Proteínas

Fuentes de proteína
• Animal
• Vegetal
– Cereales
– Leguminosas
– Hojas (espinaca y
alfalfa)

• Microorganismos...
Clasificación de aminoácidos
•

Afinidad por el agua:
Hidrofóbicos
Hidrofílicos

•

Naturaleza del grupo R
–
–
–
–
–
–

al...
Aminoácidos esenciales
–
–
–
–
–
–
–
–
–
–

niños 0-6 meses
Histidina
28
Isoleucina
70
Leucina
161
Lisina
103
Metionina
58...
Estructura de proteínas
90%

Proteína

trazas

Primaria
Polipéptidos

Secundaria

Terciaria

Cuaternaria

Iónes
Moléculas
...
Enlace peptídico

Enlace peptídico

Enlace peptídico

Distancias en el enlace peptídico

40% carácter de doble enlace

Geo...
Estructura secundaria
Hélice α

• Disposición espacial adoptada por la cadena
polipeptídica a lo largo de su eje
–
–
–
–

...
Hoja plegada β

Giros β

Afinidad de los aminoácidos a divesas conformaciones secundarias

7
Estructura terciaria
Organización tridimensional de una cadena
polipetídica,
formada por regiones con estructuras
secundar...
Interacciones que estabilizan
estructura de proteínas
• Covalentes
– Peptídicos
– disulfuro

• Electrostática
– Iónicos
– ...
Puentes de hidrógeno
N-H

O=C_ Carbonil-amida

_

N-H

H
O_ Amida-hidroxil

_

OH

O=C_ Hidroxil-carbonil

_

Interaccione...
Clasificación de proteínas por solubilidad
• Albuminas

Desnaturalización

• Solubles en agua, coagulan por calor

• Globu...
k1

PN
Proteína
nativa

k2

X1

k3

X2

microestados

PD

Factores de
desnaturalización
Agentes físicos
calor
congelación
...
Efectos del tratamiento
térmico 100 a 150°C
Caramelización
síntesis de enlaces iso-péptídicos
síntesis de lisinoalanina

C...
Influencia del pH sobre
Hidratación

pH vs pI
Carga neta
+

-

140

pH>pI

carga negativa

pH=pI

igual numero de cargas
p...
Agentes de superficie
Urea y mercaptoetanol

Dodecilsulfato de sodio (SDS)
actúa como intermediario de regiones hidrófoba ...
Upcoming SlideShare
Loading in …5
×

Proteinas

743 views
552 views

Published on

proteinas 22

Published in: Education
0 Comments
0 Likes
Statistics
Notes
  • Be the first to comment

  • Be the first to like this

No Downloads
Views
Total views
743
On SlideShare
0
From Embeds
0
Number of Embeds
2
Actions
Shares
0
Downloads
13
Comments
0
Likes
0
Embeds 0
No embeds

