Meiosis on the GO!

235
-1

Published on

review for science, chapter 2

Published in: Technology, Business
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
235
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
6
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Meiosis on the GO!

  1. 1. (an interactive presentation by Vicky & Ann)
  2. 2. Sexual SexualBasis of Sexual Reproduction in Reproduction inReproduction Animals Plants A1 B1 C1 A2 B2 C2 A3 B3 C3
  3. 3.  Conjunction is when is a method of reproduction in single- celled organisms. It involves the transfer of DNA from one individual to another It is the reason that the streptococcus bacteria was able to adapt and resist the former antibiotic used to defend it. Formerly, their were only a few of these bacteria that had the genes to defend these antibiotics, but as they got used more, the gene that fought the antibiotic started to pop up more often; “adapting” to the new conditions. Now a days, it is quite hard to find an antibiotic that will kill this bacteria. Remember, conjunction is not a form of sexual reproduction! (even if your textbook says so.) END
  4. 4. Example of Genetic CodeATGCTACGTACGGCTAATCGGCTAATGCCGTAATCGCGATGCATATGCCGCGTAATCGTACGCGGCTAATGCCGGCCGTAATGCATGCCGATATGCATGC
  5. 5.  Chromosomes are in a cell nucleus, a double-stranded threadlike structure that carries genetic material. Diploid means having two sets of chromosomes. Haploid means having one set of chromosomes. (You can remember this by thinking of half) Matching pairs of chromosomes are known as homologous pairs. A+T, G+C. (you can remember this by thinking “AT”, then just putting G+C together) DNA is short for Deoxyribonucleic Acid. DNA contains information passed down from the parent cells. They contain your genes.
  6. 6. 1. Whatis the total number of chromosomes in a human body?2. What are “matching” pairs of chromosomes known as?3. What does diploid mean?4. What is the full name of the genetic material that chromosomes carry?
  7. 7. 1. The total number of chromosomes in the human body is 46.2. They are known as homologous pairs.3. Diploid means having two sets of chromosomes.4. The full name of the genetic material that chromosomes carry is called Deoxyribonucleic Acid. (DNA)
  8. 8. Above, we see the process of meiosis
  9. 9.  Meiosis is, in cell division, the process that ensures each gamete is haploid. Only haploid gametes can combine during fertilization to form a diploid zygote. Meiosis ensures that the combination of chromosomes are different than that of one parent. because the nucleus is not the same, the gametes can produce offspring different from their parents. Crossing over is when single strands of DNA from each double stranded chromosome cross over and exchange segments of DNA.
  10. 10. 1. What is crossing over?2. Why can gametes produce different offspring from their parents?3. Only ? gametes can combine during fertilization to form a diploid zygote.
  11. 11. 1. Crossing over is when single strands of DNA from each double stranded chromosome cross over and exchange segments of DNA.2. Because they have different genetic information in their nucleus3. Haploid
  12. 12. Above are pictures of sperm and egg cells
  13. 13.  Animals that reproduce sexually have reproductive organs called gonads. Male gonads are called testes and female gonads are called ovaries. Sperm are gametes produced by males, and eggs are gametes produced by females. During fertilization, they come together to form a zygote. in the formation of egg(s), 4 identical nuclei are produced but only one gets a sufficient amount of cytoplasm, so you end up with one egg. In the formation of sperm(s), 4 identical nuclei are produced and the cytoplasm is split equally amongst them, so you end up with 4 sperm(s).
  14. 14. 1. Animals that reproduce sexually have reproductive organs called ? .2. In the formation of eggs, how many eggs form after one round of meiosis 1+2?3. In the formation of sperm, how many sperm form after one round of meiosis 1+2?
  15. 15. 1. Gonads2. 1 egg3. 4 sperm
  16. 16. All animals reproduce, it’s a fact
  17. 17.  Mating is when two members of a population come together to combine their gametes for fertilization. For some animals, there is only one mating season a year. (it is timed so that when the babies hatch or whatever, it is in favourable conditions) But another example is that a fish called the grunion mates at full or new moons. (when the tides are at their highest point.) A honey bee only mates once in its entire lifetime! Fertilization only occurs when a sperm meets an egg of the same species or of one that is really close. A moist environment is required so that the sperm and egg do not dry out. (it also keeps an egg membrane soft so a sperm can enter it easily) Fertilization is only the beginning of animal reproduction; the resulting zygote must develop into an independent individual.
  18. 18. 1. What is mating?2. Fertilization occurs when ? .3. Why do some animals mate only once each year?4. A ? environment is required during fertilization.
  19. 19. 1. Mating is when two members of a population come together to combine their gametes for fertilization.2. Fertilization occurs when a sperm meets an egg of the same species or of one that is really close.3. So that when their offspring arrive, they arrive in favourable conditions.4. Moist
  20. 20. Some organisms reproduce externally too!
  21. 21.  External fertilization is when the egg and sperm meet outside of the parent organism. An example of external fertilization is the sea anemone. Adult anemones can not move around, so they reproduce sexually by releasing sperm and eggs into the water. (this method relies on the water currents to bring the gametes together Another example would be that female fish usually lay their eggs in clusters, and then the male sprays them with sperm to fertilize them. Internal fertilization is when the egg and sperm meet inside one of the parent organisms. An example of internal fertilization is human and polar bear reproduction. Internal fertilization is primarily found in land animals; external fertilization is most commonly found in air and sea animals.
