma bajo la que se manifiesta, es un fracaso”. En Colombia no tenemos derecho a INDIGNARNOS, no protestamos ni pacífica ni violentamente y aquellos que se atreven a hacerlo corren un serio peligro en sus vidas; se amenaza, se silencia o se desaparece en un alarde del “todo se vale”, la gran mayoría de compatriotas que son gente buena y trabajadora observan alarmados como se saquean el erario público, pero no nos indignamos. REFLEXIONES SOBRE “INDIGNAOS” DE STÉPHANE HESSEL Por: Eduardo Romo Rosero 10
  • 9. En éste país se asesina, viola, secuestra, extorsiona, los niños crecen en una cultura violenta, la juventud sigue invadida por droga, sexo, muerte y no damos la menor muestra de INDIGNACION. ¿Será que nos acostumbramos a lo que Hessel llama “El siempre más”? Quizá Julieta tiene razón, cuando afirma que: “El miedo inunda nuestro pensamiento y como mecanismo de defensa decidimos olvidar.” Nunca antes en la historia, como ahora, un gran número de Gobernadores, Alcaldes, Congresistas, Ministros y funcionarios públicos, purgan condenas por corrupción y robo al tesoro público; pero llegan las elecciones y votamos por los mismos como si el problema no fuera con nosotros, sin rechazarlos, menos INDIGNARNOS. En Colombia el pasado 29 de marzo, el Gobierno Nacional a través del Banco de la República bajó en medio punto el crédito a los Bancos Privados y al día siguiente se aumentaron medio punto los intereses de los créditos a los particulares. Es que hay un cinismo vergonzoso, casi de bufones. El Estado busca aliviar el crédito para incrementar el empleo que ya casi llega como en España a cinco millones de desocupados y la Banca busca más dividendos, sin importar el dolor humano. “Ya es hora de que la preocupación por la ética, por la justicia, por el equilibrio duradero prevalezcan”. Pastusos, “Indignaos.” • Habitaciones en dos ambientes, dobles, acomodación para grupos y suites con aire acondicionado mini splite. • Desayuno americano tipo buffet incluido en la tarifa hotelera. • Servicio de internet banda ancha y WI-FI 24 horas. • Llamadas locales gratuitas • Traslados aeropuerto – hotel – aeropuerto (incluido) • Parqueadero (incluido) • Mini Bar • Centro de negocios (incluido) • Restaurante • Lavandería • Salón de conferencias con aire acondicionado mini splite, capacidad 90 personas POR LA ESTADÍA DE 2 PERSONAS PAGA SOLAMENTE 1 PROMOCIÓN FINES DE SEMANA Ubicado a 15 minutos de las playas del Morro, en el centro de Tumaco. Nariño “Un lugar estratégico de sus viajes de placer y de negocios, nos distinguimos por nuestra calidez, elegancia y la mejor atención”
  • 10. que antes del año 2020, la tecnología del siglo XX ausa asombro a la sociedad de consumo al verse invadida por impresionantes aparatos de comunicación reducidos a su mínima expresión, tal como ocurre con las llamadas tabletas electrónicas de menos de 8 centímetros cuadrados, gracias a la Nanotecnología la cual se encarga de diseñar, controlar de la manipulación de sus componentes que hace que las propiedades físicas, tales como la conductividad eléctrica, resistencia, cambio de color, elasticidad, se un tratamiento matemático y físico-químico diferente del ya conocido, siendo así que se requiere de ciencias como la biología molecular, ciencias de la computación, ingeniería genética, aeroespacial, biomédica, bioquímica, nanomedicina, química molecular, tecnología electrónica, de proteínas y otras, todo lo cual se hace en rango de dimensiones atómicas o moleculares a la hora de crear materiales y estudiar nuevas propiedades de la materia orgánica o inorgánica. El comportamiento de los átomos individuales está regido por la física y química cuánticas. La Nanotecnología se conoce como la ciencia de lo pequeño, tecnología atómica o molecular. Su escala está en una milésima de millonésima de metro. Los progresos de estas ciencias están respondiendo a las múltiples necesidades de la sociedad, tales como la tecnología de la información, energía, transporte, seguridad, agricultura, industria, medicina y medio ambiente, entre otras. Así se crean mono-robots que circulan dentro del cuerpo humano para repararlo de cualquier enfermedad e incluso postergar la vida del hombre en general. El rápido crecimiento de la actividad interdisciplinaria de estas ciencias, está barriendo las fronteras entre la física, química, biología, medicina, la farmacología y la ingeniería en una forma jamás imaginada. Se estima sea totalmente desplazada por la Nanotecnología, en la que se creará un cambio dramático en el cuadro de la energía mundial, mejorando ostensiblemente la calidad de vida de las personas, sin atentar contra el medio ambiente. Eso es lo que se espera dicen los jugará un papel trascendental. Esto que describo es apenas un esbozo porque la literatura de estos temas es abundante y apasionante. LA REVOLUCIONARIA PRESENCIA DE LA NANOTECNOLOGÍA EN EL MUNDO Por: Jaime Eraso López 12
  • 11. NO SOLO CONSTRUIMOS VIVIENDA, TAMBIÉN CONSTRUIMOS BIENESTAR SOCIAL. 1000 trabajadores en los proyectos que actualmente ejecutamos en todo el departamento de Nariño. PROYECTO DE VIVIENDA PRIORITARIA EN LA URBANIZACIÓN SAN LUIS DEL MUNICIPIO DE PASTO
  • 12. aseando tranquilamente por la ciudad, principalmente porsuscarrerasycallescéntricas,noobstanteunvigente proceso desmedido de demolición, aún se observan algunas casas antiguas al estilo de aquellas que otrora fueron el prototipo de mansiones de potentados y acaudalados que ahora solo son la objetividad de un registro histórico en cuyas páginas se materializa el valor y significado de esas edificaciones que en su tiempo fueron construidas, no precisamente con arreglo a sofisticados diseños y proyectos de especializados arquitectos ni mucho menos bajo el imperio de enredadas fórmulas de ingenieros calculistas, sino por obra y arte de empíricos maestros de obra y albañiles que para su trabajo, seguridad y firmeza de sus obras apenas se guiaron por las enseñanzas de sus antepasados por la tradición reinante, y a fe que salieron adelante, porque todavía se destacan sus muros de tapia o de bareque de perenne resistencia y vistoso colorido, sus artísticos balcones colgantes con llamativas tallas de madera, arte de admirable resistencia, en fin construcciones de dos plantas en su mayoría que aún erguidas siguen haciendo frente con orgullo a un avasallante modernismo en materia de programas habitacionales. Eneseentoncesquizásnuncapasóporlamentedesusoriginales artífices aquello de la economía de espacio para construir estrechos e incómodos interiores y levantar edificaciones en escasos metros deterreno,pensandoenlaamplitudysatisfacción de la vida de sus moradores, se optó más por el piso firme y en tierra que por las alturas de ahora. Se ingresaba holgadamente a las alcobas y al resto de compartimentos hogareños y no de lado con dificultad como ahora ocurre. En aquella época se pensaba en el albergue y hospitalidad agradables de familiares visitantes o de esporádicos huéspedes, se entraba con alegría a disfrutar el calor de hogar. Allíprecisamente,alinteriordeaquellascasasviejas, auténticos cofres guardianes de reliquias materiales e inmateriales pertenecientes a un pretérito que hoy con razón se añora, en esos espacios de vivienda colonial, escenarios enmarcados por la bondad, la sencillez y un romanticismo innegables de sus moradores, en la intimidad de rústicas alcobas alumbradas en la noche por la tenue y titilante luz de cirios y velones o por aquella que brindaban esos “…inquietos luceros…” de que habla una canción, en esos solariegos lugares y corredores internos de variados y coloridos adorno, fue precisamente en donde emergieron y se formaron ejemplares núcleos familiares constituidos por abnegadas madres, por serios y responsables jefes de hogar y una sumisa y numerosa prole, todos los cuales muy bien entendían lo que era el respeto mutuo y el amor paterno filial. Y no fue allí, al interior de esas acogedoras piezas hogareñas en donde se habló del control natal o de las uniones libres porque en esos tiempos otro era y muy respetable el pensar de aquellas generaciones, épocas en que temas como estos eran vetados, intocables y quizás grave pecado. Los años pasan y muchos de esos inmuebles, considerados con nostalgia patrimonio colonial, se exhiben como arcas protectoras y guardianes de imborrables recuerdos, se niegan a desaparecer, desean seguir figurando en el presente a la manera de artísticos cuadros regionales cuyo mirar invita a la evocación de aquellos tiempos idos y que jamás se repetirán porque la vida sigue su curso incontenible y con ello el cambio de costumbres, estilos y modo de pensar. Que se conserven por el tiempo que sea necesario aquellas casas viejas, dignas de inspirar las más sentidas poesías y artísticas postales para figurar en álbumes cuyo mirar permita a las nuevas generaciones recordar y formarse una leve idea de lo que antaño fuera la llamada Villa de Pasto. LANOSTALGIAPOR LASAÑORADASCASASVIEJAS Por: Marcial Bedoya Solarte 14
  • 13. CARTAAL VIEJO MAESTRO espetado maestro: esta misiva la recibirás, posiblemente con alegría en tu reino del infinito, hasta donde no llegan las penurias humanas y todo tiene claridad de aurora. Pero, mi intención es recordarte como fuiste, abnegado, sencilloentuporte,enelvestir,entrataralosdemás, especialmente a tus alumnos, alejado por completo de vanidades, por eso simplemente te llamábamos maestro, porque no presumías de docente ni alardeabas de revoltoso o sindicalista, eras el sabio apóstol de la verdad, del buen consejo que había que escucharlo porque además de sabiduría contenía afecto. Eras dechado de buena educación en las palabras con que te comunicabas con tus alumnos y con los demás, porque eras al tiempo modelo de ternura cuando con ahínco nos pedías hiciéramos siempre caso a la conciencia y ninguno al envidioso que no falta en cualquier época o circunstancia de la vida. Por eso tenías como máxima para transmitir a tus discípulos que había que mantener puestos los ojos en las estrellas y los pies en la tierra, significando así que en el infinito está el éxito mientras se actúa con solidez y firmeza. Con el tiempo comprendí el empeño que ponías en desterrar la rutina de nuestro trabajo, porque ella era una trampa mortal que hacía escapar por algún resquicio lo maravilloso de la vida. Los años me dijeron en concreto, que fuiste mi mejor amigo puesto que siempre tenías en mente la enmienda de mis errores y desaprobabas mis desaciertos, cuando éstos desenfocaban mi visión futurista. Nuncateapartastedelospreceptosdeldecálogo, así como fuiste recio en la observancia de las normas que el Estado promulga através de sus legítimos representantes, a fin de mantener el orden,prédicaquesirvióparamoldearmiespíritu, y así, como niño primero y adolescente después, aprendí a acatar la voluntad hogareña, el respeto a lasociedad,alasautoridades,amissuperiores, compañeros y amigos, de quienes recibí, por eso mismo, gratitud y reciprocidad, porque enseñaste con claridad que detrás de cada derecho, el individuo tiene un deber correlativo, con prevalencia del bien común dentro los conceptos de paz, libertad y orden. A propósito de la gratitud, que en los tiempos que corren, es algo exótico y fantasmagórico, de tus labios escuché que ella tiene tanto valor, que inclusive tiene el significado de una oración al cielo. Si en tu paso por la vida como maestro hubiera existido la acción de tutela, no habría sido menester utilizarla porque antaño todo giraba en derredor de lo correcto. Gracias por todo lo que representaste para mí … Por: Hermes Palacios 19 16
  • 14. Lunes a Viernes Repetición 5:30 P.M. - 12:30 A.M. 12:30 P.M. óónón 55:35:30 P0 PP.MMMP MMMPPPP MMMP MM 30 óóición 55n cciciónónóóóónónóó 55 ónónn 55n 5555n 55 óó PPPPP.M.M 303003030 PPP 30000033000000000000000000000003003000000030000:35:35 iccccicióióóóóióó 5:30 P MPP MPPPPPPPPPP 30:3 DIRECTOR MMMMMMMMMMMMMMMMMM -M - 2 3 MMM --- 212- M 22 MMMMM 00 P00000 P 30003000000000000003030030 P0000000000000000000000 MMM.MMMMMMMMM 12- 211221 PP0000000000000 222212121212122:322- 1-- 1-- 1- 11--M -MMMMMMMMMMMMMMMMMMMMMMMM ----M.MMMMMM MMMM 1212122222222:302:22:3:32:22222:32:32:3:3:332:3:322 M.M.M 303303030303030333333330000000 A0 A.MMAAAAAAAAAA0 AAA0 AA0 AA MMAAA MAAAAA MAA.M.MA.M.MMA MA MAAAAAAAA MMMMMMMMMMMMMMMMMMAAAAAAAAAAAAAAA MMMMMMMMMMMA MAA MAAA MA MAA MA MMA MMMA MMAAA MMA MA MA MMA MMMMMMMMMMMMMMMMMMMMMMMMMMMMMM PPP MPPP MPPP MMMMP MMP MMMMMMMMM --- 1---M - 3303333300000 A0 MMMMMAAAAA MMMMMMMMAAAAAAA MMMMMMMMMMMMMMMMAAAAAAAA000
  • 15. in pretender descubrir la pólvora, con este 2013 como año pre- electoral encima, son válidas las preocupaciones de quienes piensan que en la elaboración de listas y otorgamientos de avales,comosiempre,prevaleceránsimpatíasoantipatíaspersonalesy los intereses políticos de los parlamentarios y directivos de los partidos. Pero para evitarlo, quién le pone el cascabel al gato? Sería tanto como pedir que se acabe de un solo plumazo la presión armada sobre los aspirantes, el constreñimiento al elector, trasteo, compraventa de votos y alteración de formularios donde se contabilizan los sufragios. O que se les ilumine el bombillo frente a los paños de agua tibia contra la imaginación de los colombianos a la hora de hacer trampas con tal de salir elegidos. Los riesgos electorales dentro de la contienda del 2014 son inminentes. Sin mencionar que los candidatos, además tendrán que luchar con la falta de credibilidad de una clase política hundida hasta las cejas en el desprestigio. BARÓN ELECTORAL Esta vez, al mejor estilo de cualquier clásico de fútbol, las elecciones tendrán características muy peculiares En Nariño del partido liberal dicen los observadores que la pareja al Senado Javier “Tato” Álvarez y Guillermo García Realpe difícil aunque no imposible que ganen ambos o uno de ellos quede tendido en la lona o los dos. Cómo leerá esta responsabilidad escarlata el Jefe Único Simón Gaviria? A“Tato”consideradobarónelectoralcreenquelofortalecerálazonasur con su aliado -- entre otros—Gustavo Estupiñan, ex alcalde de Ipiales con pretensiones a la Cámara. Mientras que a García le reconocen su trabajo y capacidad de gestión para compensar los votos que ya no le aportará Antonio Navarro –posible candidato al Senado—y la disminuida colaboración del Gobernador Segundo Raúl Delgado, quien ya dispone de tolda aparte. El fraude y la intimidación amenazan el proceso SE IMPONEN CONGRESISTAS REPITENTES No asoma la renovación PATERNIDAD RESPONSABLE ElDepartamentodeNariñoseexponeareducirenlaCámaraAltaelnúmero de escaños. Veamos las posibilidades. De nuestro delfín Camilo Romero de “Vamos Independientes” se rumora que podría caer en la tentación de lanzar su nombre a la Gobernación de Nariño o Alcaldía de Pasto. Mientras que el avezado jurisconsulto Parmenio Cuéllar del “Polo Democrático Alternativo” como buen padre le cedería la curul a su hijo Camilo Cuéllar. Por su parte el progenitor disputaría nuevamente la Gobernación por la que ya pasó. En la otra orilla supuestamente todo parece estar fríamente calculado si la baronesa conservadora Myriam Paredes quien hace parte de la Comisión de Asuntos Internacionales y su copartidario Eduardo Enríquez Maya, quien ha logrado la aprobación de transcendentales leyes, deciden repetir. En concepto de los analistas ahí no hay nada que hacer. Él, siguiendo el ejemplo “parmenista” también encarriló a su heredero a la Cámara de Representantes. Quizá mayor esfuerzo deberá llevar a cabo Manuel Enríquez, si quiere continuar militando en el partido de la “U” porque la normatividad no le permite pasarse al “Centro Democrático” que lidera su llave, el ex presidente Álvaro Uribe, de quien fue su escudero, si bien ambos opinan que la amistad tiene carácter incancelable. ¿CARROS DE BASURA? Afanadas por llevar a buen suceso estas elecciones, las autoridades encargadas han disparado las alarmas sobre los riesgos electorales. Las artimañas de la corrupción y la politiquería terminan anulando la inscripción de miles de cédulas a lo largo y ancho del país. Con el agravante de la fragilidad del sistema electoral que es ágil a la hora de entregar resultados pero paquidérmico cuando se trata de encontrar y corregir las fallas. Otragrandebilidadeslafaltadeinterésencapacitarseylairresponsabilidad de los jurados de votación y de los testigos electorales. Seamos francos, cuando el conteo de votos es manual inclusive una equivocación de buena fe puede alterar el querer ciudadano. Y quizá lo peor, desaparecieron los ideólogos. Por su ambición de sumar votos, los partidos políticos se parecen a los carros de la basura que van recogiendotodoloqueencuentranasupasoynoasumenresponsabilidades. Por: Claudio Obando Burbano 18
  • 16. TTeelll:: (((000999222))) 777223 64 221 Fax: (092) 723 688 333888 www.condimentoslagarza.comww.condimentoslaww ndimentoslagarr .... .... .... ..ww.ww.w.condw. mm a comnn cccondimentoslagarcondimentoslagart lww.condimentoslagarza.comwwwww