No notes for slide

Proteinas

  1. 1. Proteínas Fuentes de proteína • Animal • Vegetal – Cereales – Leguminosas – Hojas (espinaca y alfalfa) • Microorganismos – unicelular • Fuente de nitrógeno orgánico – – – – – Regeneración y síntesis de tejidos Enzimas Anticuerpos Hormonas Membranas (transporte) α-L-Aminoácidos Proteínas Unidades estructurales de proteínas • Productos de alta calidad carboxilo – Nutricional – Propiedades sensoriales • Textura, geles, viscosidad, fibras, color • Susceptibles a modificación física, química y enzimática durante proceso y almacén α amino Cadena lateral Enantiomeros Lisina Cadena lateral R 1
  2. 2. Clasificación de aminoácidos • Afinidad por el agua: Hidrofóbicos Hidrofílicos • Naturaleza del grupo R – – – – – – alifáticos aromáticos hidroxilados básicos ácidos azufrados 2
  3. 3. Aminoácidos esenciales – – – – – – – – – – niños 0-6 meses Histidina 28 Isoleucina 70 Leucina 161 Lisina 103 Metionina 58 Treonina 87 Fenilalanina 125 Triptófano 17 Valina 93 Totales 742 catiónica adultos (mg/día/kg) 0 10 14 12 13 7 14 3.5 10 83.5 doble ión aniónica Carga neta 0 + 3
  4. 4. Estructura de proteínas 90% Proteína trazas Primaria Polipéptidos Secundaria Terciaria Cuaternaria Iónes Moléculas metálicos orgánicas Residuos de aminoácidos Estructura primaria • secuencia de restos de aminoácidos • Unidos por enlaces covalentes peptídicos • geometría trans • Orden génetico hélice cadena polipeptídica subunidades ensambladas Secuencia de aminoácidos DNA ATGCATGCTAAAGTGCCATAA TAGCTACGATTTCACGGTATT mRNA AUGCAUCGUAAAGUGCCAUAA Proteína Met-His-Arg-Lys-Val-Pro----- 4
  5. 5. Enlace peptídico Enlace peptídico Enlace peptídico Distancias en el enlace peptídico 40% carácter de doble enlace Geometría plana Configuración trans Extremos de la cadena polopeptídica N- terminal Amino terminal Grupos ionizables C- terminal Carbonilo terminal 5
  6. 6. Estructura secundaria Hélice α • Disposición espacial adoptada por la cadena polipeptídica a lo largo de su eje – – – – -NH-CO- Hélice Hoja plegada Giros β azar Hélice α Restos de aa por vuelta 3.6 hélice 310 hélice π 3 4.4 Hélice γ (5.2 restos de aminoácidos) Helice derecha Estabilizada por interacciones Iónicas y puentes hidrogeno 6
  7. 7. Hoja plegada β Giros β Afinidad de los aminoácidos a divesas conformaciones secundarias 7
  8. 8. Estructura terciaria Organización tridimensional de una cadena polipetídica, formada por regiones con estructuras secundarias: – Esféricas o Globulares • Estructura compacta similar a una esfera, • zonas hidrofóbicas plegadas en el centro • Solubles en agua, sols. Salinas diluidas, ácidos y bases débiles – Tubulares o Fibrilares • Insolubles en agua • Unidas por un gran número de enlaces • Forman tejidos (piel, músculo, tendones, etc) Proteína globular dominios Estructura cuaternaria • Asociación de dos o más unidades proteicas o cadenas polipeptídicas • Mediante interacciones no covalentes 8
  9. 9. Interacciones que estabilizan estructura de proteínas • Covalentes – Peptídicos – disulfuro • Electrostática – Iónicos – Dipolo-dipolo – Ión-dipolo • van der Waals inducción de momentos dipolares en grupos apolares • Puentes de hidrógeno (carbonil-amida, amida-hidroxilo, hidroxilo-carbonilo) • hidrofóbicas Interacciones covalentes -Cα Interacciones electrostáticas + H3N_ Iónica C-O O _ C- N H O Cα− -S S- Peptídico _ disulfuro CH2OH _ CH2OH HOCH2_ Dipolo-dipolo O δ- δ+ O C_ Ión - dipolo 9
  10. 10. Puentes de hidrógeno N-H O=C_ Carbonil-amida _ N-H H O_ Amida-hidroxil _ OH O=C_ Hidroxil-carbonil _ Interacciones proteína-agua La conformación de proteínas depende de la interacción con el solvente. • Agua estructural: atrapada dentro de cavidades unida fuertemente a cadenas laterales • • Agua de la monocapa o interfacial Agua libre solvatación Interacciónes proteína-agua C-O O _ _ _ _ Ión – dipolo δ+ δ+ CH2-O-H N-H δ- δ+ Dipolo - d ipolo δ+ – Homoproteínas – Heteroproteínas o conjugadas • Solubilidad: • Función biológica: δ- Puente de hidrógeno δδ+ Proteínas conjugadas Clase – Globulares – fibrilares • Composición: δ- C=O Clasificación de proteínas • Forma: δ- Grupo protético – – – – – Estructurales Anticuerpos Transporte Enzimas hormonas Mioglobina Grupo hemo Ejemplo Lipoproteínas Lípidos β-lipoproteína Glucoproteínas Carbohidratos Inmonuglobulina Fosfoproteínas Grupos fosfato Caseina hemoproteínas Grupo hemo Hemoglobina flavoproteínas Flavin nucleotidos Succinato deshidrogenasa metaloproteínas Hierro Cinc Calcio Molibdeno cobre Ferritina Alcohol deshidrogenasa Calmodulina Dinitrogenasa plastocianina Cadena polipeptídica 10
