Nucleic Acid Chemistry www.freelivedoctor.com
Central Dogma <ul><li>DNA ----------------    RNA--------------   protein </li></ul>Replication transcription translatio...
Central Dogma <ul><li>Replication </li></ul><ul><ul><li>DNA making a copy of itself </li></ul></ul><ul><ul><ul><li>Making ...
Replication <ul><li>Remember that DNA is self complementary </li></ul><ul><li>Replication is semiconservative </li></ul><u...
Replication is Semiconservative www.freelivedoctor.com
Replication <ul><li>Roles of enzymes </li></ul><ul><ul><li>Topoisomerases </li></ul></ul><ul><ul><li>Helicase </li></ul></...
Replication www.freelivedoctor.com
Replication <ul><li>Helix opens </li></ul><ul><ul><li>Helicase </li></ul></ul><ul><li>Causes supercoiling upstream </li></...
Replication www.freelivedoctor.com
Replication <ul><li>Leading strand </li></ul><ul><ul><li>3’ end of template </li></ul></ul><ul><ul><li>As opens up, DNA po...
Replication www.freelivedoctor.com
Replication <ul><li>Lagging strand </li></ul><ul><ul><li>5’ end of template </li></ul></ul><ul><ul><ul><li>Can’t be made c...
Transcription <ul><li>DNA template made into RNA copy </li></ul><ul><ul><li>Uracil instead of Thymine </li></ul></ul><ul><...
Transcription www.freelivedoctor.com
Transcription <ul><li>DNA opens up </li></ul><ul><ul><li>Enzymes? </li></ul></ul><ul><li>RNA polymerase binds  </li></ul><...
Transcription <ul><li>How does RNA polymerase know where to start? </li></ul><ul><li>upstream promotor sequences </li></ul...
Introns and Exons <ul><li>Introns </li></ul><ul><ul><li>Intervening sequences </li></ul></ul><ul><ul><li>Not all DNA codes...
Processing of hnRNA into mRNA <ul><li>3 steps </li></ul><ul><ul><li>Introns removed </li></ul></ul><ul><ul><ul><li>Self sp...
Processing of hnRNA into mRNA www.freelivedoctor.com
Translation <ul><li>RNA --   Protein </li></ul><ul><ul><li>Change from nucleotide language to amino acid language </li></...
Genetic Code <ul><li>Nucleotides read in triplet “codons” </li></ul><ul><ul><li>5’ -   3’ </li></ul></ul><ul><li>Each cod...
Genetic Code www.freelivedoctor.com
Genetic Code <ul><li>Not everything translated </li></ul><ul><li>AUG is start codon </li></ul><ul><ul><li>Find the start c...
Translation <ul><li>Steps: </li></ul><ul><ul><li>Find start codon (AUG)  </li></ul></ul><ul><ul><li>After start codon, rea...
Translation Process <ul><li>Requires Ribosomes, rRNA, tRNA and, of course, mRNA </li></ul><ul><ul><li>Ribosome </li></ul><...
Ribosome <ul><li>Left is cartoon diagram   Right is actual picture </li></ul>www.freelivedoctor.com
Transfer RNA <ul><li>Mostly double stranded </li></ul><ul><ul><li>Folds back on itself </li></ul></ul><ul><li>Several loop...
Transfer RNA www.freelivedoctor.com
Translation <ul><li>Initiation </li></ul><ul><ul><li>Ribosomal subunits assemble on mRNA </li></ul></ul><ul><ul><li>rRNA a...
Translation www.freelivedoctor.com
Mutations <ul><li>Changes in nucleotide sequence </li></ul><ul><li>Can cause changes in aa sequence </li></ul><ul><ul><li>...
Point Mutations <ul><li>Single nucleotide changes </li></ul><ul><li>Old sequence </li></ul><ul><ul><li>AUG   GGU AGG GAG G...
Point mutations <ul><li>Depending on change, may not change aa sequence </li></ul><ul><li>Old sequence </li></ul><ul><ul><...