  22. 22. 1. What is external fertilization?2. What is internal fertilization?3. Give an example of each. (animal)
  23. 23. 1. External fertilization is when the egg and sperm meet outside of the parent organism.2. Internal fertilization is when the egg and sperm meet inside one of the parent organisms.3. Answers may vary. Expected responses include the sea anemone and fish for external; humans and polar bears for internal.(There are many more possibilities.)
  24. 24. It is considered a mutation forhumans to be hermaphrodites.
  25. 25.  The term "hermaphrodite" derives from Hermaphroditus, the son of Hermes and Aphrodite in Greek mythology, who was fused with a nymph, Salmacis, resulting in one individual possessing physical traits of both sexes. Hermaphrodites are organisms that have both female and male reproductive organs in each individual. Examples of this would be flatworms and earthworms. During mating, each planarian (the name given to non- parasitic flatworms) injects sperm into a reproductive pore on the other’s body. Each planarian then lays fertilized eggs. Hermaphrodite is used in botany to describe a flower that has both staminate (male, pollen-producing) and carpellate (female, ovule-producing) parts.
  26. 26. 1. What does the term hermaphrodite originate from? (state the type of mythology)2. What is the definition of “hermaphrodite”?3. How can the word hermaphrodite be used in botany?
  27. 27. 1. The word “hermaphrodite” originates from Greek mythology.2. Hermaphrodites are organisms that have both female and male reproductive organs.3. The term hermaphrodite is used in botany to describe a flower that has both staminate (male, pollen-producing) and carpellate (female, ovule-producing) parts.
  28. 28. Did you know that seeds are the productsof sexual reproduction in most plants?
  29. 29.  A seed is a complete reproductive package that contains an embryo, a food supply, and a seed coat. It is also the product of sexual reproduction in most plants. Scottish botanist Robert Brown was the first to classify seed-bearing plants into two major groups based on seed structure. They are split into two sections, namely: Angiosperms and gymnosperms.  Angiosperms are flowering plants.  Gymnosperms are non-flowering plants.  Keep in mind that plants do not fit into those two categories.
  30. 30. 1. What is usually the product of sexual reproduction in plants, and what does it contain?2. What are the two different categories plants can be categorized into?3. Give a rough general explanation of what separates the two categories.
  31. 31. 1. Seeds are usually the product of plant sexual reproduction, and they contain an embryo, a food supply, and a seed coat.2. Plants can be classified into gymnospheres, and angiosperms.1. The major difference between these two categories is that angiosperms produce flowers, and gymnosperms do not.
  32. 32. Angiosperms make great gardens! 
  33. 33.  Over half of all known plant species are angiosperms. (flowering plants) Some, such as a sunflower, produce showy flowers, while others, such as grasses, produce tiny flowers that are often overlooked. All flowers have the same function. That is, they all contain the plant’s reproductive organs. The female reproductive organ is called the pistil, and the male’s is called the stamen. Pollen grains from the anthers (a part of the plant) must reach the stigma of the pistil before seeds can develop. In self-pollination, both female and male gametes come from the same plant. In cross-pollination, gametes from different species reproduce. This means that the pollen from one flower is transfered to a flower on a different plant.
  34. 34. 1. What exactly are angiosperms?2. Give two examples of angiosperms.3. Name the reproductive organs found in an angiosperm? State the male organ first, then the female.4. How are seeds created/ how do angiosperms reproduce? What goes on in the plant?5. From the information gathered, what can angiosperms be considered as? HINT: it starts with an H.
  35. 35. 1. Angiosperms are, in the simplest explanation, flowering plants.2. Answers may vary. Sunflowers, tulips, grasses, etc.3. Stamen, pistil.4. Pollen grains from the anthers (a part of the plant) must reach the stigma of the pistil before seeds can develop.5. Angiosperms can be considered as hermaphrodites.
  36. 36. a Ever seen a pinecone?That’s a seed of agymnosperm!
  37. 37.  Unlike angiosperms, gymnosperms do not produce flowers. Instead, most gymnosperms produce seeds inside cones. Gymnosperm seeds have a coat that protects them from dehydration. In some gymnosperm species, male and female cones are produced on separate trees. However, in the most familiar species, the same tree produces both types of cones. Like an angiosperm, the seed of a gymnosperm contains an embryo, a food supply, and a coat that protects it from drying out. However, the seed is not contained in a fruit.
  38. 38. 1. What differentiates a gymnosperm from an angiosperm?2. Are gymnosperm seeds produced on the same tree, or on separate trees? **tricky, be careful!3. Seeds of gymnosperms are similar to seeds of angiosperms. What do they contain?
  39. 39. 1. Unlike angiosperms, gymnosperms do not produce flowers. Instead, most gymnosperms produce seeds inside cones.2. In some gymnosperm species, male and female cones are produced on separate trees. However, in the most familiar species, the same tree produces both types of cones.3. Like an angiosperm, the seed of a gymnosperm contains an embryo, a food supply, and a coat that protects it from drying out.
  40. 40. Hopefully you learned at least one thing, and have a HAPPY DAY!
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×