  • 17. N DICIEMBRE, PASTO CONTARA CON POLICIA METROPOLITANA. Así lo anunció el presidente Juan Manuel Santos Calderón en su reciente visita a la ciudad, donde ratificó la llegada de 500 uniformados que estarán permanentes para garantizar la seguridad ciudadana. Ante el incremento de la violencia en la capital nariñense, el mandatario de los colombianos comisionó al general Francisco Patiño Fonseca con 200 hombres, especializados en contrarrestar los homicidios, sumándose a los 650 policías que hace algunos meses llegaron a Nariño. El Presidente Santos en la visita a Pasto, entregó oficialmente al comando de la Policía Nariño 60 motocicletas, 18 camionetas y tres CAI móviles, que funcionarán en los sectores donde más se ha detectado la presencia de las bandas delictivas. Y de esta manera, reforzó la seguridad en Pasto y en algunas regiones del Departamento. El Mandatario Nacional confirmó la puesta en marcha de un plan piloto de seguridad que iniciará en la plaza de mercado El Potrerillo y que se extenderá a otras ciudades del país. Así mismo, les anunció una línea de crédito a los pequeños comerciantes de la central de abastos, por $3.000 millones, proyecto liderado por Bancoldex en asocio con la Alcaldía de Pasto. La medida tiene la finalidad de acabar con los préstamos ‘gota a gota’, donde los comerciantes están pagando altas tasas de interés. Juan Manuel Santos, también oficializó varios proyectos para beneficio de la capital de Nariño, como la entrega de 1.396 computadores con una inversión de $1.533 millones para sedes educativas públicas, lo que permitirá avanzar en la meta de 12 niños por computador. Y la entrega de un Punto Vive Labs por una suma de $1.232 millones que beneficiará a 200 personas. Con asistencia por parte de Findeter, Pasto entró a participar en el programa de Ciudades Sostenibles y Competitivas en alianza con el PRESIDENTE JUAN MANUEL SANTOS SE COMPROMETIÓ CONLASEGURIDADEIMPORTANTEINVERSIÓNSOCIAL Banco Interamericano de Desarrollo, BID, el cual permitirá generar sostenibilidad ambiental, urbana, económica, social, fiscal y gobernanza. El Gobierno local también ha logrado incluir otro tipodeobrasdeinfraestructuraquebeneficiarán al sector urbano y rural del Municipio, como es el mejoramiento del parque en el barrio Santa Mónica, de la Comuna 3, con una inversión de $200 millones. Y el mejoramiento del escenario deportivo del corregimiento de San Fernando, porunvalorde$108millones.Losdosproyectos se encuentran en etapa de estructuración. IMPORTANTES APORTES ECONÓMICOS Presidente Santos en compañía del alcalde Harold Guerrero en la entrega de CAI MOVIL y 60 motocicletas INFORME DE INTERÉS GENERAL Por: Rodolfo Pantoja Pantoja 20
  • 18. En cuanto al programa de vivienda gratis, en Pasto se adelanta la construcción de 1.914 casas para más de 7.600 personas, que tienen un valor de $ 75 mil millones. El programa de construcción relaciona tres urbanizaciones: Nueva Sindagua (406 viviendas), San Sebastián (400 casas) y San Luis (1.108 viviendas). Estas son algunas de las acciones que apoya el Gobierno Nacional a través de la gestión realizada por el mandatario local Harold Guerrero López. VIVIENDA Otra inversión importante, es la optimización de la Planta de Tratamiento Centenario por un valor de $ 7 mil millones, el cual beneficiará a 42 mil personas y será culminado en marzo de 2014. Así mismo, está el sistema de abastecimiento de la quebrada Las Piedras en su segunda fase, con una inversión de $30 mil millones, favoreciendo a más de 110 mil habitantes. Además el alcantarillado de la calle 20 con una inversión de $5 mil millones que beneficiará a 349 mil habitantes y será entregado a la comunidad en febrero de 2014. El Gobierno también hizo referencia a las conexiones intra domiciliarias que tienen una inversión de $4.600 millones de pesos, beneficiando a 1.220 familias. Este proyecto deberá estar finalizado en diciembre de 2013. El presidente Juan Manuel Santos en el Colegio Ciudad de Pasto Juan Manuel Santos en el Potrerillo acompañado del alcalde, Harold Guerrero López
  • 19. l presidente Juan Manuel Santos Calderón visito las instalaciones del periódico DIARIO DEL SUR con el fin de congratular y felicitar de manera sincera a susdirectivos,periodistasycolaboradores,sobre la magnífica labor que cumple cotidianamente esta casa editorial en Pasto y en Nariño. DIARIO DEL SUR cumplió en marzo los 30 años de su fundación, pero la conmemoración oficial fue el 18 de abril en el Club Colombia, donde asistieron senadores, representantes, gobernador, alcalde de Pasto, instituciones, corporaciones y distinguidas personalidades de la ciudad y del Departamento. En este evento, el director y fundador de DIARIO DEL SUR, Hernando Suarez Burgos, recibió numerosas distinciones y galardones, como también las diferentes manifestaciones deaprecioyreconocimientoalaextraordinaria labor quijotesca que cumple este medio de comunicación en Nariño y en 20 ciudades de Colombia. PRESIDENTESANTOSVISITÓADIARIODELSUR CONMOTIVODESUS30AÑOSDEFUNDACIÓN 22
  • 20. l Contralor del Municipio de Pasto, José Fabián Jurado Mora, salió a la defensa y protección del medio ambiente y priorizó en la agenda de la entidad denuncias por el descuido de las autoridades y de Corponariño, en la ciudad San Juan de Pasto y en lugares como el corregimiento de El Encano. Manifestó a la Revista ELITE NARIÑO, que cómo es posible que en pleno siglo XXI, en El Encano, municipio de Pasto, sector importante del turismo nariñense, no se haya construido el sistema de alcantarillado y no se cuente con el tratamiento de las aguas residuales, con el fin de evitar la contaminación de las aguas de La Cocha. Elfuncionarioexpresóqueestetemaseabordoyanalizó enelEncuentro Nacional de Aguas que se realizó en la Universidad Mariana de Pasto, al cual asistieron delegados del orden nacional, departamental, local y organizaciones comunitarias de Nariño y Putumayo. El Contralor José Fabián Jurado Mora, reiteró: “El Departamento y su capital Pasto, cuentan con la Laguna de La Cocha, humedal Ramsar, que hace parte del corredor Andino Amazónico Norte, Ecorregión Bordoncillo - Patascoy y es triste que esta comunidad, como la que habita el Puerto, consuman alimentos contaminados de la Laguna, por falta de la canalización de las aguas negras. R. E. N. ¿Para solucionar este grave problema, que están haciendo las autoridades competentes? J.F.J.M. “En el Encuentro Nacional de Aguas, se informó por parte de la alcaldía a través de la Secretaría de Gestión Ambiental que hay un presupuesto para la construcción de la Planta de Tratamiento de El Encano pero, para la comunidad de la vereda El Puerto no hay una solución inmediata. Por parte de los delegados de CORPONARIÑO, solo dijeron, que ésta comunidad debía ser evacuada. Esto se interpretó que la Alcaldía Municipal se encargue de la solución del problema con los habitantes del Puerto. Lo injusto es que La Corporación recibió en el 2012, por concepto de transferencias del impuesto predial de Pasto $ 4.500 millones. Me pregunto ¿De qué manera ellos reinvierten esos recursos en el municipio de Pasto?” CONTRALOR MUNICIPAL DE PASTO DENUNCIACONTAMINACIÓNDE“LACOCHA” José Fabián Jurado Mora, Contralor del Municipio de Pasto 24
  • 21. R.E.N. ¿A su juicio cuales son las falencias en el tema del Medio Ambiente por parte de Corponariño? J.F.J.M: “Pienso que Corponariño es una institución inoperante, no le presta servicio a la comunidad, no cumple con la función legal para la cual fueron creadas las Corporaciones Autónomas Regionales, no desarrolla la función básica de educación ambiental, en el caso explícito del municipio de Pasto yo no veo nada”. R.E.N. ¿Ante esta valiente denuncia usted ha recibido respaldo político y gubernamental? J.F.J.M. “Es un tema que se debe debatir públicamente y de cara a la comunidad, sin embargo, no he logrado el respaldo de los concejales, ni de las organizaciones del Medio Ambiente de Pasto ni de los habitantes del corregimiento de El Encano. Y en este caso soy una sola golondrina que la pueden amenazar”. R.E.N. ¿Que otras irregularidades ha detectado? J.F.J.M. “Hace algunos días, me reuní con funcionarios de la Secretarías de Gestión Ambiental y Tránsito, para tratar dos temas: Primero, el manejo indiscriminado que existe en Pasto con las escombreras. La ciudad pierde el ornato y embellecimiento por qué no hay control en esta materia. Y segundo, solicité información de lo que están haciendo en materia de medición de gases y sobre todo cuales son los aportes de Corponariño en la solución de ésta problemática”. Puerto La Laguna de La Cocha
  • 22. Las cifras económicas y sociales han demostrado que el modelo centralista en Colombiahafracasado.Desafortunadamente los dirigentes políticos defienden este sistema para proteger sus intereses, obnubilando a sus electores con un estado de fantasía social. La anarquía institucional generada por falta de legitimidad en los cargos públicos por nombramiento o elección popular, se debe a las contrataciones amarradas a favor de particulares, a la excesiva burocracia y al innecesario clientelismo gubernamental. Perfecto encaje para la clase política en el manejo de la corrupción y la ilicitud. Se plantea entonces, la necesidad de repensar el modelo de Estado Regional para un país como el nuestro, multicultural y pluriétnico, que fortalezca la unidad nacional sobre la base del respeto a la diversidad. Es ahora cuando cobra mayor importancia el debate que plantea desde la ciudad de Pasto, el abogado Julio César Bastidas Castillo, en la construcción de un Estado incluyente que consulte la fragmentación política, administrativa, cultural, social y económica, además de las grandes disparidades territoriales. Gracias a él, la discusión sobre la conveniencia de la soberanía regional y local a través de los Autonomías Territoriales empieza a ser un asunto de saludable discusión en sectores muy representativos de opinión. Razón por la cual los alcaldes consignaron su reciente protesta ante el Presidente de la República. LA SOBERANÍA REGIONAL,CONTRA EL ASFIXIANTE CENTRALISMO Por Claudio Obando Burbano Hay algunos cuantos tan ingenuos, que en lugardegobernarseellosmismosprefieren ser gobernados y explotados por otros. THOMAS HOBBES RegiónCundiboyacense: CundinamarcayBoyacá RegiónPaisa: Antioquia-Risaralda-Quindío-Caldas RegiónSantanderes: SantanderdelNorteySur Región CostaCaribe: Guajira-Magdalena-Atlántico-Bolivar-Sucre-Cesar-Córdoba RegiónPacífica: Choco-Valle-Huila-Tolima RegiónLlanos: Arauca-Caquetá-Casanare-Guainía-Guaviare-Vaupés-Vichada-Meta RegiónPanamazónica: Cauca-Nariño-Putumayo-Amazonas RegiónCosmopólita: Bogotá RegiónInsular: SanAndrésyProvidencia RegióndelaOrinoquía 1 2 3 4 5 6 7 8 9 10 OceanoAtlántico Panamá OceanoPacífico Ecuador Perú Brasil SanAndrés y Providencia Venezuela 26
  • 23. R.E.N: ¿Cómo define usted el Centralismo? J.C.B.C: EL centralismo es la concentración de funciones y facultades de todo un país, en la toma de decisiones en un solo sitio, en este caso Bogotá.El centralismo propicia y fortalece la corrupción, el atraso, la desigualdad, la concentración de la riqueza; la violencia, el narcotráfico, la doble moral, la anarquía institucional, las contrataciones leoninas a favor de los particulares y los grandes cargos burocráticos o clientelistas de este país a favor de unos pocos privilegiados. R.E.N: ¿Cuál es el ejemplo? J.C.B.C: La mercantilización de la salud, la educación y la justicia. La privatización de bienes y servicios públicos. La concesión de los sistemas de comunicación como carreteras, telecomunicaciones, aeropuertos y todo cuanto signifique lucro. R.E.N: ¿Qué desventajas genera el Centralismo? J.C.B.C: En los tres poderes y los órganos de control, reina el desorden, la crisis y la anarquía institucional en lo nacional, regional y local. Situación perfecta para el manejo de la corrupción. R.E.N: ¿Cómo se distribuye el poder en Colombia? J.C.B.C: Las ramas en el poder del Estado Colombiano; el gobierno, el congreso y la justicia además de los órganos de control se los reparten tres grupos, los costeños, los paisas y los bogotanos; si algo les sobra, que casi nunca ocurre le dejan al resto de la provincia. Les interesa el poder y manejo en lo político, administrativo y económico, por medio de una estructura burocrática y clientelistaque es el motor generador de la corrupción en Colombia. R.E.N: ¿En otras naciones ha prosperado el modelo federalista? J.C.B.C: Desde luego, los que han adoptado la soberanía regional y local son los países de mejor bienestar en su población. Los casos más notorios Estados Unidos, Canadá, Brasil, México, Argentina, Alemania, Suiza, Austria, España entre otros y de mayor relevancia, China y los Emiratos Árabes permitiéndoles un mayor desarrollo cultural, social y económico. R.E.N: ¿Un proyecto de tal magnitud es viable en Colombia? J.C.B.C: Por supuesto, Colombia es un país de contrastes culturales, sociales y económicos. Lo primordial es homogenizar el desarrollo y progreso de las regiones que la globalidad del mundo requiere. Gran parte de la provincia en Colombia es comparable con las economías de Haití y África pobre. Nariño, no es la excepción. R.E.N: ¿Frente a esta propuesta, la gente es receptiva? J.C.B.C: Mucho, ya se habla del tema en los diferentes estamentos políticos, académicos, medios de comunicación. El mejor ejemplo fue la participación masiva que hubo en la Consulta Caribe. Este es el único camino para lograr la verdadera paz en Colombia. Al respecto, la Revista ELITE NARIÑO, entrevistó al dirigente pastuso Julio César Bastidas Castillo, quien en su participación como parlamentario de Nariño presentó el proyecto de ley y escribió el libro ‘’Autonomías Regionales”:
  • 24. Somos la Semilla de una Nueva Ciudad
  • 25. Avante viene ejecutando en la ciudad una serie de obras de infraestructuraconelfindemejorarlamovilidadylacalidaddevida de los residentes de Pasto e implementar el Sistema Estratégico de Transporte Público de Pasajeros, el cual permitirá a los usuarios el desplazamiento dentro de la ciudad pagando un solo pasaje. A continuación presentamos los proyectos que se están ejecutando y que pronto estarán al servicio de los ciudadanos. OBRAS DE AVANTE PARA RECONSTRUIR PASTO Jorge Cote, Gerente AVANTE
  • 26. Esta obra transformará la entrada sur de la ciudad y será la cara de bienvenida a quienes arriben a Pasto desde el Ecuador y el sur del continente. La intervención en la zona comprendió la pavimentación total de la vía, con dos carriles en cada sentido y una renovación total del espacio público. La técnica y los materiales empleados en la obra garantizan una larga duración a esta importante vía de tráfico pesado que ya está funcionando. La inversión en la pavimentación fue de casi 6 .670 millones de pesos. La adecuación del espacio público es un componente importante de este proyecto al que se destinan cerca de $1.380 millones. En la zona de construyen amplios andenes que responden a los estándares de accesibilidad para personas con limitaciones y funcionará una de las ciclorutas con las que contarán aquellos que prefieran trasladarse en medios alternativos como la bicicleta. El proyecto en esta zona incluye la pavimentación de una calzada y laintervenciónenelespaciopúblicoqueserátotalmenterenovado. La vía que une la Av. Idema con el Hospital Departamental ya está concluida y al servicio de la comunidad. En este sector los transeúntes podrán utilizar con amplios andenes que permiten la movilidad segura de peatones con limitaciones de visión o de movilidad. De igual manera se construyó un nuevo puente peatonal sobre la canalización que atraviesa la zona. En este proyecto la inversión alcanza los 1.300 millones de pesos. Pavimentación y Urbanismo Calle 12 Avenida Chile 30
  • 27. El tráfico vehicular ya está habilitado por esta vía que comunica la Avenida Panamericana con el Centro Administrativo Municipal de la Alcaldía de Pasto en el sector de Anganoy. El proyecto ejecutado por el Consorcio San Juan, incluye el arreglo y la adecuación de los andenes. La inversión en este proyecto supera los 780 millones de pesos. Con la ejecución de este proyecto se intervinieron varios sectores y tramos viales críticos de la ciudad con el fin de mejorar la movilidad y hacer una rehabilitación de la malla vial que garantice unas calzadas de calidad con una inversión superior a los 3 mil millones. Carrera 33, Vía a Anganoy Rehabilitación de 12 vías urbanas La rehabilitación de las vías incluidas dentro de este proyecto va más allá de un simple bacheo o parcheo, en ellas tras la intervención en los huecos se aplicó una capa de asfalto de 8 centímetros sobre todo el ancho de la calzada. Además se adelantaron trabajos en sumideros, sardineles y tapas de alcantarillas. Algunas de las vías que hacen parte de este proyecto son: la calle 17, la carrera 32, el sector del parque Bolívar, la calle 11 en el sector de Santiago, la zona de la I.U. Cesmag, el sector de Fátima, entre otros.Enelsegundosemestredelañoseadelantará una rehabilitación de otras vías de la ciudad.