Point Mutations <ul><li>Change could make little difference </li></ul><ul><ul><li>If valine changed to leucine, both nonpo...
Point Mutations <ul><li>Other possibilities, </li></ul><ul><ul><li>Stop codon inserted </li></ul></ul><ul><ul><ul><li>Trun...
Frame Shift mutations <ul><li>Insertions or deletions </li></ul><ul><ul><li>Change the reading frame </li></ul></ul><ul><l...
Frame Shift Mutations <ul><li>Deletion example </li></ul><ul><li>Old sequence </li></ul><ul><ul><li>AUG   GGU  A GG GAG GC...
Complementary DNA Strand <ul><ul><li>Template: </li></ul></ul><ul><li>3’  ACTAGCCTAAGTCG  5’ </li></ul><ul><li>5’  TGATCGG...
RNA Transcript <ul><ul><li>DNA  3’ GCCTAAGCTCA 5’ </li></ul></ul><ul><ul><li>RNA   5’ CGGAUUCGAGU 3’ </li></ul></ul>www.fr...
Upcoming SlideShare
Loading in...5
×

Nucleic Acid Chemistry

379

Published on

0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total Views
379
On Slideshare
0
From Embeds
0
Number of Embeds
0
Actions
Shares
0
Downloads
23
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Nucleic Acid Chemistry

  1. 1. Nucleic Acid Chemistry www.freelivedoctor.com
  2. 2. Central Dogma <ul><li>DNA ----------------  RNA--------------  protein </li></ul>Replication transcription translation www.freelivedoctor.com
  3. 3. Central Dogma <ul><li>Replication </li></ul><ul><ul><li>DNA making a copy of itself </li></ul></ul><ul><ul><ul><li>Making a replica </li></ul></ul></ul><ul><li>Transcription </li></ul><ul><ul><li>DNA being made into RNA </li></ul></ul><ul><ul><ul><li>Still in nucleotide language </li></ul></ul></ul><ul><li>Translation </li></ul><ul><ul><li>RNA being made into protein </li></ul></ul><ul><ul><ul><li>Change to amino acid language </li></ul></ul></ul>www.freelivedoctor.com
  4. 4. Replication <ul><li>Remember that DNA is self complementary </li></ul><ul><li>Replication is semiconservative </li></ul><ul><ul><li>One strand goes to next generation </li></ul></ul><ul><ul><li>Other is new </li></ul></ul><ul><li>Each strand is a template for the other </li></ul><ul><ul><li>If one strand is 5’ AGCT 3’ </li></ul></ul><ul><ul><li>Other is: 3’ TCGA 5’ </li></ul></ul>www.freelivedoctor.com
  5. 5. Replication is Semiconservative www.freelivedoctor.com
  6. 6. Replication <ul><li>Roles of enzymes </li></ul><ul><ul><li>Topoisomerases </li></ul></ul><ul><ul><li>Helicase </li></ul></ul><ul><ul><li>DNA polymerases </li></ul></ul><ul><ul><li>ligase </li></ul></ul><ul><li>DNA binding proteins </li></ul><ul><ul><li>DNA synthesis </li></ul></ul><ul><ul><ul><li>Leading strand </li></ul></ul></ul><ul><ul><ul><li>Lagging strand </li></ul></ul></ul>www.freelivedoctor.com
  7. 7. Replication www.freelivedoctor.com
  8. 8. Replication <ul><li>Helix opens </li></ul><ul><ul><li>Helicase </li></ul></ul><ul><li>Causes supercoiling upstream </li></ul><ul><ul><li>Topoisomerases (gyrase) </li></ul></ul><ul><li>DNA Binding Proteins </li></ul><ul><ul><li>Prevent reannealing </li></ul></ul>www.freelivedoctor.com
  9. 9. Replication www.freelivedoctor.com