  11. 11. Clasificación de proteínas por solubilidad • Albuminas Desnaturalización • Solubles en agua, coagulan por calor • Globulinas Pérdida o cambios en la estructura secundaria y terciaria • Insolubles en agua • Solubles en soluciones salinas diluidas • Histonas • Elevado contenido re residuos básicos • Solubles en ácidos • Glutelinas • Solubles en ácidos (pH 2) y bases fuertes (pH 12) • Prolaminas • Solubles en etanol al 50-80% • Escleroproteínas Proteína nativa • insolubles Susceptibilidad de la proteína a la desnaturalización Facilidad del agente para romper interacciones que estabilizan estructura intensidad tipo de proteína Efectos de la desnaturalización Reducción de la solubilidad reducción en la capacidad para fijar agua pérdida de actividad biológica aumento de la susceptibilidad al ataque de proteasas aumento en la viscosidad intrínseca incapacidad para cristalizar Interacciones proteína-proteína Tipo E kJ/mol Distancia (°A) grupos Proteína desnaturalizada Desnaturalización Disolventes que perturban 330-380 1-2 Cistina-S-S Reductores Mercaptoetanol Ditiotreitol Puente hidrógeno 8-40 2-3 -NH C=O -OH Urea Guanidina detergentes Hidrofóbicas 4-12 3-5 alifáticas aromáticos Detergentes Disolventes orgánicos Electrostáticas 42-84 2-3 COO NH3+ Van der Waals 1-9 - Energía libre covalente nativo Barrera de activación desnaturalizado Soluciones salinas pH´s extremos Dipolos permanentes o inducidos 11
  12. 12. k1 PN Proteína nativa k2 X1 k3 X2 microestados PD Factores de desnaturalización Agentes físicos calor congelación tratamientos mecánicos presión hidrostática radiación interfases proteína desnaturalizada Energía de activación es elevada por ruptura de: •enlaces disulfuro, •interacciones no covalentes de baja energía Factores de desnaturalización Agentes químicos ácidos y álcalis metales disolventes orgánicos soluciones salinas concentradas Calor Q10= 600 depende de: naturaleza de proteína pH, fuerza iónica solubilidad Desnaturalización: Fenómeno en etapas Temperatura Efectos del tratamiento térmico 60-85°C ruptura de purntes de hidrógeno Exposición grupos hidrofóbicos Apertura de la cadena polipeptídica precipitación ruptura de enlaces disulfuro liberación de sulfuro de hidrógeno deshidratación Efectos del tratamiento térmico 80 a 100°C reacción de Maillard racemización de aa desaminación de glutamina y asparagina formación de nuevos enlaces covalentes o intramoleculares oxidación 12
  13. 13. Efectos del tratamiento térmico 100 a 150°C Caramelización síntesis de enlaces iso-péptídicos síntesis de lisinoalanina Congelación Interfases sulfuros disulfuros mercaptanos compuestos volátiles a. difusión hacia la interfase b. ruptura de enlaces aguaproteína c. apertura d. grupos hidrofóbos expuestos hacia la fase no acuosa e. orientación de grupos hidrofílicos hacia las fase acuosa Ácidos y álcalis I. Adsorción: P*m + n(H2O) II Desnaturalización P*m + n(H2O) cisteína cistina metionina Interfases Formación de agregados y precipitación disociación de oligómeros reorganización de sub-unidades PN m(H2O) + (H2O)* Desulfuración pH´s extremos incremento de repulsiones electrostáticas entre grupos ionizados dentro de la molécula desplegamiento PD P* = proteína hidratada y activada 13
  14. 14. Influencia del pH sobre Hidratación pH vs pI Carga neta + - 140 pH>pI carga negativa pH=pI igual numero de cargas positivas y negativas 120 + pH 0 CRA 100 80 60 40 - pH< pI carga positiva 20 0 pH = pI 5 10 15 pH Metales Serie de Hofmeister • Transición (Cu, Fe, Hg, Ag) (PO4)3->(SO4)2-> Cl-> Br -> NO3-> (NH4)+ > K+ > Na+ >Mg 2+ > Ca 2+ ClO4 -> SCN- Promueven precipitación Disolventes orgánicos • Reducen la constante diélectrica del medio • Modifican interacciones electrostáticas que estabilizan la estructura de proteínas reaccionan fácilmente con proteínas forman complejos estables con grupos- tiol • alcalino-terreos (Ca, Mg) poco reactivos Sales Urea y sales de guanidina (4-8M) rompen puentes de H disminuyen interacciones hidrofóbicas incrementan solubilidad de residuos hidrófobos provoca grados variables de desnaturalización • Penetran en regiones hidrofóbas 14
  15. 15. Agentes de superficie Urea y mercaptoetanol Dodecilsulfato de sodio (SDS) actúa como intermediario de regiones hidrófoba e hidrofílicas Aniónicos incrementan la carga neta negativa y las fuerzas de repulsión internas producen desplegamiento de la estructura nativa Efecto de altas presiones • Cambios en las distancias: – interatómicas – interacciones intra e intermoléculares Ruptura / pH , fuerza iónica, °C • enlaces iónicos por electrostricción • interacciones hidrofóbicas De 100 a 200MPa • Disociación de estructuras oligoméricas • parcial desnaturalización de las estructuras monoméricas • agregación proteica 15

×