  • 28. EstavíaquecomunicalaAv.Mijitayoconelsectorde Anganoy estará pronto al servicio de la comunidad y será una vía paisajística gracias a la panorámica privilegiada de la ciudad que se aprecia cuando se recorre. La inversión en este proyecto supera los 2.300 millones de pesos y la ejecución de la obra está a cargo del Consorcio Pasto 2050. Calle 8 Oeste Avante y la Alcaldía de Pasto agradecen a la comunidad su sentido de pertenencia con la ciudad y su comprensión ante las molestias lógicas que ocasiona la ejecución de un proyecto de gran envergadura. Próximamente Avante empezará obras en la Avenida Idema, calles 20 y 16 y Avenida Panamericana con las que continuaremos con la transformación y reconstrucción de nuestra capital. Además de las obras de pavimentación este sector tendrá andenes espaciosos, dotados con una franja táctil para invidentes y rampas de acceso para quienes utilizan silla de ruedas. También contará con una cicloruta para fomentar el uso de este medio alternativo de transporte. 32
  • 29. REFLEXIONES Y ANÁLISIS DEL SECTOR AGROPECUARIO La indolencia oficial frente a las vías de hecho y a los acontecimientos lparocafeterosirvióparareafirmarqueno existe una política agraria que priorice la produccióncampesinaenelpaís.Cuando se practiquen los análisis y se cuantifiquen las pérdidas, seguramente llegaremos a la conclusión de que más fueron las pérdidas que los beneficios logradosporlosagricultoresenelparo. Es que ese hábito de taponar las vías e impedir la libre movilización de las personas, que ya se ha hecho costumbre para presionar al Gobierno, que es sordo hasta que los hechos lo desbordan, termina dando resultado porque el Mandatario Nacional indolentemente deja que ocurra y no practica lo que en salud se llama la prevención. El mejor consejo, es prevenir los desacuerdos entre las partes y luego no lamentar las consecuencias quesonfunestasparatodos.Losparosnoocurren de la noche a la mañana sino que se anuncian con meses de anticipación, se dejan madurar hasta llegar a su climax y entonces, cuando las circunstancias se salen de su cauce se entra apenasadialogaryaconcederlaspeticionesque pudieron conciliarse desde un comienzo sin tener que traumatizar la economía de las regiones tan vulnerables como el Departamento de Nariño. Con el paro cafetero sufrieron los paperos, paneleros,productoresdeleche,transportadores, hoteleros, la industria, sector de combustibles y en fin todo el comercio en general de Nariño. Nuestro Departamento necesita de los recursos del nivel central y que se establezcan políticas especialesyespecíficasparaelagroportratarsede zona de frontera, por ser una región con problemas de orden público y sobre todo por la extrema pobreza y la inequidad existente en su sector rural. Nariñoenotrasépocas,nomuylejanas,eramodelo de coexistencia pacífica, remanso de paz, con una población campesina que cultivaba los diversos productos para el autoconsumo y la venta a la población urbana, sin mayores traumatismos en su resignada y bucólica existencia. Fue víctima en los años90delallamadaglobalizacióndelaeconomía y entonces le dijeron que no sembrara (porque se iba a importar a precios inferiores a los de su producción) pero no les indujeron el sistema de solución para recuperar la economía agropecuaria. Por: Javier Tato Alvarez Montenegro Representante a la Cámara Cultivos cafeteros en el municipio de la Unión 34
  • 30. Y es así como el campo nariñense pasa de la pobreza a la pauperización y prácticamente a la desaparición de la economía campesina. Productos como la papa, requieren de una inversión cercana a los seis millones de pesos por hectárea, suma que muchas veces está fuera del alcance de los pequeños productores y si los tienen o se los prestan, debe correr el albur de los precios en el momento de la venta del tubérculo, que pueden conducirlo a la quiebra y a la pérdida de su parcela. El trigo desapareció del listado de la producción agropecuaria del Departamento siendo que en 1994 habían 30 mil hectáreas sembradas y hoy apenas 4.524 con rendimientos inferiores a dos toneladas / hectárea, prácticamente una forma lenta de entrar en quiebra. Y si hablamos de la cebada en otrora ícono de nuestro Departamento en cuanto a la producción agrícola, en 1987 era de 14.500 hectáreas y en la actualidad 227 sembradas o sea que este cultivo salió del menú de la oferta agrícola departamental. Lo mismo ha ocurrido con toda una serie de productos agrícolas que languidecen por falta de apoyo del Estado en todo el proceso de siembra, cultivo y cosechas, sobre todo en el mercadeo del producto, que realmente es un cuello de botella para el gran agricultor y en especial para el mediano campesino. Pero estos son otros tiempos, tiempos en que hablamos de combate a la pobreza, a la inequidad y de la exclusión de los pobres. Debemos cancelar la deuda social que se tiene con el campesinado realizando ahora sí una reforma agraria integral que lleve al siglo 21 a nuestros agricultores. Hay que dotarlos de tierras suficientes para el desarrollo de todas las potencialidades de su familia que le permita vivir con dignidad y esperanza; darle todos los apoyos estatales en lo concerniente a vivienda, educación, salud y recreación. Proporcionarle todas las herramientas para la producción como la asistencia técnica, crédito, innovaciones tecnológicas, sistemas de comunicación y apoyo en la selección de cultivos y en su mercadeo. El bienestar en el campo definitivamente implica solución a sus problemas, paz y seguridad en las ciudades. Fotografías cortesía: Federación Nacional de cafeteros, seccional Nariño
  • 31. $130.000millones $3.000millones $5.000millones $50.000millones $75.000millones $40.000millones $43.600millones $83.000millones $120.000millones $120.000millones $58.900millones VíaEspriella-RíoMataje PreinversiónvarianteElEncano-Santiago PreinversiónAcuapistaTumaco-Buenaventura FinalizaciónPistaAeropuertoIpiales PavimentaciónvarianteSanFrancisco–Mocoa VíaCircunvalaralGaleras VíaIpiales-Guachucal–ElEspino VíaTúquerres-Samaniego VíaJunín–Barbacoas VíaElEmpate-SanBernardo-LaCruz-Higuerones Finalizacióndelasvías:Córdoba-Panamericana;Iles-PilcuányPanán-Cumbal ASEGURADO RECURSOS PARA DIFERENTES OBRASENNARIÑO l Consejo Superior de Política Fiscal, CONFIS, adscrito al Ministerio de Hacienda y Crédito Público, aprobó los recursosdelasvigenciasfuturasparaelDepartamento deNariñopor$728.500millonesdestinadosadarcumplimiento a los proyectos de infraestructura contemplados en el Contrato Plan. El Gobierno Nacional aportará la suma de $ 682 mil millones y el Departamento $ 46.500 millones procedentes de los recursos de regalías. Así lo manifestó el Gobernador Raúl Delgado Guerrero, quien se mostró optimista por las obras programadas desde hace 20 años, aspirando a ejecutarse varias de ellas en su gobierno y el resto se terminarán hasta el año 2016. PROYECTOS DE INFRAESTRUCTURA CONTEMPLADOS EN EL CONTRATO PLAN $728.500 MILLONES GOBIERNO NACIONAL Departamento de NARIÑO (Procedentes de los recursos de regalías) Dpto de Nariño LosproyectosavaladosporelCONFIS,destinadosalaconstruccióndeinfraestructurason: en enero entre la Nación y el Departamento compromete inversiones por valor superior a 1 billón quinientos mil millones de pesos, que por $ 728 mil millones; de Agua Potable y Saneamiento Básico por $ 161 mil millones; de Tecnologías de la información y comunicación por $165 mil millones; de Desarrollo productivo por $126 mil millones; en energía y gas, $ 120 mil millones, de los cuales $ 60 mil millones se destinarán al gasoducto Popayán - Pasto. De igual forma, el sector de educación contará con recursos por $ 106 mil millones y el sector salud $ 51 mil millones. 36
  • 32. FotografIapor: 300 750 93 78
  • 33. MUJER LIDER EN EL SECTOR SOLIDARIO EN NARIÑO ESPERANZA ROJAS DE BASTIDAS 38
  • 34. Trabajó 13 años como docente en la Institución Educativa Nuestra Señora de Fátima y durante 8 años como Coordinadora Académica en la Jornada Nocturna de la Institución Educativa Santo Tomás de Aquino del municipio de Sandoná. A los 21 años al servicio del Magisterio de Nariño se retira para dedicarse exclusivamente al sector solidario. En 1988 aceptó el cargo de coordinadora de asuntos cooperativos de la Entidad “El Coeducador” hoy COFINAL, cargo que lo desempeñó hasta 1995. A partir de este año hasta el 2002 fue nombrada Directora de la Agencia de Cofinal regional Sandoná. El 26 de Abril del 2002 asume el cargo de Gerente General elegida por unanimidad por el Consejo de Administración de COFINAL LTDA, cargo que desempeña con lujo de competencia hasta la fecha y con positivos resultados. ESPERANZAROJASDEBASTIDAS,sehadestacado como una líder empresarial del Cooperativismo, no solo en Nariño y en Colombia sino también a nivel internacional. Su trabajo en favor de la niñez ha sido reconocido por el Consejo Mundial de Cooperativas WOCCU con sede en Estados Unidos como “La Mujer Líder del Cooperativismo en Colombia” hecho que le permitió viajar hasta Las Vegas para recibir este homenaje, en razón al apoyo a las instituciones educativas del Departamento de Nariño en beneficio de la infancia. De igual manera el TRADE LEADERS CLUB empresa española seleccionó a COFINAL Ltda. como merecedora al TROFEO INTERNACIONAL A LA EXCELENCIA EMPRESARIAL por fomentar la filosofía de calidad organizativa, evento que se realizó en Madrid España. Nació en Sandoná, sus estudios primarios y secundarios los inició en la Institución Educativa Nuestra Señora de Fátima y se graduó como bachiller en 1979 en la Institución Educativa Santo Tomás de Aquino; los estudios superiores los realizó en la Universidad Mariana donde obtuvo el título de Licenciada en Educación con especialidad en Ciencias Económico - Familiares. En 1.998 adelantó el Post-Grado con la Universidad del Valle obteniendo el título de Magister en Administración Educativa con Énfasis en Dirección y Gestión. EXPERIENCIA LABORAL RECONOCIMIENTOS ESPERANZA ROJAS DE BASTIDAS Otrohechorelevante, eselrealizadoporLaUniversidad Cooperativa de Colombia destacando las 10 mejores empresas de Nariño y a la Representante Legal Mg. Esperanza Rojas como la mujer emprendedora del sector solidario. Una nueva distinción le otorgó el Concejo Municipal de SANDONA, a COFINAL liderada por la Señora Esperanza Rojas de Bastidas como una entidad que propende por el bienestar de los asociados y por el trabajo que desarrolla con la niñez sandoneña en las diferentes instituciones educativas. Así mismo el Concejo Municipal de Pasto exaltó la labor social de la Cooperativa con los sectores más vulnerablesdeNariño,cumplidaporlaSra.Esperanza Rojas de Bastidas. El doctor Harold Guerrero, Alcalde de Pasto en el día de la Mujer, también la destacó como una de las siete mujeres exitosas de Nariño representando al sector solidario y por su contribución con el desarrollo del Departamento.