  10. 10. Replication <ul><li>Leading strand </li></ul><ul><ul><li>3’ end of template </li></ul></ul><ul><ul><li>As opens up, DNA polymerase binds </li></ul></ul><ul><ul><li>Makes new DNA 5’ -  3’ </li></ul></ul><ul><ul><ul><li>Same direction as opening of helix </li></ul></ul></ul><ul><ul><ul><li>Made continuously </li></ul></ul></ul>www.freelivedoctor.com
  11. 11. Replication www.freelivedoctor.com
  12. 12. Replication <ul><li>Lagging strand </li></ul><ul><ul><li>5’ end of template </li></ul></ul><ul><ul><ul><li>Can’t be made continuously as direction is wrong </li></ul></ul></ul><ul><ul><li>RNA primer </li></ul></ul><ul><ul><li>New DNA made 5’  3’ </li></ul></ul><ul><ul><ul><li>Opposite direction of replication </li></ul></ul></ul><ul><ul><ul><li>Discontinuous </li></ul></ul></ul><ul><ul><ul><ul><li>Okazaki fragments </li></ul></ul></ul></ul><ul><ul><ul><li>Ligase closes gaps </li></ul></ul></ul>www.freelivedoctor.com
  13. 13. Transcription <ul><li>DNA template made into RNA copy </li></ul><ul><ul><li>Uracil instead of Thymine </li></ul></ul><ul><li>One DNA strand is template </li></ul><ul><ul><li>Sense strand </li></ul></ul><ul><li>Other is just for replication </li></ul><ul><ul><li>Antisense </li></ul></ul><ul><li>In nucleus </li></ul><ul><ul><li>nucleoli </li></ul></ul>www.freelivedoctor.com
  14. 14. Transcription www.freelivedoctor.com
  15. 15. Transcription <ul><li>DNA opens up </li></ul><ul><ul><li>Enzymes? </li></ul></ul><ul><li>RNA polymerase binds </li></ul><ul><ul><li>Which strand? </li></ul></ul><ul><ul><li>Using DNA template, makes RNA </li></ul></ul><ul><ul><ul><li>5’-  3’ </li></ul></ul></ul><ul><ul><ul><li>Raw transcript called hnRNA </li></ul></ul></ul>www.freelivedoctor.com
  16. 16. Transcription <ul><li>How does RNA polymerase know where to start? </li></ul><ul><li>upstream promotor sequences </li></ul><ul><li>Pribnow Box </li></ul><ul><li>TATA box </li></ul><ul><li>RNA polymerase starts transcription X nucleotides downstream of TATA box </li></ul>www.freelivedoctor.com
  17. 17. Introns and Exons <ul><li>Introns </li></ul><ul><ul><li>Intervening sequences </li></ul></ul><ul><ul><li>Not all DNA codes for protein </li></ul></ul><ul><ul><li>Regulatory info, “junk DNA” </li></ul></ul><ul><li>Exons </li></ul><ul><ul><li>Code for protein </li></ul></ul>www.freelivedoctor.com
  18. 18. Processing of hnRNA into mRNA <ul><li>3 steps </li></ul><ul><ul><li>Introns removed </li></ul></ul><ul><ul><ul><li>Self splicing </li></ul></ul></ul><ul><ul><li>5’ methyl guanosine cap added </li></ul></ul><ul><ul><li>Poly A tail added </li></ul></ul><ul><li>Moved to cytosol for translation </li></ul>www.freelivedoctor.com
  19. 19. Processing of hnRNA into mRNA www.freelivedoctor.com
  20. 20. Translation <ul><li>RNA --  Protein </li></ul><ul><ul><li>Change from nucleotide language to amino acid language </li></ul></ul><ul><li>On ribosomes </li></ul><ul><li>Vectorial nature preserved </li></ul><ul><ul><li>5’ end of mRNA becomes amino terminus of protein </li></ul></ul><ul><ul><li>Translation depends on genetic code </li></ul></ul>www.freelivedoctor.com