  • 35. OFINAL fue creada el 4 de Julio de l964 por 58 docentes del colegio San Juan Bosco, motivados por la difícil situación económica de ese momento. Nace con el nombre de Coeducador porque su vínculo era únicamente para docentes, pero en 1995 cambia su razón social por COFINAL LTDA. Se rige por las leyes 79 de l988 y 454 de l998. COFINAL CRECE A PASOS AGIGANTADOS, BRINDANDO SERVICIOS A LOS SECTORES MÁS VULNERABLES Y CONTRIBUYENDO A LA SOLUCIÓN DE LOS PROBLEMAS SOCIO - ECONÓMICOS DE SUS ASOCIADOS BENEFICIOS FINANCIEROS QUE TIENE LA COOPERATIVA • Cuenta de ahorro Cofiahorrito • Cuenta de ahorro Cuenta de Ahorro Cofisemilla • Cuenta de ahorro Empresarial • Ahorro Contractual • Ahorro Programado • CDAT • Aportes Sociales BENEFICIOS SOCIALES DE COFINAL Respecto a los beneficios sociales de la cooperativa; creados para mejorar la calidad de vida de nuestros asociados y se alimentan con los excedentes de la cooperativa, entre ellos tenemos: • Fondo de Solidaridad • Fondo de Bienestar integral • Fondo de Educación • Grupo asociativo años felices • Planes excequiales • Seguro de vida cofinanciados por la cooperativa • Pagos de Familias en acción y subsidios de Comfamiliar de Nariño • Convenios con Telefónica y Movistar • Convenios interinstitucionales para acceder a los servicios especializados en salud y odontología a bajo costo EsunaempresavigiladaporlaSuperintendenciadeEconomía Solidaria, respaldada por el Fondo de Garantías de Entidades Cooperativas FOGACOOP. Es una cooperativa especializada en Ahorro y Crédito con 48 años de existencia jurídica en el sectordelaEconomíaSolidariaconamplia cobertura en el sur occidente de Colombia y tiene presencia en 13 Municipios de Nariño, una en el Cauca y otra en el Putumayo. En la actualidad cuenta con 36.000 asociados. 40
  • 36. COFINAL APOYA LA EDUCACIÓN FORMAL La Inversión Social de la Cooperativa a través de la aplicación de los excedentes COFINAL, en el año 2012 entregó $1.116.194 pesos de los cuales $216.136.000 pesos del Fondo de Educación acatando el decreto 2880 el cual obliga a las cooperativas a invertir en Educación Formal de las cuales han sido beneficiadas muchas instituciones Educativas del Municipio de Pasto y del Departamento de Nariño VALORES AGREGADOS EXCLUSIVOS DEL SECTOR SOLIDARIO Dentro de los valores agregados de la cooperativa lo realiza con la extensión de los servicios sociales a través de los fondos de SOLIDARIDAD Y BIENESTAR INTEGRAL, los cuales permite llegar a los asociados y comunidades donde tiene presencia la cooperativa en los donde tiene presencia nuestra Cooperativa. Las entregas están representadas en uniformes, zapatos, kit escolares, sudaderas y dotación de restaurantes escolares. Caberesaltarquelosbeneficiossocialesdelacooperativason destinados para los niños más vulnerables del Departamento de Nariño y la selección es avalada por las Secretarias de Educación Municipal y Departamental. momentos difíciles para mitigar en parte sus necesidades apremiantes; por medio de estos fondos contribuye al mejoramiento de la calidad de vida de los asociados. En el año 2012 se entregó del fondo de Solidaridad $553.241.000 de pesos y del fondo de Bienestar Integral $396.717.000 pesos. Entrega de sudaderas en el corregimiento de SANTA BARBARA (PASTO) Entrega de libretas y recursos educativos INSTITUCIÓN EDUCATIVA ANDES DE CUICAL Entrega de sudaderas al colegio INEM Participación en el CARNAVALITO
  • 37. a Fundación Hospital San Pedro desde su nacimiento el 18 de marzo de 1886 soporta y fundamenta su pensamiento, direccionamiento y acciones no como acción filantrópica sino enmarcada en un pensamiento que en lenguaje de hoy significa, fortalecerse en prácticas de responsabilidad social empresarial que definen en su legado directrices que permanecen incólumes pero en constante evolución con base en el nuevo entorno, estas son: 1. Se creará un Hospital de caridad para los pobres. 2. Esta obra, para garantizar su transparencia en el cumplimiento de sus objetivos, siempre tendrá como garante y patrono al OBISPO de la Diócesis de Pasto. 3. Al servicio de los enfermos siempre estará la Comunidad de la Hermanas Vicentinas y habrá un Capellán y una capilla para el apoyo espiritual. Somos una fundación privada, sin ánimo de lucro, de III y IV nivel de complejidad que desde su nacimiento, hace ya 127 años, no ha cerrado sus puertas ni un solo día para cubrir la salud de la comunidad nariñense y del sur occidente colombiano. Hoy proyectamos un Hospital seguro, que trabaja para conseguir los más altos estándares de calidad, y así continuar brindando a nuestros usuarios una atención médica de calidad, amable y humanizada. FUNDACIÓNHOSPITALSANPEDRO1886-2013 “UNAOBRADEFEYPERSEVERANCIA” “Fundación Hospital San Pedro, una organización eclesial católica que humaniza evangelizando” 42
  • 38. Personal Estación de Observación Sala de EsperaEstación de Autorizaciones A partir de febrero de 2012 hemos transformado nuestro Hospital con las siguientes obras: BLOQUE ANTIGUO Se sometió a un “Reforzamiento estructural y Reorganización Físico Funcional”, en el componente de reducción de vulnerabilidad sísmica (ejecutada en un 100%) y reorganización médico arquitectónica de su infraestructura, siguiendo las políticas establecidas por la Organización Mundial de la Salud (OMS) y por la Organización Panamericana de la Salud (OPS) de hospitales seguros. Estación de Admisiones •1 sala de reanimación simultánea para dos pacientes.• Ampliación del área de 400 mts2 a 1.400 mts2. •Área de observación para 65camillas de última tecnología. • 3 estaciones de enfermería. •4 salas de pacientes aislados. •Salas de procedimientos asépticos y sépticos. • 1 depósito de dispositivos médicos. • Baño para paciente intoxicado. • Sala de yesos. • Bodega de insumos. • 3 consultorios médicos yTriage, entre otros. • Laboratorio Clínico: Ampliacióndeláreade145mts2a397mts2. • Banco de Sangre:Ampliacióndeláreade78mts2a150mts2. • Patología, Unidad de Investigación y de Oncohematología:Ampliacióndeláreade58,5mts2a129,4mts2. “Con el paso del tiempo nos convertimos en un Hospital Moderno que avanza, crece y cuida la salud de Nariño y del sur occidente colombiano” PRIMER PISO (REMODELACIÓNTOTAL) SEGUNDO PISO NUEVA ÁREA DE URGENCIAS Hacen parte del bloque antiguo:
  • 39. * Con habitaciones unipersonales y bipersonales de 30 mts2 dotadas de camas eléctricas, closets individuales, baños individuales con servicio de agua caliente, sistema de oxígeno en red, sistema de presión negativa, sistema moderno y digital de llamado de enfermería, televisores de alta definición, sofá cama para acompañante, entre otros. * En este piso se incrementó el número de habitaciones de 15 a 22 habitaciones disponibles y pasó de una capacidad de 19 a 38 camas. * Con habitaciones unipersonales y bipersonales de amplios espacios dotadas de camas eléctricas, closets individuales, baños individuales con servicio de agua caliente, sistema de oxígeno en red, sistema de presión negativa, sistema moderno y digital de llamado de enfermería, televisores de alta definición, sofá cama para acompañante, entre otros. * Se incrementó el número de habitaciones de 7 a 15 habitaciones disponibles y adicionalmente una (1) habitación múltiple para cuidados intermedios de gineco obstetricia, para una capacidad de 32 camas. Habitación Unipersonal Habitación Bipersonal Estación de Enfermería Estación de Enfermería “La Fundación Hospital San Pedro con tecnología de última generación, cuida la vida con humanismo y calidad” TERCER PISO HOSPITALIZACIÓN CUARTO PISO HOSPITALIZACIÓN 44
  • 40. Vista de Circulación Interior Habitación Unipersonal Vista de Circulación Interior Estación de Enfermería •Edificaciónconunáreadeocupaciónde950mts2aproximada- mente, con tres niveles y proyectada para cinco. • El primer nivel alberga servicios de archivo central, cocina, preparación de alimentos, bodegas y cuartos fríos. • El segundo y tercer nivel presta el servicio de hospitalización con 50 habitaciones unipersonales. • Todas las habitaciones de hospitalización están dotadas de camas eléctricas, baño privado, agua caliente, sistema de oxígeno en red, sistema de presión negativa, sistema moderno ydigitaldellamadodeenfermería,televisordealtadefinición, cómodo sofá cama para acompañante, entre otros. •Habitacionesdotadasdelasmejorescaracterísticasambien- talesytecnológicas,conundiseñoamplioyconfortable. NUEVO BLOQUE DE HOSPITALIZACIÓN
  • 41. ÁLVARO GÓMEZ HURTADO PROMOTOR DE LA ELECCIÓN POPULAR DE ALCALDES 46
  • 42. a elección popular de alcaldes nació de la necesidad de profundizarlarepresentaciónpopularyladescentralización política, que interpretara fielmente la inteligencia iluminada de Álvaro Gómez Hurtado y se hizo realidad en el gobierno de Belisario Betancourt. Ese egregio conductor de multitudes logró enmendar la estructura vertical de la Constitución Política de 1886 para que el pueblo eligiera libre y soberanamente, a quien oriente los destinos del municipio. La arquitectura jurídico política culminó cuando la Asamblea Nacional Constituyente, presidida por Álvaro Gómez, Horacio Serpa y Antonio Navarro, decidió poner en vigencia la elección popular de gobernadores, integrando así dos paradigmas que han fortalecido la democracia Colombiana. Al cumplirse veinticinco años de la elección popular de alcaldes rendimos un sentido homenaje a su promotor el doctor Álvaro Gómez Hurtado, a quien de veras le cabía el país en la cabeza. Era un ser humano excepcional, con cerebro para pensar sin límites, corazón dispuesto a sentir el palpito del pueblo, manos para construir el futuro de Colombia, ojos para mirar lejos y muy alto, y capacidad intelectual y política para señalar senderos de reconciliación y de paz en favor de nuestros compatriotas. A Gómez Hurtado sí se le puede y debe reconocer su grandeza. Fue testigo directo del inicio de la convivencia entre los colombianos, cuando se selló el pacto del Frente Nacional, rubricado por dos figuras estelares de la política, Alberto Lleras Camargo y su padre Laureano Gómez Castro. A pesar de haber sido derrotada su aspiración presidencial en tres ocasiones, jamás claudicó. Él, como Bolívar, expresaría ¨que el arte de vencer se aprende en las derrotas¨. Por ello, siempre fue triunfador en el plano ideológico, sus planteamientos eran de inigualable factura, conocía con profundidad la historia de Colombia y América y el talante de su personalidad, permitió calificarlo como un hombre público de carácter y visión internacional. Como periodista, Álvaro Gómez Hurtado aprendió de Jefferson, que más vale una prensa sin gobierno que un gobierno sin prensa. Por eso, en el diario El Siglo, tribuna para difundir su pensamiento político,porelaltocontenidodialécticosuseditorialesconstituyeron verdaderas enseñanzas para que jefes y militantes se nutrieran de una fuente inagotable de conocimientos y profundo contenido doctrinario. Álvaro Gómez Hurtado siempre estuvo de cara al peligro y enfrentó los retos que le generaban su posición política y sus convicciones, muchas de las cuales se erigieron en principios tutelares del ideario conservador. Fue secuestrado en 1988 cuando salía del altar de la iglesia; al poco tiempo con varios temas propios de su identidad filosófico política, dejó impronta definitiva en la Constitución Política del 91 con lo que él llamaba ¨el acuerdo sobre lo fundamental¨. A pocos años, es vilmente asesinado cuando salía de la casa del saber, de la Universidad Sergio Arboleda, a la que tanto amó, después de dictar su última clase de historia a muchos discípulos que hoy son promesa real de la patria, a quienes con generoso corazón les repetía la sabia enseñanza de Cicerón, quien bellamente expresaba que ¨la historia es la madre de la vida, la antorcha de la verdad y la testigo de las edades¨. Por ahora, con las anteriores palabras, celebramos las bodas de plata de la elección popular de alcaldes e invitamos a estos funcionarios, a servir al pueblo cada día más y de mejor manera para honrar la memoria del cimiento de esa reforma, ideólogo y conductor, Álvaro Gómez Hurtado. La efigie de este mártir de la democracia relumbrará en las páginas del conservatismo y de la historia de Colombia. POPULAR DE ALCALDES Por: Eduardo Enríquez Maya Senador de la República 25 AÑOS DE ELECCIÓN PROMOTOR ÁLVARO GÓMEZ HURTADO
  • 43. www.dantoniovillota.com dantoniovillota@hotmail.com Galeria, taller de arte y marqueteria D. Antonio Villota Marquetería nacional e importada CARRERA 25 # 14 – 12 CENTRO Cel: 300 285 38 12 316 799 59 92 Un lugar lleno de color, expresión, variedad en técnicas; que aproximadamente hace cuatro años existe en la ciudad de Pasto. Dario Villota realiza sus obras y las ofrece al público en general. Trabaja técnicas como es oleo sobre lienzo, con distintos asuntos temáticos, también vitrales con motivos exclusivos, espejos con vitral y vitrales para decoraciones y para ambientar espacios. Calle 14 Calle 15 Carrera25 Cruz Roja Galería y taller deArte
  • 44. Es una muestra pictórica que surge a partir de una necesidad de representar algunos imaginarios que las personas percibimos en la noche, en los paisajes urbanos, en los colores que la naturaleza nos brinda. Supuestos imaginarios, no es ni una ilusión ni tampoco una fantasía, es una realidad. Dario Villota prepara su nueva exposición. La treceava en su carrera artística titulada“supuestos imaginarios” que la va a exponer en la pinacoteca departamental y posteriormente en su galería de arte. Los esperamos.
  • 45. Laura Enríquez Erazo Pasto Comunicación Social Universidad Santiago de Cali María Alejandra Cabrera Muñoz Pasto Colegio Champagnat PATROCINADOR OFICIAL DE LA MODELO ELITE NARIÑO - EDICIÓN JULIO 2013 -
  • 46. Angie Guativa Melo Pasto Comunicación Social Universidad Santiago de Cali Cinthya Carolina Ruiz Barco Sandoná PATROCINADOR OFICIAL DE LA MODELO ELITE NARIÑO - EDICIÓN JULIO 2013 -
  • 47. Mayeli Valencia Calderón Cumbitara Técnica Laboral en Salud Oral Ana Soledad Garzón Zambrano Pasto Universidad Mariana PATROCINADOR OFICIAL DE LA MODELO ELITE NARIÑO - EDICIÓN JULIO 2013 -
  • 48. ”TODOS POR IPIALES”. con el respaldo popular y las buenas relaciones con gobernantes, parlamentarios, concejo y comunidades indígenas, se logró importantes resultados para el desarrollo del municipio de IPIALES. UN TRABAJO SILENCIOSO, PERO FIRME DEL ALCALDE DE IPIALES Panorámica de Ipiales “Ciudad de las Nubes Verdes” l doctor DARÍO VELA DE LOS RÍOS, Alcalde de Ipiales, así reveló su gestión y expresó su satisfacción a la revista ELITE NARIÑO: “Gracias a Dios y a la voluntad popular asumí el cargo de primera autoridad del Municipio, con el pleno convencimiento de que Ipiales está en permanente desarrollo y que por ninguna circunstancia éste debe detenerse. La construcción técnica del Plan de Desarrollo “Todos Por Ipiales 2012-2015”, que gracias al compromiso de los integrantes del Consejo de Planeación Municipal y el decidido apoyo de la mayoría absoluta de los señores Concejales del Municipio, fue aprobado, se convirtió en la carta de navegación que fijó el claro horizonte para el desarrollo planificado de Ipiales por parte de nuestra Administración. 60
  • 49. Nuestro Gobierno ha tenido un acercamiento permanente con los gobiernos Departamental y Nacional, con las autoridades de los Cabildos Indígenas del Municipio, con los señores Congresistas y las autoridades de la vecina República del Ecuador, hecho que ha facilitado la formulación de proyectos en todos los frentes del desarrollo y la inversión, aquí un reconocimiento a los equipos de trabajo de las diferentes entidades del Municipio que con gran compromiso y sentido de pertenencia con mi gobierno, dedicaron el tiempo suficiente para que hoy más de cincuenta proyectos estén radicados ante el gobierno departamental, nacional y ONG´S como solicitud de inversión para el Municipio. Hemos realizado el seguimiento y la gestión permanente a los proyectos que se han presentado, de lo cual tenemos importantes resultados que hoy nos acercan a cumplir casi un 35% de lo consignado en el Plan de Desarrollo del Municipio. Mi compromiso es seguir trabajando para que en el año 2015 cuando termine mi periodo de gobierno, el balance sea altamente positivo y de satisfacción por el cumplimiento de las expectativas y de los compromisos asumidos con la comunidad” DARÍO VELA DE LOS RÍOS, Alcalde de Ipiales
  • 50. La Administración Municipal Todos por Ipiales, está empeñada en seguir el camino que se ha trazado durante los últimos años, continuar construyendo ciudad para beneficio de todos quienes habitan este rincón de la patria Colombiana. En esta primera etapa de Administración Municipal, Ipiales ha logrado grandes transformaciones, que la han acercado al propósito de brindar progreso y desarrollo a la comunidad, se ha comenzado a mostrar el trabajo, que de manera silenciosa pero con pasos firmes, se desarrolla en estos meses de gobierno. OBRAS PARA GRANDES TRANSFORMACIONES Dentro de estas obras se destaca: la construcción de la Casa de Justicia en el lote donde funcionaba la Plaza de Mercado los Mártires; la remodelación del CAI y construcción del Salón Múltiple en el barrio Champagnat; la Red de Alcantarillado de la Urbanización Montecarlo – Jardín Social; construcción de Alcantarillado en la Urbanización Prados Andinos; Alcantarillado de la Vereda las Cruces segunda etapa, Construcción del Box Coulvert en la vereda las Animas, la Construcción de la Batería Sanitaria del Centro Educativo Chácuas; Acueducto en la Vereda Yanalá Centro; construcción de Acueducto y Alcantarillado corregimiento Cofanía Jardines de Sucumbíos y de la Vereda Chaguaipe. Parque principal corregimiento LA VICTORIA Mandatario local atendiendo las inquietudes de la comunidad Alcalde de Ipiales Trabajando de la mano con la comunidad 62
  • 51. Optimización del Alcantarillado de la carrera 3ª primera etapa; construcción del Parque en el Centro Poblado del corregimiento de la Victoria; rehabilitación de la vía Puente Nuevo – Teques – Pulcás, muro de contención – ampliación de la banca y alcantarillado y la construcción del acueducto en la vereda la Floresta del Municipio de Ipiales, la puesta en funcionamiento de la nueva Plaza de Mercado Minorista, la construcción del CAI del Barrio Totoral entre muchos otros proyectos. Gracias a la incansable Gestión del Alcalde Darío Ignacio Vela De los Ríos, el Gobierno Nacional ha presupuestado para la vigencia 2013, la suma de $20 mil millones de pesos para avanzar en la consolidación del proyecto de ampliación de la pista del aeropuerto San Luis que lo convertirá en un aeropuerto internacional situación que traerá gran desarrollo no solo para la región sino también para el Departamento de Nariño. Con el apoyo del Gobernador del Departamento y la mayoría de la bancada de parlamentarios nariñenses, se asumió el compromiso de incluir para la vigencia 2.014 la suma de $20 mil millones de pesos más en el presupuesto nacional para la puesta en marcha del proyecto. Se está cumpliendo con el compromiso de ofrecer bienestar a la comunidad en varios sectores como salud, educación, atención a los adultos mayores, a la mujer, en materia deportiva, de prestación de servicios públicos, movilidad y atención a la población vulnerable. En Educación se destaca el logro de la Secretaría de Educación Municipal al alcanzar la certificación de Icontec y obtener en el último mes el primer lugar dentro de las Secretarías de Educación certificadas del país, al cumplir con el objetivo de ofrecer educación de calidad a todos los niños y jóvenes ipialeños. “Ipiales somos todos” plaza de mercado minorista (exterior) “Ipiales somos todos” plaza de mercado minorista (interior) Construcción CAI barrio Totoral
  • 52. La Administración Municipal Todos por Ipiales, se prepara para adelantar proyectos tales como la Construcción del Teatro Municipal, con una inversión de 1.200 millones de pesos; concretar el proyecto bandera de la actual Administración la Universidad Pública de la Frontera, que cuenta con el apoyo de la Gobernación de Nariño y los Municipios de la Provincia de Obando; la construcción de un moderno cuartel de Policía donde además funcionará la SIJIN y las oficinas de la Interpol. Así mismo, se proyecta el Centro Mixto de Atención y Rehabilitación de Consumidores de Drogas y Alcohol, la adecuación, remodelación y mantenimiento de nuestros escenarios deportivos, la infraestructura educativa tanto en el sector urbano como rural del Municipio, la construcción del Centro Vida para los adultos mayores. Se destaca la futura Construcción del Centro Comercial Gran Plaza Ipiales, proyecto que gracias a una serie de gestiones, muestra la fortaleza como ciudad fronteriza para la inversión del Sector Privado. El Centro Comercial Gran Plaza, Ipiales será construido en las instalaciones de la antigua Bavaria, con un gran impacto en la generación de empleo directo e indirecto, comercio, y desarrollo en general. De igual manera el Municipio ha dispuesto lo necesario para que se construyan 636 soluciones de vivienda como parte del proyecto de construcción de viviendas de interés prioritario del Gobierno Nacional. PROYECTOS FUTUROS María Cristina Sánchez (Secretaria de Educación) Darío Ignacio Vela de los Ríos (Alcalde) El alcalde de Ipiales apoya la niñez a través del deporte Myriam Ortiz De Vela (Gestora Social), Juan Manuel Santos (Presidente de la Republica), Darío Ignacio Vela De Los Ríos (Alcalde Ipiales) 64
  • 53. Gabinete Municipal Alcaldía de IPIALES El compromiso de la Administración Municipal Todos por Ipiales, es y seguirá siendo llevar a la comunidad todo su esfuerzo por lograr el bienestar común, por lo que se adelanta toda clase de gestiones ante el Gobierno Departamental y Nacional para obtener los recursos y el apoyo necesario para hacer realidad el Plan de Desarrollo Municipal “Todos por Ipiales” 2012 – 2015.
  • 54. NAVEGACIÓN Por: Carlos Alvarez León A VELAEN LA COCHA La laguna ofrece a nativos y foráneos perspectivas para la práctica de actividades náuticas a Cocha, laguna ubicada en el corregimiento de El Encano, municipio de Pasto, ofrece perspectivas inigualables para muchas actividades náuticas que hasta hoy han sido desaprovechadas. Entre ellas el deporte de la “navegación a vela”, que aunque hay varias personas que lo practican, todavía es necesario que se popularice y esté al alcance del que quiera sentir las emociones de ser impulsados por el viento de una manera silenciosa, emocionante y sin la contaminación que causan los motores fuera de borda. 66
  • 55. Hace algún tiempo un grupo de buzos experimentados exploró el fondo del lago, encontrando una gruesa costra de aceite y desperdicios de combustible totalmente atentatorios a la ecología y al desarrollo de peces y por supuesto de la fauna silvestre acuática. Pero lo más interesante al respecto, es que allí se construyen embarcaciones a vela de varios tamaños y características, las cuales han sido llevadas a otras zonas del país como el lago Calima en el Valle, sin que se haya despertado el interés de éste deporte en Nariño, que en otras partes tiene entusiastas practicantes que aprovechan lo que la naturaleza nos ofrece. Por falta de divulgación en nuestro medio, se piensa que un velero es costoso; pues no, ya sea que se lo arme en madera por artesanos que han aprendido a construirlos o quesebusqueunveleritopequeñoenfibradevariasclases como los Snipe, Lightning, Cadet y muchos otros como los que navegan en los lagos de la Sabána de Bogotá, Calima en el Valle, el Peñol cerca de Medellín o en la represa del Huila, se consiguen a precios muy accesibles para la mayoría de la gente. Para los jóvenes de todos los estratos constituye una actividad deportiva que reviste emoción y los aleja de actividades no deseables, máxime cuando a 30 minutos de Pasto se encuentra una maravilla de la naturaleza que nos llama para que disfrutemos de ella sin la menor degradación ambiental. Desde la revista ELITE NARIÑO, hago una cordial invitación, particularmente a la juventud para que se interese en la navegación a vela, siendo en otras partesundeportemuypopularyalalcancedetodos.
  • 56. TUMACOTUMACOLABELLEZANATURALYELENCANTODESUSMUJERESLABELLEZANATURALYELENCANTODESUSMUJERESLABELLEZANATURALYELENCANTODESUSMUJERES 68
  • 57. PUERTO DE ENCANTO, QUIEN LLEGA AQUÍ SE QUEDA UNPARAISOENTREBRISA,PLAYAYMAR UMACO puerto de oro, pueblo de encantos y de embrujos. Cargado de historia, cultura arqueológica que con su biodiversidad impresiona y motiva a soñar al nativo, turista y extranjero e invita a explorar, convivir y aprovechar las múltiples maravillas de su entorno y los exóticos campos que le ofrece la naturaleza, como el clima, brisa, playa y mar. Quienes llegan a este paraíso disfrutan del calor humano, del bullicio de su gente y admiran la belleza de la mujer costeña que engalana la cálida ciudad y el paisaje del litoral pacífico de Nariño. SanAndrésdeTumaco,formapartedelacosta andina nariñense, habitada en sus tiempos primitivos por los indígenas “Tumaco” en la desembocadura del río Mira y fue fundada el 30 de noviembre de 1.640, por el padre jesuita Francisco Ruggy, fecha ratificada mediante acuerdo por el Concejo Municipal. DESCUBRAMOS LA NUEVA FACETA DE TUMACO En la actualidad es una ciudad acogedora y de gran ambiente. Con un clima que oscila entre los 26 a 28 grados, se encuentra a 3 m.s.n.m., una población aproximada a 180.000 habitantes, distante a 280 kilómetros de Pasto por carretera pavimentada. Tiene una estructura de comunicación terrestre, área y marítima que permite abrir puertas sobre el pie de monte costero, ciudades colombianas y del Continente Americano para descubrir nuevos horizontes y dejar huellas de la capacidad profesional, intelectual y del talento deportivo, como lo hacen grandes figuras Tumaqueñas a nivel nacional e internacional. Riqueza marina Atardecer en las playas de TUMACO
  • 58. 70 En Tumaco existen pintorescos lugares para visitar, como la isla del Morro, Bocagrande, el parque natural Sanquianga, riveras de los ríos: Mira, El Patía, Mulatos, Vigía sobre el río Tapaje y las playas de Punta Cascajal. También son muy atractivos los senderos de la playa del Morro, El Bajito, El Puente del Morro, el Parque Colón, Centro Recreacional Casa Verde y el Centro recreacional Chilví. Lo apasionante es contemplar a plenitud la gran perla del mar, donde bordean sus aguas y descansan en la lontananza. Allí el navegante de la barca o quien rema la canoa, con el vaivén de las encrespadas olas y con el cielo azul que lo cubre, conjuga la idea en la inspiración de una poesía o la tonada de la canción alusiva al aventurero viaje por el océano. En las amplias y acogedoras playas bajo la sombra de las palmeras, los turistas y nativos viven la vida de un sueño del ideal esparcimiento en el campo natural, como de la infraestructura hotelera, confortables servicios de restaurantes, atención y excelente cultura de sus propietarios. El núcleo humano está conformado por familias procedentes de diferentes regiones del mundo matizados entre blancos mestizos, indígenas y afro colombianos, donde todos comparten la convivencia ciudadana, costumbres y cultura sin distinciones, ni preferencia alguna. Solo hace falta que el Gobierno Nacional invierta en la industria del turismo, riqueza sin explotar. Ojalá Dios ayude y haya voluntad política para constituirlo a Tumaco en “Distrito Turístico de Colombia”, porque quien llegue a Tumaco aquí se queda. Avistamiento de Ballenas Avistamiento de distintas clases de aves Avistamiento de distintas clases de Aves
  • 59. EN TUMACO, HAY TRES TESOROS POR DESCUBRIR NATURALEZA a Administración Municipal de Tumaco por intermedio del alcalde Victor Gallo Ortiz y con el apoyo de Bibiana Prado, directora de Corpomarimba y Liliana Churta, directora de Turismo, gestionan proyectos de desarrollo cultural y turísticos para demostrar a Nariño y Colombia la nueva imagen y la faceta positiva del puerto Tumaqueño, con el objeto que cuando el turista llegue a la región se encuentre seguro y disfrute a plenitud de la naturaleza, cultura y gastronomía regional los “Tres Tesoros por Descubrir” que muchos desconocen. Es una de las grandes riquezas que tiene el territorio de Tumaco que perdura sin la explotación técnificada y adecuada. Cuenta con montañas primarias, manglares y mucha flora. Para conocer las maravillas de la naturaleza se debe recorrer los sitios y senderos de las islas, morros, playas y riveras de la hidrografía del litoral. Riqueza Vegetal Para la gastronomía, se cuenta con las mujeres más hábiles en la culinaria y preparación de comidas típicas y ancestrales con sus mejores sabores y condimentos naturales, exclusivos del secreto y receta de la cocina regional. Preparan los exquisitos platos para todos los gustos: Encocado de cangrejo, encocado de camarón, encocado de pescado, sancocho de pescado, arroz con coco, pusandao, tapao de pescado, seviche de camarón y concha y arroz marinero. Todas estas delicias gracias a las riquezas marinas del mar pacifico. GASTRONOMÍA Gastronomía
  • 60. Son diferentes eventos de cultura que se festejan en la Perla del Pacífico y que vale la pena recordar, para visitar y recordar las inolvidables fechas: En febrero, el carnaval del fuego; Semana Santa; en mayo Semana de la Afrocolombianidad; julio, festival del mar; julio, agosto y septiembre, avistamiento de ballenas; en agosto, festival del viento; septiembre, día Mundial del Turismo; del 17 al 30 de noviembre, Juegos del Litoral y cumpleaños de Tumaco. FECHAS PARA RECORDAR Vitrina Nacional de Anato, evento realizado en Bogotá. En la fotografía de izquierda a derecha, Liliana Churta, directora de Turismo de Tumaco; Katty Ibarra, reina del Carnaval; Victor Gallo Ortiz, alcalde de Tumaco; Alexandra Becerra, directiva Corferias Bogotá y Silena Dajome Palacios, gestora Social. 72 CULTURA En cuanto a la cultura el municipio ha logrado importantes espacios en el territorio nacional e internacional a través de grupos musicales y danzas que con bailes, ritmos y tonadas han conquistado el prestigio, logrando galardones y regando el buen nombre de Tumaco. En los dos últimos años han participado en el festival de música del pacífico Petronio Álvarez. Con los grupos Changó y Cueros y Chonta representarán al departamento de Nariño en el Festival del Caribe, programado para el próximo julio del 2013 en la ciudad de Santiago de Cuba. Así mismo se preparan para nuevos eventos culturales, otros grupos de prestigio, como Semilleros del Pacífico. Cultura y Naturaleza
  • 61. aDirectoraGeneraldelSENAGinaParody,visitóalmunicipio deTumacodondeconocióyratificóelcompromisodeapoyar elproyecto de la Escuela Binacional de Emprendimientopara el Desarrollo de la Pesca, Acuicultura y Maricultura. Además, tuvo un encuentro con aprendices e instructores del Centro Agroindustrial y Pesquero de la Costa Pacífica, donde se comprometió a desarrollar acciones que permitan la calidad de la formación del trabajador. Así mismo, realizó un recorrido por los ambientes donde se evidenció los avances de investigación en el tema ambiental con la elaboración de aceites, aromatizantes y repelentes a base de plantas como también el desarrollo acuícola. Gina Parody manifestó, “que en Tumaco lo que haga el SENA en formación debe ser para el trabajo, es fundamental que cada vez tengamos más pertenencia, que el SENA este acorde al desarrollo de la región y por lo tanto esa es la oferta que debemos estar dando”, añadió, que la Entidad se encuentra preparada para cualquier tipo de formación que demanden las empresas en Nariño. En el encuentro con aprendices la Directora General anunció que con apoyo del Presidente de la República Juan Manuel Santos, se tendrá un plan padrino para todos los aprendices que en deportes o actividades culturales estén triunfando y dejando en alto el nombre de Colombia y son talento SENA para que tengan un apoyo económico. A través del compromiso se logrará fortalecer esta Entidad patrimonio de Colombia y la misión es reforzarla en presupuesto y calidad y que sean más de 7 millones de colombianos los que se formen para el trabajo. Gina Parody directora general del SENA (centro), visitó las instalaciones del Centro Agroindustrial y Pesquero de la Costa Pacífica, donde evidenció el desarrollo investigativo de aprendices e instructores en compañía de Andrés Fajardo, funcionario Centro Agroindustrial y Pesquero de Tumaco; Sara Ángela Arturo Gonzales, Directora Regional de Nariño; Libia Mercedes Ramírez, Centro Sur Colombiano de Logística Internacional de Ipiales y Jairo Lasso Medina, Centro Internacional De Producción Limpia LOPE - Nariño. DirectoraGeneraldelSENAcomprometida coneldesarrollodeTumacoyNariño
  • 62. Nuestra Misión Proporcionar a nuestros huéspedes y visitantes una experiencia inolvidable de confort, placer natural y aventura, donde Su Satisfac- ción sea nuestro mejor referente. Nuestra Visión Contribuir al fortalecimiento del turismo en el pacifico sur en las playas de Bocagrande, y los proyectos productivos de la región. Aportando de esta manera con nuestro grano de arena para convertir esta hermosa y paradisíaca playa ecoturística de San Andrés de Tumaco. Hotel María del Mar se caracteriza por tener playas privadas, a solo 20 minutos de Tumaco, con un ambiente familiar y descanso absoluto. Contamos con servicios como: Restaurante, Bar, Discoteca, Playa Privada junto a Cómodas Cabañas.