  21. 21. Genetic Code <ul><li>Nucleotides read in triplet “codons” </li></ul><ul><ul><li>5’ -  3’ </li></ul></ul><ul><li>Each codon translates to an amino acid </li></ul><ul><li>64 possible codons </li></ul><ul><ul><li>3 positions and 4 possiblities (AGCU) makes 4 3 or 64 possibilities </li></ul></ul><ul><ul><li>Degeneracy or redundancy of code </li></ul></ul><ul><ul><ul><li>Only 20 amino acids </li></ul></ul></ul><ul><ul><ul><li>Implications for mutations </li></ul></ul></ul>www.freelivedoctor.com
  22. 22. Genetic Code www.freelivedoctor.com
  23. 23. Genetic Code <ul><li>Not everything translated </li></ul><ul><li>AUG is start codon </li></ul><ul><ul><li>Find the start codon </li></ul></ul><ul><li>Also are stop codons </li></ul><ul><li>To determine aa sequence </li></ul><ul><ul><li>Find start codon </li></ul></ul><ul><ul><li>Read in threes </li></ul></ul><ul><ul><li>Continue to stop codon </li></ul></ul>www.freelivedoctor.com
  24. 24. Translation <ul><li>Steps: </li></ul><ul><ul><li>Find start codon (AUG) </li></ul></ul><ul><ul><li>After start codon, read codons, in threes </li></ul></ul><ul><ul><li>Use genetic code to translate </li></ul></ul><ul><li>Translate the following: </li></ul><ul><li>GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC </li></ul>www.freelivedoctor.com
  25. 25. Translation Process <ul><li>Requires Ribosomes, rRNA, tRNA and, of course, mRNA </li></ul><ul><ul><li>Ribosome </li></ul></ul><ul><ul><ul><li>Made of protein and rRNA </li></ul></ul></ul><ul><ul><ul><li>2 subunits </li></ul></ul></ul><ul><ul><ul><li>Has internal sites for 2 transfer RNA molecules </li></ul></ul></ul>www.freelivedoctor.com
  26. 26. Ribosome <ul><li>Left is cartoon diagram Right is actual picture </li></ul>www.freelivedoctor.com
  27. 27. Transfer RNA <ul><li>Mostly double stranded </li></ul><ul><ul><li>Folds back on itself </li></ul></ul><ul><li>Several loops </li></ul><ul><ul><li>Anticodon loop </li></ul></ul><ul><ul><ul><li>Has complementary nucleotides to codons </li></ul></ul></ul><ul><li>3’ end where aa attach </li></ul>www.freelivedoctor.com
  28. 28. Transfer RNA www.freelivedoctor.com
  29. 29. Translation <ul><li>Initiation </li></ul><ul><ul><li>Ribosomal subunits assemble on mRNA </li></ul></ul><ul><ul><li>rRNA aids in binding of mRNA </li></ul></ul><ul><li>Elongation </li></ul><ul><ul><li>tRNAs with appropriate anticodon loops bind to complex </li></ul></ul><ul><ul><li>have aa attached (done by other enzymes) </li></ul></ul><ul><ul><li>Amino acids transfer form tRNA 2 to tRNA 1 </li></ul></ul><ul><ul><li>Process repeats </li></ul></ul><ul><li>Termination </li></ul><ul><ul><li>tRNA with stop codon binds into ribosome </li></ul></ul><ul><ul><li>No aa attached to tRNA </li></ul></ul><ul><ul><li>Complex falls apart </li></ul></ul>www.freelivedoctor.com
  30. 30. Translation www.freelivedoctor.com
  31. 31. Mutations <ul><li>Changes in nucleotide sequence </li></ul><ul><li>Can cause changes in aa sequence </li></ul><ul><ul><li>Degeneracy in genetic code can prevent </li></ul></ul><ul><li>Two types </li></ul><ul><ul><li>Point mutations </li></ul></ul><ul><ul><ul><li>Single nucleotide changes </li></ul></ul></ul><ul><ul><li>Frame shift </li></ul></ul><ul><ul><ul><li>Insertions or deletions </li></ul></ul></ul>www.freelivedoctor.com
  32. 32. Point Mutations <ul><li>Single nucleotide changes </li></ul><ul><li>Old sequence </li></ul><ul><ul><li>AUG GGU AGG GAG GCA ACC UGA ACC GAC </li></ul></ul><ul><ul><li>aa: G R E A T </li></ul></ul><ul><ul><li>New sequence </li></ul></ul><ul><ul><li>AUG GGU AG U GAG GCA ACC UGA ACC GAC </li></ul></ul><ul><ul><li>aa: G S E A T </li></ul></ul>www.freelivedoctor.com
  33. 33. Point mutations <ul><li>Depending on change, may not change aa sequence </li></ul><ul><li>Old sequence </li></ul><ul><ul><li>AUG GGU AGG GAG GCA ACC UGA ACC GAC </li></ul></ul><ul><ul><li>aa: G R E A T </li></ul></ul><ul><ul><li>New sequence </li></ul></ul><ul><ul><li>AUG GGU AG A GAG GCA ACC UGA ACC GAC </li></ul></ul><ul><ul><li>aa: G R E A T </li></ul></ul>www.freelivedoctor.com
  34. 34. Point Mutations <ul><li>Change could make little difference </li></ul><ul><ul><li>If valine changed to leucine, both nonpolar </li></ul></ul><ul><li>Change could be huge, </li></ul><ul><ul><li>Could erase start codon </li></ul></ul><ul><li>Old sequence </li></ul><ul><ul><li>AUG GGU AGG GAG GCA ACC UGA ACC GAC </li></ul></ul><ul><ul><li>aa: G R E A T </li></ul></ul><ul><ul><li>New sequence </li></ul></ul><ul><ul><li>AU U GGU AG A GAG GCA ACC UGA ACC GAC </li></ul></ul><ul><ul><li>aa: no start codon…protein not made </li></ul></ul>www.freelivedoctor.com
  35. 35. Point Mutations <ul><li>Other possibilities, </li></ul><ul><ul><li>Stop codon inserted </li></ul></ul><ul><ul><ul><li>Truncated protein </li></ul></ul></ul><ul><ul><li>Stop codon changed </li></ul></ul><ul><ul><ul><li>Extra long protein </li></ul></ul></ul><ul><li>Bottom line, </li></ul><ul><ul><li>Depends on what change is </li></ul></ul>www.freelivedoctor.com
  36. 36. Frame Shift mutations <ul><li>Insertions or deletions </li></ul><ul><ul><li>Change the reading frame </li></ul></ul><ul><li>Insertion example </li></ul><ul><ul><li>Old sequence </li></ul></ul><ul><ul><li>AUG GGU AGG GAG GCA ACC UGA ACC GAC </li></ul></ul><ul><ul><li>aa: G R E A T </li></ul></ul><ul><ul><li>New sequence </li></ul></ul><ul><ul><li>AUG GGU AGG A GA GGC AAC CUG AAC CGA C </li></ul></ul><ul><ul><li>aa: G R R G N L N R </li></ul></ul>www.freelivedoctor.com
  37. 37. Frame Shift Mutations <ul><li>Deletion example </li></ul><ul><li>Old sequence </li></ul><ul><ul><li>AUG GGU A GG GAG GCA ACC UGA ACC GAC </li></ul></ul><ul><ul><li>aa: G R E A T </li></ul></ul><ul><ul><li>New sequence Delete second A (Underlined above) </li></ul></ul><ul><ul><li>AUG GGU GGG AGG CAA CCU GAA CCG AC </li></ul></ul><ul><ul><li>aa: G G R Q P G P </li></ul></ul>www.freelivedoctor.com
  38. 38. Complementary DNA Strand <ul><ul><li>Template: </li></ul></ul><ul><li>3’ ACTAGCCTAAGTCG 5’ </li></ul><ul><li>5’ TGATCGGATTCAGC 3’ </li></ul>www.freelivedoctor.com
  39. 39. RNA Transcript <ul><ul><li>DNA 3’ GCCTAAGCTCA 5’ </li></ul></ul><ul><ul><li>RNA 5’ CGGAUUCGAGU 3’ </li></ul></ul>www.freelivedoctor.com
  1. A particular slide catching your eye?

    Clipping is a handy way to collect important slides you want to go back to later.

×