  • 63. Reservas: Av. La Playa, diagonal al colegio I.T.P.C. (cescat) Tel. (2) 727 64 99 Cel. 318 699 99 72 e-mail: hotelmariadelmar@live.com TUMACO, NARIÑO Reservas: Av. La Playa, diagonal al colegio I.T.P.C. (cescat) Tel. (2) 727 64 99 Cel. 318 699 99 72 e-mail: hotelmariadelmar@live.com TUMACO, NARIÑO Ubicado en el antiguo Bocagrande a 20 minutos deTumaco, Haciendo un recorrido en lancha por manglares de belleza sin igual Avistamiento de ballenas: julio - agosto - septiembre Marcamos la diferencia porque estamos en medio de la naturaleza, el arruyo de las olas y el canto de las aves
  • 64. TERRITORIO DE GRANDES PROYECCIONES CIUDAD DULCE DE COLOMBIA, VISTA PANORÁMICA SANDONÁ 76
  • 65. IMPORTANTES PROYECTOS SE EJECUTAN EN SANDONÁ, HABRÁ VIVIENDA GRATIS Y PROYECCIÓN DEL TELEFÉRICO, SUPERADA CRISIS FINANCIERA DEL ANTERIOR GOBIERNO on recursos propios, regalías y cofinanciación con el Gobierno Nacional y Departamental, se construyen importantes obras que contribuyen al desarrollo del municipio de Sandoná, venciendo así las dificultades presupuestales y crisis económica encontrada a 31 de diciembre del 2011 por el déficit financiero dejado del anterior alcalde municipal. Así se conoció en la rendición de cuentas del año 2012, realizadapúblicamenteporelactualalcaldeCamiloGómez Montero, quien con colaboradores de la administración municipal, procedieron de inmediato a buscar alternativas de solución para amortizar los pagos de la deuda del municipio que se debía por diferentes conceptos. Luego el Alcalde Gómez Montero inició con una incansable labor presentando proyectos para vías y vivienda, gestionó ante el Departamento y Nación, recursos de inversión en obras de infraestructura, saneamiento básico, educativo, salud y de apoyo a los programas sociales, beneficiando a 29.360 habitantes tanto del casco urbano como de los ocho corregimientos incluidos sus 22 veredas del territorio de Sandoná. CAMILO GÓMEZ MONTERO, Alcalde de Sandoná
  • 66. Entre los proyectos de mayor impacto y recibido con beneplácito en Sandoná, como en todos los municipios del occidente de Nariño, fue la aprobación del Presidente Juan Manuel Santos de 4.000, millones de pesos para la carretera Circunvalar al Galeras. Igualmente, el ex-Ministro de Vivienda, Germán Vargas Lleras, firmó el proyecto de construcción en Villa Cafelina para 218 viviendas gratuitas destinadas a familias pobres que no tienen techo. Y la otra obra que llamará la atención y de mucho interés general, será la instalación del Teleférico Artesanal sobre la cascada de Belén, proyectada por la actual administración, con el fin de aprovechar el clima, la belleza paisajista para fomentar el turismo, generar empleo y dividendos económicos al Municipio. Construcción de 218 Viviendas Gratuitas Proyecto de Instalación del Teleférico Artesanal con acceso a la Cascada de Belén Proyectos que generan empleo 78
  • 67. GESTIÓN DE PROYECTOS * Asignación de subsidios con el fin de favorecer a las familias sandoneñas. * Proyecto de la línea de conducción para el abastecimiento del acueducto urbano del municipio de Sandoná. * Contratación de la interventoría por valor de $29.000.000 ante el Plan Departamental de Aguas. * Proyecto de reformulación de la línea de conducción por valor de $276.000.000 (Gobernación de Nariño). * Se presupuesto contablemente $21.000.000 para la legalización de los permisos de servidumbre por donde atraviesan la línea de conducción EMSAN. Proyectó la legalización de 218 matrículas para la disponibilidad de acueducto y alcantarillado para el proyecto de Villa Cafelina. * Aprobación por Corponariño del plan de cierre del relleno sanitario por valor de $49.000.000. * Gestión ante el Ministerio de Vivienda, el convenio para ejecución de la fase 1 de alcantarillado urbano por valor de $1.130.000.000. * Consultoría para la fase 2 del alcantarillado del casco urbano por valor de $87.000.000. Estudio de construcción de Box Coulvert, ante el Plan Departamental de Aguas por 20 mil millones de pesos. * Se logró restablecer el servicio de aseo para el Corregimiento del Ingenio. * Convenios con instituciones educativas para compromiso ambiental y social. * EN EL SECTOR PRODUCTIVO: $ 3.200 millones de pesos, distribuidos así: * Para los Cañicultores $ 2.141 millones y Cafeteros 1.059 millones de pesos. * INVERSION EDUCATIVA de 2.000 millones de pesos, destinados a la construcción del Centro de Estudio Superior Regional y seis aulas escolares. Recursos de ciencia tecnología e innovación por 970 millones de pesos para la Granja Ospina Pérez, financiados con la Federación de Cafeteros con la dependencia de Cenicafé. * Para atender en el campo de LA SALUD, el valor de 1.500 millones de pesos y * Hospital Clarita Santos $ 1.200 millones. Así mismo para mejoramiento de la infraestructura, sala de urgencia y dotación del Hospital Clarita Santos, asignados por regalías 2.240 millones de pesos. * MEDIO AMBIENTE $ 1.500 millones: Páramo de San Germán $ 900 millones y para la Reforestación de la cuenca del Ingenio entre los tres municipios vecinos. * En construcción del Puente El Ingenio $480.000.000. * Mantenimiento de vías terceáreas: San Bernando-Guaitara y San Francisco Chaves-Partidero. * Convenio INVIAS-Federación de Cafeteros La Regadera-San Miguel. * Mantenimiento de vías San José-Santa Rosa-Circunvalar; Bomba San Francisco - * San Gabriel La Joya; Barrió Porvenir vía Ancuya hasta La Mina y Puente Care Perro - * San Isidro por $101.000.000. Para el mejoramiento de la vía a San José $ 6.000.000 y reformulación del trazo y apertura de la vía Chávez-Cocha-Chupadero-Dorada Guatarilla. VÍAS En la titánica gestión ante los Ministerios, Presidencia de la República y Gobernación de Nariño, el odontólogo Camilo Gómez, alcalde de Sandoná, logró la consecución de aportes económicos y aprobación de importantes proyectos destinados a varios sectores de la administración que se ejecutarán en la vigencia 2013 y continuarán en los años siguientes, así:
  • 68. GESTIÓN DE PROYECTOS SANEAMIENTO BÁSICO Y AGUA POTABLE * Construcción bocatoma principal Rio Ingenio para abastecimiento de la cabecera municipal. * Construcción y mejoramiento de bocatomas: Santa RosaCentro–Saracocho–La Joya–San Pablo- Vergel–Alto Jiménez–San Bernardo–Guaitara–Santa Rosa Alto–San Gabriel La Joya–Guarango DEPORTES * Gradería del estadio municipal, 236 millones convenio entre FONADE y Municipio. * Recuperación del Estadio Cañaveral: 28 eventos y campeonatos deportivos en las diferentes categoría y disciplinas. SERVICIOS PÚBLICOS *El doctor Camilo Gómez Montero, con el objeto de hacer conocer del Concejo Municipal y comunidad sandoneña sobre la verdadera situación de la Empresa de Servicios Públicos, resume en tres puntos básicos:Estado en el que se recibe la empresa, Gestión de proyectos y aspecto financiero y contable. VIVIENDA * Construcción de 218 viviendas gratuitas enVilla Cafelina, convenio entre el Ministerio de Vivienda y el Municipio de Sandoná. Más 60 viviendas para el sector cafetero,convenio Banco Agrario, Ministerio de Agricultura y Gobernación de Nariño; 40 viviendas destinadas a otras familias con el Banco Agrario; 349 viviendas para los afectados por ola invernal,convenio ComfenalcoValle; mejoramiento de 276 viviendas, ejecutadas por el Minuto de Dios, financiado con ayuda internacional y se ha generado mas de 400 empleos directos. La fertilidad de su tierra. El Ingenio, Sandona PROGRAMAS DE APOYO * Familias en acción: incremento de cobertura de 947 familias. * Adulto mayor: se incrementaron 77 cupos con un subsidio bimensual de $130.000 * Centro de estudio Regional de Educación CERES, se logro 22 carreras entre Profesionales yTecnológicas. * Se logro subsidio de $ 654.400 semestrales por estudiantes con ICETEX, 57 créditos y 900 millones de pesos para aulas y dotación. * 4.000 kid escolares a la fecha para el mejoramiento de la calidad Educativa. 80
  • 69. ASÍ EL MUNICIPIO DE SANDONÁ SE ENRUMBA POR BUEN CAMINO (De izq. a der. Abajo) Yuli Chávez, Jesica Rodríguez, Yaneth Rodríguez, Jazmín Nataly Medina, Milena Pantoja, Catalina Mera Jirón, Nery Fajardo, ALCALDE, Alejandra Rodríguez, Ruth del Carmen Rodríguez, Janeth Burbano, Arelis Peña, Yuli Martínez. (De izq. a der. Arriba) Julieth Ojeda Andrade, Diana Paola Ibarra, Zulma Patricia, Jorge Díaz, Jorge Zambrano, Guillermo Cabrera, Álvaro Morillo Zambrano, Mario Alberto Melo, Alonso Carlosama, Adriana Cerón Mora, Sonia Fajardo Rojas, Neire Martínez. (De izq. a der. Atrás) Fernando Fajardo, Harold Córdoba, Silvio Palomino, Lucio Rodríguez, Eduardo Leonel Erazo. La Empresa se recibió con problemas administrativos y financieros con un déficit de l7.000 millones de pesos a 31 de diciembre del 2011. Uno de los problemas que afecto a los sandoneños fue La mala formulación de los diseños del proyecto: OPTIMIZACION DE LA LINEA DE CONDUCCION PARA EL ACUEDUCTO URBANO DEL MUNICIPIODESANDONA, llevandoaquesesuspendieraelservicio de agua el 9 de septiembre de 2011, Para esta situación el alcalde municipal realizo formulación de los proyectos civiles estructurales e hidráulicosparalaconstruccióndelabocatomaparaelabastecimiento del acueducto urbano con una inversión de $30.000.000, logrando mejorar la calidad y continuidad de la prestación de servicios. Tampoco se reportó la información técnica, financiera, contable y administrativa ante la Superintendencia de Servicios Públicos domiciliarios, por esta razón tenemos una sanción de 25 mil millones de pesos. Y además el atraso de informes a la Contraloría Departamental de Nariño, Contraloría Nacional y a la Contaduría General de la Nación. En la actualidad gracias al gran trabajo de la Gerente de EMSAN, apoyo del Concejo Municipal y del Gobierno Local, se ha logrado superar las dificultades y tener un superávit de $ 188.000 y una utilidad contable de $ 27.454.000 millones.
  • 70. Cristo De Los Milagros De Sandoná - Nariño 82
  • 71. ELCRISTOMÁSGRANDE DE COLOMBIA Por: Sofonías Rodríguez Montezuma esde las cimas de las montañas emergen sobre el hondo azul del infinito las admirables improntas de la basílica de Nuestra Señora del Rosario, en el occidente de Nariño, donde la inquebrantable fe del pueblo sandoneño se inclina reverente ante la más portentosa imagen del Cristo de los Milagros, único en Colombia. El majestuoso Crucifijo, probablemente el de mayores dimensiones en nuestro país, se encuentra en la ciudad de Sandoná localizada en la zona occidente del municipio de Pasto, distante a 48 kilómetros de la capital nariñense. Según las dimensiones de la milagrosa efigie, parece no existir otrasemejanteenparroquiascolombianas,comolaimagenque veneran los devotos de Jesús Sacrificado. El imponente templo dondeselerindeculto,fueconstruidohacecincuentaaños,con materiales y piedras labradas, recuperadas de un monumento indígena.Hacia allá cada día aumenta la peregrinación, para adorar al Señor y darle gracias por los favores recibidos. El CRISTO DE LOS MILAGROS DE SANDONÁ, así lo llama la feligresía, es a quien diariamente le claman y elevan sus plegarias para que el DIOS de la vida les conceda la paz en sus hogares y que las proteja de todo peligro, especialmente de los fenómenos naturales, que tanto daño en vidas humanas y bienes materiales han causado en muchas regiones del país y del mundo. Y la comunidad católica aferrada a su credo, sigue convencida que sus plegarias son escuchadas por el Divino Redentor, para que los Sandoneños respiren el aire fresco de la paz y la tranquilidad. Don José (Chepe) Cerón, quien por varios años fue colaborador de la parroquia y que tuvo la oportunidad en aquella época de presenciar el acto de entronización de la hermosa imagen, es un fiel testimonio de lo acontecido. Próximaacumplircuarentaycincoañosdehaberarribado alaparroquiadeSandoná,esconsideradacomounaobra religiosamagistraltalladaporelmaestroAlfonsoZambrano Payán, la cual se constituye como el primer milagro para la comunidad cristiana de esta región, expresión que siempre usaba el desaparecido sacerdote Ángel María Araujo Aux, párroco en aquella época, que tuvo la suerte de recibir y luego acompañar la bendición de la imagen de Cristo por Monseñor Jorge Alberto Giraldo Restrepo, Obispo de Pasto.
  • 72. La señora Ernestina Montezuma recientemente fallecida, pariente cercana de don Lucio Meza Vargas, hijo ilustre de esta tierra, hombre piadoso y de excepcional generosidad, benefactor en “limosnear” a Cristo Crucificado, la considera histórica y de gran valor, para la comunidad de Sandoná. Según el testimonio de doña Ernestina, don Lucio tenía muchos deseos de dejar algún recuerdo a su pueblo natal. En aquellos tiempos él ya residía en la ciudad de Pasto, donde se reunió con su familia y la intención de regalar dinero para comida o ropa de los pobres, acogiendo la sugerencia de los suyos, terminó financiando el costo de la monumental obra religiosa, recuerdo que aún perdura en la gratitud y en la memoria de los sandoneños. Loquenadieseimaginó,decía su parienta,esque de un momento a otro como si el mismo Dios lo hubiese iluminado, don Lucio decidió regalar un Cristo Crucificado, para situarlo en el altar mayor o en una de las naves laterales. De inmediato se contactó con el maestro Alfonso Zambrano, considerado en Colombia, uno de los mejores artesanos en el tallado sobre madera quien se puso manos a la obra, advirtiendo que por las características del diseño sería una imagen hermosa de grandes dimensiones, pero eso sí más costosa. “Por ese trabajito, le dijo el escultor al señor Meza, le voy a cobrar sin rebaja $30.000”, cuyo equivalente hoy en día es aproximadamente de $ 30.000.000, al tiempo que el donante, le contestó: “No importa, hágalo por lo que sea, que es para mi pueblo”. Tanto esmero y tiempo le dedicó a la obra el maestro que luego de algunos meses, lo llamó para entregársela a entera satisfacción. Don Gilberto Burbano que era el sacristán de ese entonces, manifiesta que ha sido una de las mejores historias para la feligresía de Sandoná, cuando el párroco anunció que se aproximaba la llegada de la imagen y que era necesario estar preparados espiritual y físicamente para ayudar a cargar la monumental imagen del Cristo de los Milagros. Recuerda que para ese memorable 10 de diciembre de 1.967, la única volqueta que tenía el Municipioselaengalanócomounalujosacarroza, mientras los fieles lucían sus mejores atuendos en medio del regocijo general hasta que llegó la memorable fecha. Era una imagen inmensa esculpida en madera que mide 4 metros con 75 centímetros de alto, teniendo que acondicionarla para iniciar el desfile encabezado por el párroco, la comunidad y la participación de la Banda Santa Cecilia dirigida por el maestro Juan Castillo. Seis meses después, conmemorando el primer centenario de la parroquia, fue bendecida la imagen por Monseñor Jorge Alberto Giraldo Restrepo, Obispo de la Diócesis de Pasto. Como si hubiera sido ayer, don Gilberto no olvida que entre los inconvenientes que surgieron una vez se había llegado al templo, era que la corpulenta imagen no calzaba en el muro interior del Santuario, porque con la cruz medía siete metros por cuatro. Entonces dice que el sacerdote llamó a otro de los maestros de obra de Sandoná, Don Filemón Vallejo, quien llevó a su oficial Franco Delgado para que recortara parte del madero de la Cruz y así se logró su ubicación en el lugar apropiado. Cuarenta y cinco años después de llegada la milagrosa imagen, el fervor sigue incólume entre las gentes de la zona suroccidental de Colombia. El 2 de marzo del 2013 se realizó la primera peregrinación que con la anuencia de la Diócesis de Pasto, se aspira a institucionalizar anualmente, estimulando a su vez a Sandoná como destino turístico por su clima y belleza natural. LA HISTORIA Iglesia Parque de Sandoná 84
  • 73. l mutuo entendimiento entre los Gobiernos de Ecuador y Colombia ha permitido desarrollar seis importantes proyectos entre obras y acuerdos binacionales que fortalecen a los dos países vecinos, en infraestructura vial, financiación económica, mejoramiento en la atención ciudadana y la socialización de emigración de los dos países. Los resultados del trabajo colombo-ecuatoriano, son el fruto del esfuerzo de integración de los Jefes de Estado y también se debe a las buenas y magníficas relaciones que por primera vez en la historia se mantienen entre los Alcaldes Municipales y Cónsules de Ipiales y Tulcán, respectivamente. El doctor Nelson López Jácome, Cónsul del Ecuador en Ipiales, un incansable luchador por las obras sociales y relaciones internacionales, expresó a la revista ELITE NARIÑO su gran satisfacción por haber logrado los seis acuerdos binacionales, con positivos resultados para los dos países vecinos, así dijo: “Gracias a los esfuerzos de integración entre nuestros países, se logró dar inicio a la ampliación del puente internacional de Rumichaca; se hizó un acuerdo binacionaldehidrocarburos,quepermitequeelpetróleo colombiano utilice el oleoducto ecuatoriano para salir al Pacífico; se acordó un procedimiento de interconexión eléctrica entre Puerto Ospina y Puerto El Carmen; se firmó un memorando de entendimiento contra el tráfico ilícito de bienes culturales; se implementó el Centro Binacional de Atención Fronteriza (CEBAF), que entró en operación el 1 de abril y se lanzó la cartilla binacional de control migratorio”. SEISOBRASDEACUERDOSBINACIONALES SE DESARROLLAN EN LA FRONTERA COLOMBO - ECUATORIANA Nelson López Jácome, Cónsul del Ecuador en Ipiales
  • 74. retender que este deporte de conjunto sobre salieraconstantementeenelámbitonacional no sólo era difícil sino casi que imposible, y no precisamente por falta de material humano, sino por el poco apoyo y la mala organización para el fútbol en Nariño. Con la llegada del fútbol profesional a la ciudad de Pasto en el año de 1996, muchas fueron las puertas que poco a poco se abrieron para el futbolista de la región, quizá la más importante fue la de tener un punto de llegada después de un largo proceso de aprendizaje y perfeccionamiento propio de esta disciplina deportiva. Es menester entonces hacer un justo reconocimiento a un grupo de jugadores que en compañía de su cuerpo técnico, han dejado en alto la bandera de Nariño a través de este deporte. Dicho proceso comenzó a entregar resultados en el año 2011 cuando la Selección Nariño juvenil llegó a la final nacional de la categoría con sede en Pasto, sede que a propósito obtuvo Nariño, gracias al buen desempeño de su seleccionado en las fases eliminatorias. En aquella oportunidad llegó como uno de los favoritos pero como suele suceder en este juego “pinchó” en el camino y apenas obtuvo el quinto puesto, lugar que no empañó su buen rendimiento a lo largo del año. Posteriormente, y demostrando que lo obtenido en el año anterior no fue casualidad, logró una vez más y de manera consecutiva, llegar a la final nacional organizada por la Federación Colombiana de Fútbol esta vez con sede en Barranquilla, y aunque no logró el título, obtuvo un honroso segundo lugar detrás de Antioquia. En el presente año y ratificando su elevado nivel, llegó por tercera ocasión a la final con sede en Bucaramanga después de superar a difíciles rivales, una vez más era favorito pero lastimosamente no logro el objetivo. Pero lo más destacado de esta camada de buenos futbolistas que desde niños comenzaron a construir su carrera como deportistas, fue el haber conseguido la Medalla de Bronce en los pasados Juegos Atléticos Nacional con sede en Norte de Santander para este deporte, confirmando que cuando las cosas se planifican y se les da la importancia que estas requieren, sumadas al capital humano que siempre ha existido, los bueno resultados son cuestión de tiempo. Este justo reconocimiento es para todos y cada uno de los componentes del seleccionado nariñense de fútbol juvenil compuesto por un cuerpo técnico capaz y bien preparado, y un conjunto de jugadores que son el fiel reflejo del talento existente en esta sección del país en donde los futbolistas surgen por naturaleza y no por generación espontánea, tanto es así que varios de ellos ya fueron seleccionados por Colombia a certámenes internacionales, el último convocado el arquero tumaqueño Iván Mauricio Arboleda quien fue titular con el país en el pasado Suramericano Prejuvenil realizado en Argentina en el mes de abril del presente año. Selección Nariño de fútbol juvenil, UN PROCESO DE VERDAD Por: Gerardo Insuasty 88
  • 75. IVAN ARBOLEDA ABRIL/21/1996 MARIO ORTIZ ENERO/12/1997 YILSON QUIÑONES MARZO/31/1995 MAIRON QUIÑONES ABRIL/20/1995 DANIEL LOPEZ ENERO/01/1996 JEAN CORTES JULIO/09/1996 SEBASTIAN ARCOS MAYO/22/1996 CARLOS ORTEGA ABRIL/05/1996 JULIO QUIÑONES JULIO/08/1996 EDGAR MENESES FEBRERO/12/1995 JUAN LOPEZ JUNIO/09/1995 DAVID CORTES MAYO/28/1996 DUVER CERON SEP/03/1996 ANDRES CORTES NOV/11/1997 LEONARDO DAZA JULIO/06/1995 JUAN ARIZALA MAYO/05/1995 IVAN PULISTAR MARZO/09/1996 GIOVANNY RUIZ Director Técnico DIEGO DULCE Asistente Técnico VICTOR CABEZAS Preparador de Arqueros FERNEY BELALCAZAR Preparador Físico ANDRES BURBANO MAYO/14/1995 CUERPO TÉCNICO A continuación, y deseando que en su gran mayoría logren llegar al fútbol profesional, unos como jugadores y otros ,ocincétopreucnuedsetnargetniomoc presentamos a la mencionada plantilla:
  • 76. s muy grande el número de los deportistas extremos en la ciudad de Pasto así como en el Departamento de Nariño, número que aumenta diariamente con la necesidad, de contar con espacio físico, propio y adecuado para la práctica y promoción de este tipo de deporte, es por esto que nace la iniciativa que se denomina “Queremos un skatepark en Pasto” la cual nace de los deportistas extremos desde las modalidades Skate, Parkour, Bmx y Roller, en articulación con la Consejera Municipal de Juventud y Estudiante de Derecho de la IU Cesmag Nathalia Rodríguez, proyecto que busca la construcción de un espacio físico adecuado, para la formación y promoción del deporte extremo; en donde los deportistas puedan expresar, más que un deporte un estilo de vida, QUEREMOS UN SKATEPARK EN PASTO Por: Nathalia Rodríguez cabe resaltar que este grupo jóvenes se han articulado de igual forma, para la realización de una serie de eventos en los cuales se ha dado a conocer el talento que poseen los deportistas ante la comunidad en general, la cual ha sido testigo de la necesidad de contar con un espacio propio para estos deportes, espacios que han servido también para recolectar firmas de apoyo a este proyecto. Como consejera municipal de juventud para mí es muy importante continuar con esta iniciativa puesto que los deportistas extremos necesitan el apoyo y la inclusión en la agenda pública para que de este modo puedan contar con un escenariopropioparapracticarel deporte como una buena alternativa de aprovechamiento del tiempo libre en las y los jóvenes. SKATE ANDRÉS ORDOÑEZ “SKATER” EstudiantedeIngenieríaElectrónicaUniversidaddeNariño Todo en la vida es una constante búsqueda, que hacer, que decir, a que enfocarse, porque vivir. Gracias al skate he encontrado una gran respuesta, un sentido a la vida. Quizá este comercialmente y a ojos de personas. No practicantes sea solo un deporte extremo, un modo de recreación, pero para uno que ha probado los sabores y los desazones de este deporte es más que eso. Practicar este deporte se siente como alcanzar las estrellas, Sesientecomollegaraunlugarseguro,sesiente satisfacción, liberación, diversión y muchísimos más adjetivos capaces de describir la sensación que este genera. Es sin duda alguna un estilo de vida, porque uno siente que la tabla “patineta” es parte de los pies, como si fuéramos una sola cosa, un solo plan, un solo sueño. 90
  • 77. PATINAJE EXTREMO B M X PARKOUR“TRACEUR” JugadordeHockey,estudiantedeArquitectura,Udenar, eintegrantedelabandadebluesOPIUMBLUESBAND El patinaje extremo es una disciplina deportiva la cual consiste en hacer una serie de movimientos corporales de alto riesgo en la ciudad, o en un parque extremo con la utilización de patines apropiados, los cuales es deportista pasa de un punto a a un punto b de la forma más rápida y con el mejor estilo, ya sea saltando un obstáculo x, o deslizando la baranda tubo o filo, con la mayor fluidez que se pueda y la cantidad de técnicas aprendidas a lo largo de la practica es un deporte el cual, te hace entender con una visión diferente la ciudad, se aprende a detallar espacios los cuales las personas los usa para funciones EstudiantedeingenieríaIndustrialUDENAR El BMX es un Deporte que se basa en realizar diferentes maniobras, de alta exigencia física y coordinación mental, Consiste en practicar trucos, saltos y giros montando una cicla con unas características específicas, Este deporte se puede practicar en cualquier espacio de Parkour significa trazo, es trasladarse de un punto A a un punto B, atravesando obstáculos urbanos lo más fluido posible, utilizando principalmente las habilidades del cuerpo humano y es cada obstáculo es un nuevo reto para atravesarlo, así como en la vida cotidiana superamos retos y problemas, el parkour CARLOS ANDRÉS LÓPEZ comunes y básicas, pero nosotros como rollers o deportistas extremos de cualquier disciplina, esos espacios urbanos los miramos como un lugar de convivencia, de esparcimiento con la práctica de esta disciplinas deportivas donde la apropiación del lugar por nosotros es notoria, lo adecuamos según nuestras necesidades sin trasgredir de una forma absurda la morfología del espacio, todo eso para una práctica digan y segura del deporte que me hace vivir un sueño que creía distante pero con la práctica diaria se hace cada vez real. Ser mejor día tras día tanto como deportista y como persona, ya que el deporte es eso, un ser integro. ANTHONY CAMILO CORNEJO JURADO “ROLLER” HERNÁN SALAS “BIKER” la calle o también en un skatepark lo que se ha convertido en una necesidad en nuestra ciudad; como deportistas observamos que en otras ciudades con la construcción de estos escenarios han evolucionado tanto la ciudad como el deporte. aporta en mi vida el aprender a superarlos, este deporte necesita mucha disciplina y entreno, el nivel de este deporte esta también en: no tomar, ni fumar, teniendo un estilo de vida saludable ya que este exige mucho estado físico; Este deporte no es de competencia la competencia es con uno mismo.
  • 78. n “Los Cedros”, vereda del municipio de Gualmatán, nació Eudoro Efraín Lucero Burgos, ingeniero electrónico que pasó por la NASA y recorrió gran parte del mundo. Don Julio Lucero y Bertha Burgos, son sus queridos padres. Por amor a su familia y cariño a su terruño, regresó a los 32 años de ausencia. Desde niño conoció su acogedora patria chica con todas las actividades diarias del campo, jugaba con sus vecinos y pastoreaba el ganado… pero debido a su inteligencia ya en su mente infantil dibujaba un futuro promisorio. Eudoro Efraín Lucero nació el 12 de diciembre de 1942, estudió en la escuela urbana de niños Cristo Rey, bachiller del Liceo de la Universidad de Nariño, ingeniero electrónico de la Universidad Distrital de Bogotá, especializado en Instrumentación Nuclear desde 1975. Es un hombre de éxito, amante de su carrera, afortunado en sus oportunidades académicas y de su profesión. Un científico de gran reconocimiento internacional. Su debilidad es la electrónica nuclear, estuvo en Francia en 1978, Canadá 1981, Alemania 1983, Argentina 1985, Costa Rica, Brasil, España, Austria, Uruguay, México, Santo Domingo, Estados Unidos, Holanda, Italia e Inglaterra. En1974fueJefedelÁreadeTecnologíayFísicaNuclearenelInstitutoNacional de Asuntos Nucleares, Miembro del Organismo Internacional de Energía Atómica, Coordinador General del proyecto de instrumentación nuclear para América Latina, científico reconocido, técnico administrativo, integrante de varias entidades nacionales e internacionales, conferencista, asistente, asesor, organizador de eventos de ciencia nuclear, profesor universitario, asesor de tesis, autor de varias publicaciones, representante ante organismos internacionales, delegado por Colombia. En resumen con esta sobresaliente hoja de vida, ha recorrido gran parte del mundo para orgullo de los nariñenses y de los colombianos. Alguna vez también pasó por la Nasa. Volvió a su tierra de Gualmatán luego de 32 años de ausencia, visitó Ancuya, la tierra de su esposa, recordó los poemas de su época universitaria y recibió un homenaje de “Crónicas del Retorno”. Efraín Lucero Burgos, cerebro fugado, hombre nacido en la entraña rural, otro gualmatense orgulloso de su comarca, ciudadano que sale del sur, más allá de la provincia. EUDOROEFRAÍNLUCEROBURGOS UN GUALMATENSE DE TALLA INTERNACIONAL Por: Leonel Chavez Dávila 92 Efraín Lucero y las hermanas Vallejo Mafla Gualmatán, Balcón de Flores
  • 79. as canciones del Trío MAGIA BLANCA compendian los anhelos de sus integrantes y de quienes los vimos moldearse en el crisol de la virtud, la consagración y el arte, para perfilarse como los mejores exponentes de música romántica en el sur colombiano, sobre el ruedo mágico del acetato, cuya calidad no requiere ponderación alguna sino más bien del sentimiento de los corazones románticos que del cotidiano existir hacen un poema en el que se conjugan ilusiones y adversidades”. Inspiración de Jorge Luis Santiusty Solarte. Esta famosa agrupación musical tuvo su origen en la ciudad de Túquerres, el 22 de abril de 1992, con un gran semillero de espectaculares voces, requintos y guitarras marcantes que sobre salen el mundo artístico y hoy más que nunca sus actuales integrantes siguen cosechando fama nacional e internacional. TRÍO MAGIA BLANCA, ENCANTA A NARIÑO Y COLOMBIA JORGE EDGAR BENAVIDES ORTEGA Nació en Túquerres (N) el 5 de marzo de 1951, Abogado litigante en la ciudad de Pasto en diferentes áreas del Derecho, egresado de la UniversidadCooperativadeColombia,Licenciado enFilosofíadelaUniversidadMariana;exgerente de Telecom, ex docente, fundador del Trío Magia Blanca hace 20 años, se desempeña como primera voz y percusión, con su especial estilo siembra en los corazones y en las mentes de propios y extraños el mensaje de amor que jamás se olvida. HENRY ALBERTO RODRÍGUEZ VELANDIA Egresado de la Escuela Normal Nacional, docente de la UDENAR, U Libre del Valle y nativo de Pasto. Su carrera musical se inició con la agrupación familiar CUARTETO DE LOS HERMANOS RODRIGUEZ, CONJUNTO AGUALONGO JUNIOR, GRUPO RAZA DE BRONCE, GRUPO FOLCLORISTA QUILLASINGA, COROS CANTARES DE NARIÑO, LOS RODRIGUEZ, Y Tríos: LOS ANDES, LOS GALANTES, Y ROMANTICOS. Murga AGUALONGO participando por más de cuarenta años en los carnavales de Negros y Blancos. Hace más de 17 años formando parte del trío Magia Blanca con su segunda voz y guitarra marcante. JESÚS SALAS Nació en Pasto en 1974, estudio en la Escuela Normal Nacional. Su carrera musical comenzó a la edad de 14 años como requinto y primera voz del trío juvenil LOS CHAVALES. Después de esta grata experiencia se integra a distintos tríos moldeando su carrera musical y ejecutando siempre el requinto y la tercera voz. Participó en los tríos: MONTERREAL, MARFIL (Policía Nacional), MONARKAS, EVOCACIÓN, DINASTÍA,LOSEMPERADORESyLOSANDES. En la actualidad se desempeña como tercera voz y requinto del trío MAGIA BLANCA al lado de esos dos maestros de la música: Henry Rodríguez y Jorge Benavides.
  • 80. i t LLLLLL ÑÑÑÑÑÑÑOOOOOOOOOffff li iii aa:::::: AA NNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT NNNNNNNNNAAAAAAAAPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTOOOOO AAAAAAAAAABBBBBBBBBBBRAAVVVVVVVVVVVVVVVVVVVVVVVVVVVVOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOVVV LLLLLLLLLLLLEEENNNNN NNNNAAAAAAAAAA AAAAAANNNNNNNNNN OOOOOOOOOOOOOOOOOOOOJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJAAAAAAAAAA RRAAAAAAAAAAAAAAAAAAAAAAAAVVVVVVVVVVVVVVOO CCCCCCCCCCCCCCCCCCCCCCC rr oooomooooooooo iiiiiinnnnnnnnnnnnnnnnn rrrr iiiiiizz dddddddddddddddddddddadddddddddddd ennnnnnnn iciicccccccccc ddddddddddddddddddddddddudduuuduuuuuddddd dddddddddddddddddddddddddddddddd ddddddddddddddddddddddddddddd SaSaSSSS nnnnnnnnn JJJJJuuuuuJJuJJJuJuJuJJJJJJJuJJJuJ nnnnnnn ddddddddddddddddde PPPPPPPPPPPPPPP toooooo eee ddddddddddddddddddddddddddddddddddddddd 555555555555 dddddddd MaMMMaMaMMMayoyoyoyoooooooooooyyyoyyyyyyyyyyyyyyyyyyyyyy dddddddddddddddddd 2022202022000220000002000001313131331333311131113311111311313133333131111 PPP rrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrr s PPPPPPPPPPPPP iiiiiirii eerrrarraaa CC ióóó RevistaELITENARIÑOfelicitaa: VALENTINAPANTOJABRAVO Ceremonia realizada en al ciudad de San Juan de Pasto el día 5 de Mayo de 2013 Por su Primera Comunión
  • 81. CuaCCCuaCuaCuaauCuauuuatrotrotrotrotrootro añañañaññaññañññña osososososososs dededdddededddee lababablablalablabablaboreoreoreoreoreoreoores ls ls llss levlevevleveevevaandandanandandandanaa o lo loooo llo lo mo mo mmmmmejoejejojoojejejejojoejjejooj r dr dr dr dr dr dr ddr dee le le le llla ta ta ta taa taa eleeleeleelelleleeleleeeevisvisvisvisvisvisvisvisvisvisvisvisvisvissvisvisvisióióióóióniónióniióióniónióónónióniónónóónónóiónióóóóón llolololollolololololollololoooololollololooolololooooolooocalcalcalcalcalcalcalalccalcalcalcacacalcalcacaacacalcalccaalcalaaaaalacalaca aaaaaaaaaaaaaaaaaaaaa lalalaalalaaalalalalalallalalaalalaaaaala comcocomcomcomcomcomcommcomomcccccomcomcocomcococomcomcoccooomccoo uniuniununiuniiniunu daddaddaddaddaddaddadadd dededddedeede lalaalalllalalalalall capcapcacapcacappppititaitaiitatataitatait l nllll nl nl nll ariariariarriñenñenñenenñenseseesessesessee cumcumcumcumcumcuccccummplipliplipliplió eó eó eóóó eeeel ml ml ml mmmagaagaaagaggaaazínzínzínzízínzínzínzízínzzíz VIVIVIVIVIVIVIVVVIVIVIVIVIVIVVIVVIVVIVEVEVEVEVEEVEVEVEVEEVEVEEVEVEEVEVEEVEVEVEVEV LALAALALLLA MAÑMAÑAÑMAÑÑÑMAÑMAÑMAÑANAAANNANANANAANAAANANAANANAAAN , b, b, bbb, bbb, b,, bajoajoajoajoajoajoajojoajojoaajoaj lalallalalalalalalala didddiddddididididiirecrecrerecrececrec iócióciócióióóóóóióciócióióióóóóióóócióccióción yn yn yn yn yn yn yyyn yn yn ynn yyyyyyyyyyn yn preprepreprepreprepreepp sensensensensene tactactactatactactataca ióniónóóiónónnniiónii dedededdededeedeed WWIWIWWWIWWIWIWIWIWIWWILSOLSOLSOSOLSOLSOSOLSOSON MMMMN MMMN MNN MNNN MMN OREOROROROREREOREOREREREREEOR NONONONNONONONONNNONOOONOONOOOONOONO GUEGUEGUEGGGGGGUEGUEUGGGU RRERRERRERRER RO.RORO.RO.OOprepreprepresensensesense tactactactacacióniónónónióónn dedededed WIWIWIWIWIWWW LSLSOSOLSOLSSOSOLSON MN MN MN MN MNN OREOREOREOREREREREORO EO ENONONONONNONOONON GUEGUEGUEGUEGUGUGUGUGUEUEGGUGGUGUEGGGGGU RRERRRRERRRRREREERRORORO SeSeSeSSe emiemiememmitetetete dededededdedddd lunlununlunlunlunlunlu eseseses a va va va va va vvvvvva viierierierierierierierierierierieriernesnesnesnesenesnessnesnesn snesnesessesesesnesnesnesen dededddedddedededededddedededdededd 9:9:9:9:9:9:9:9:9::9:9::000000000000000000000000000000 A.MA.MA.MAA.MA.MA.MA.MA.MMA.MA.MAA.MA.MA.MMA . //. /. /. /. /.... 1212121221212212:00:000:00:00:00:00:00 P.P.P.P.P.PPM.M.M.M.MMMMM.M. porporporporpororporporpporo elelelleleleeelelll cacacacacccac nalnalnalnalnalnalnala CNCNCNCNCNCNNCNNNNCCCC,CCC,CC,C,C,,C, conconconconconcono reprepreprepreprepee etietietietieetietitie cióc óciócióc óóóci n pn pn pn ppn pppn pn pn poororororoorororoo elelelelelelelele cancancanancancancanancannannnnnalalalalalalalalalalalalalalallalaaalalalaa 5656565656556565656565656565555 SENSENSENSENNSENSENENENTIMTIMTIMIMTIMTIMTIMMMIENIIENIENI NIENIENIENIENTOTOTTOTOTOOTOTO VALVALVALVALVALALVALVALVALA LENLENLENENENLENLENLENLENLENL ATOATOATOATOATOTOTOTOTOATOOATOATOTOATOOOTO aaaaaaaaaaaaaaaaa laslaslaslaslasaslalllalasaaslaslasala 6:6:6:6:6:6:66:6:6:30303003030330300 PMP.MPMPMPMPMP.MP.MP.P.MPP .. FelFelFelF lFeleeFeFeFe iziziizzizizizz cumcumucumcummcumumcumcumcumcumcumcummumummmumcummccucummcucc plepleplepleplepleplepleañoañoañoñoañañ s as as ass a totototooodosdosdosddosdosdossdos lolollololololos qs qs qs qsss quueueueeueee hachahahachh cchh enenenen parparpaarrrpappp tetete deldelddeldeldeldel eqeqeqe uipuippuipipuipuippppo Vo Vo Vo Vo Vo Vo VVVVVIIIVEVEIVEIVEIVEIVEIVVEEI LALALALALALAALALALA MAMAMAMAMAMAAAMAMAMAAMAMAAAMAMAÑAÑAÑANÑÑAÑAÑANÑAÑANANÑANÑAÑANÑANÑANÑAÑÑÑÑÑAÑ A yA yA yA y mimimiillll gggg ppppp qqqq ppp ,, pppp qqqqqqqgragragragrgrgrgrgragragragragragg ciaiiiiciaaiciaciaciaciaiiiacias as as as aas aaaas aas as as as aa lalalalalaalllallallalalalalalalas ps ps ps ps ps ps pss ps perserersersersersersersersrrerserrsr oonaonaonaonanaono s qs qqs qs qs queueueueuue hanhanannannann ccrcrcrccrcreídeídeídeídeíddeído eo eo eo eo eo eo enn en enn eeeestestesstest emememmemememprepreprerereerepreprepr ndindindindindindindind miemiemmiemiemiemiem ntontontotttonntontontoto, a, aa, aa, a, aaaa, a lalalalalalalalalalalaaalalaaal ss es es es emprmprmprp esaesaesasas qs qs qs qs qqs qqueueueueueueueueeue hahahanhahanhananhan apapapapapapapppoyaoyoyaoyayayaoyyayaoyoooyy dodododododododoododo esestestestseeses a ia iaa iia inicnicnicnicniccnicniciatiatiatiatiatatiattivaivaivaivaivaivaivaiva yyyyyyy a la la la la llla llosososososooosooss teltelteltelteltelteelelevievievievievevevev dendendendendendentestestestestes ququququuuq e de de de dee íaíaíaíaía a da da daa íaíaíaíaíaííaía estestesesteestese ánááánánánán conconconconconconconcon nononononononosotsotsotsotsotsotsototrosrosrosrosrosrososro ... TodTodTodTodddT ddTodTodTodT osososososoo nuenuenuenuenuenueenueen strstrstrrstrs osososossosss ttetteltelteltelteelele evievievievieviiee dedendedenndenend testestestestessstesee pupupupupuppup edeededeedeedeedeedeedeeeeeeeeen cnnn cn cn cn cn cn cn cn cn cn cn ccn cn cn cn cn cn cn cn cnnnnnnn oooomuomomuomuomuomomuoom nicnicnicniccnicarsarsararsarsaarse ee ee ee ee eeen vn vn vn vn vn vn vvivoivoivoivoivoivovoo cococococococon nn nn nn nn nn nn nnn nosoosoosoososoossosossotrottrooororr s ass as as as a trtrtrtrtrtravéavéavéavavéavav s ds ds ds ds ds ds e le le lee le lllosoooosos telteltelteltetelteleeletee éfoéfoéfoéfoéfoéfoffoéféfoéfoéfoéfoéfonosnososnosnonnonossnonnnnn ::: 7373373373373333333373337 53537553753537373771 y1 y1 y1 y11 y1 yy1 yyy 7373737337373733533335335335335353353333537272727272727272272722222222, o, o, ooooooooo, ooooo, ooooooo ttatatatambimbimbiimbibibiim énénénénénénénn puepuepuepuepuepuepuepu dendendendendendendden esesesesesesessescricrcricricricribirbiribirbirirnosnosnossnonos alalalal cococococococorrerrerrerrerrerrerreeooo:oo:o:o:o: vivvivvivvivvivvivvivvivvivvivelaelaelaelaelalaelaeelaeelamamanmanmanananananaanaananaanaanan @h@ho@hohoo@@ho@ho@ho@@hotmamatmatmatmamammt il.ilililil.ilil.comcococomcomcomcommmcommmcom PPrPrPrePrePrePrePrePrePrePPrerresesensensensensenense tadtadtaddtadadadoreorororoooreo eeees:s:s:s:ss::s: WWWilWilWilWilWilWWilsosonsonsso MoMoMoMoMoMoMoMoMoMorenrenrenrenrenno Go Go Go GGo Guerueruerueruererrrererrerrerrerrer ro yo yo yo yo yo yyoo yy FeFeFFFeFFeFeFeFeFeFeernarnarnnrnrnarnrnarnrnrnrnandandandandandada ReReReReReRebolbolbolbolbolbolbolbolledledledledledledleddo Ao Ao Ao Ao Ao Ao Allvelvelvelveveeveeeeararararararara
  • 82. MAELO RUÍZVICENTE FERNÁNDEZ SERGIO VARGAS ENRIQUE BUNBURY VILMA PALMA E VAMPIROSMARIANO CÍVICO KRAKEN MAGO DE OZ HOMBRES G TITO ROJAS JARABE DE PALO
  • 83. Dirección: Carrera 7 No. 21 – 12 San Juan de Pasto Teléfono: (092) 7322136 – 7309453 - Celular: 317 510 1051 Tour virtual en: www.hotelbolivarplaza.com e-mail: contacto@hotelbolivarplaza.com