Securite et surete maritime
Upcoming SlideShare
Loading in...5
×
 

Securite et surete maritime

on

  • 711 views

 

Statistics

Views

Total Views
711
Views on SlideShare
711
Embed Views
0

Actions

Likes
0
Downloads
27
Comments
0

0 Embeds 0

No embeds

Accessibility

Categories

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

  Securite et surete maritime Securite et surete maritime Document Transcript

  • UUUUUUUUNNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEERRRRRRRRSSSSSSSSIIIIIIIITTTTTTTTEEEEEEEE DDDDDDDDEEEEEEEE DDDDDDDDRRRRRRRROOOOOOOOIIIIIIIITTTTTTTT,,,,,,,, DDDDDDDD''''''''EEEEEEEE FFFFFFFFAAAAAAAACCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEE DDDDDDDD CCCCCCCCeeeeeeeennnnnnnnttttttttrrrrrrrreeeeeeee dddddddd SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE EEEEEEEETTTTTTTT SSSSSSSSUUUUUUUURRRRRRRREEEE DDDDDDDDEEEEEEEESSSSSSSS TTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEESSSSSSSS AAAAAAAA LLLLLLLLAAAAAAAA MMMMMMMMEEEEEEEEMMMMMMMMOOOOOOOOIIIIIIIIRRRRRRRREEEEEEEE DDDDDDDDiiiiiiiippppppppllllllllôôôôôôôômmmmmmmmeeeeeeee dddddddd''''''''EEEEEEEEttttttttuuuuuuuuddddddddeeeeeeeessssssss SSSSSSSS mmmmmmmmaaaaaaaarrrrrrrriiiiiiiittttttttiiiiiiiimmmmmmmmeeeeeeee eeeeeeeetttttttt ddddddddeeeeeeeessssssss ttttttttrrrrrrrraaaaaaaa PPPPPPPPRRRRRRRREEEEEEEESSSSSSSSEEEEEEEENNNNNNNNTTTTTTTTEEEEEEEE PPPPPPPPAAAAAAAARRRRRRRR MMMMMMMMoooooooo AAAAAAAAnnnnnnnnnnnnnnnnééééééééeeeeeeee 22222222000000000000000022222222 SSSSSSSSOOOOOOOOMMMMMMMMMMMMMMMMAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEE IIIIIIIINNNNNNNNTTTTTTTTRRRRRRRROOOOOOOODDDDDDDDUUUUUUUUCCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN 33333333 PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRREEEEEEEE PPPPPPPPAAAAAAAARRRRRRRRTTTTTTTTIIIIIIIIEEEEEEEE :::::::: LLLLLLLLAAAAAAAA SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIII SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: SSSSSSSSOOOOOOOOUUUUUUUURRRRRRRRCCCCCCCCEEEEEEEE EEEEEEEETTTTTTTT LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTT SSSSSSSSAAAAAAAANNNNNNNNSSSSSSSS CCCCCCCCEEEEEEEESSSSSSSSSSSSSSSSEEEEEEEE EEEEEEEENNNNNNNN EEEEEEEESSSSSSSSSSSSSSSSOOOOOOOORRRRRRRR SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: GGGGGGGGEEEEEEEENNNNNNNNEEEEEEEESSSSSSSSEEEEEEEE DDDDDDDD''''''''UUUUUUUU LLLLLLLL''''''''AAAAAAAAMMMMMMMMEEEEEEEELLLLLLLLIIIIIIIIOOOOOOOORRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRR SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE EEEEEEEECCCCCCCCOOOOOOOONNNNNNNNOOOOOOOOMMMMMMMMIIIIIIIIEEEEEEEE EEEEEEEETTTTTTTT DDDDDDDDEEEEEEEESSSSSSSS SSSSSSSSCCCCCCCCIIIIIIIIEEEEEEEENNNNNNNNCCCCCCCCEEEEEEEESSSSSSSS --------AAAAAAAA DDDDDDDDEEEEEEEE DDDDDDDDRRRRRRRROOOOOOOOIIIIIIIITTTTTTTT EEEEEEEETTTTTTTT DDDDDDDDEEEEEEEE SSSSSSSSCCCCCCCCIIIIIIIIEEEEEEEENNNNNNNNCCCCCCCCEEEEEEEE PPPPPPPPOOOOOOOOLLLLLLLLIIIIIIIITTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUU ddddddddeeeeeeee DDDDDDDDrrrrrrrrooooooooiiiiiiiitttttttt MMMMMMMMaaaaaaaarrrrrrrriiiiiiiittttttttiiiiiiiimmmmmmmmeeeeeeee eeeeeeeetttttttt ddddddddeeeeeeeessssssss TTTTTTTTrrrrrrrraaaaaaaannnnnnnnssssssssppppppppoooooooorrrrrrrrttttttttssssssss DDDDDDDDiiiiiiiirrrrrrrreeeeeeeecccccccctttttttteeeeeeeeuuuuuuuurrrrrrrr:::::::: SSSSSSSSeeeeeeeerrrrrrrrggggggggeeeeeeee JJJJJJJJaaaaaaaauuuuuuuummmmmmmmaaaaaaaaiiiiiiiinnnnnnnn RRRREEEEEEEETTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE :::::::: DDDDDDDDEEEEEEEE LLLLLLLL''''''''EEEEEEEELLLLLLLL AAAAAAAA DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEE DDDDDDDDEEEEEEEE MMMMMMMMIIIIIIIISSSSSSSSEEEEEEEE EEEEEEEE SSSSSSSSuuuuuuuuppppppppéééééééérrrrrrrriiiiiiiieeeeeeeeuuuuuuuurrrrrrrreeeeeeeessssssss SSSSSSSSppppppppéééééééécccccccciiiiiiiiaaaaaaaalllllllliiiiiiiisssssssséééééééé aaaaaaaannnnnnnnssssssssppppppppoooooooorrrrrrrrttttttttssssssss oooooooonnnnnnnnssssssssiiiiiiiieeeeeeeeuuuuuuuurrrrrrrr HHHHHHHHAAAAAAAAFFFFFFFFFFFFFFFFAAAAAAAAFFFFFFFF MMMMMMMMOOOOOOOOHHHHHHHHAAAAAAAAMMMMMMMM IIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE 66666666 TTTTTTTTIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE DDDDDDDD''''''''UUUUUUUUNNNNNNNNEEEEEEEE RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN 66666666 UUUUUUUUNNNNNNNNEEEEEEEE RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN EEEEEEEENNNNNNNN FFFFFFFFAAAAAAAAVVVVVVVVEEEEEEEEUUUUUUUURRRRRRRR RRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE :::::::: 66666666 EEEEEEEE EEEEEEEETTTTTTTT EEEEEEEEFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCAAAAAAAACCCCCCCCIIIIIIIITTTTTTTTEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFEEEEEEEERRRRRRRREEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS AAAAAAAANNNNNNNNGGGGGGGGEEEEEEEERRRRRRRRSSSSSSSS UUUUUUUUEEEEEEEE LLLLLLLLAAAAAAAABBBBBBBBOOOOOOOORRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN EEEEEEEENNNNNNNN ŒŒŒŒŒŒŒŒUUUUUUUUVVVVVVVVRRRRRRRREEEEEEEE ééééééééeeeeeeeessssssss eeeeeeeennnnnnnn ddddddddrrrrrrrrooooooooiiiiiiiitttttttt MMMMMMMMEEEEEEEEDDDDDDDD SSSSSSSSAAAAAAAAIIIIIIIIDDDDDDDD DDDDDDDDEEEEEEEE
  • NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUUXXXXXXXX DDDDDDDD''''''''IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRVVVVVVVVEEEEEEEENNNNNNNNTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN 2222222233333333 SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: DDDDDDDDOOOOOOOOMMMMMMMMAAAAAAAAIIIIIIIINNNNNNNNEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS TTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEESSSSSSSS EEEEEEEETTTTTTTT RRRRRRRREEEEEEEESSSSSSSSPPPPPPPPEEEEEEEECCCCCCCCTTTTTTTT DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN 4444444444444444 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS TTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEESSSSSSSS EEEEEEEEXXXXXXXXIIIIIIIISSSSSSSSTTTTTTTTAAAAAAAANNNNNNNNTTTTTTTTSSSSSSSS EEEEEEEETTTTTTTT LLLLLLLLEEEEEEEEUUUUUUUURRRRRRRR DDDDDDDDOOOOOOOOMMMMMMMMAAAAAAAAIIIIIIIINNNNNNNNEEEEEEEE 4444444444444444 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII ::::::::LLLLLLLLEEEEEEEESSSSSSSS AAAAAAAACCCCCCCCTTTTTTTTEEEEEEEEUUUUUUUURRRRRRRRSSSSSSSS DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA CCCCCCCCHHHHHHHHAAAAAAAAÎÎÎÎÎÎÎÎNNNNNNNNEEEEEEEE DDDDDDDDEEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE 5555555500000000 DDDDDDDDEEEEEEEEUUUUUUUUXXXXXXXXIIIIIIIIEEEEEEEEMMMMMMMMEEEEEEEE PPPPPPPPAAAAAAAARRRRRRRRTTTTTTTTIIIIIIIIEEEEEEEE ::::::::VVVVVVVVEEEEEEEERRRRRRRRSSSSSSSS UUUUUUUUNNNNNNNNEEEEEEEE NNNNNNNNOOOOOOOOUUUUUUUUVVVVVVVVEEEEEEEELLLLLLLLLLLLLLLLEEEEEEEE IIIIIIIIDDDDDDDDEEEEEEEEEEEEEEEE DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE:::::::: LLLLLLLLAAAAAAAA SSSSSSSSUUUUUUUURRRRRRRREEEEEEEETTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE 6666666677777777 SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: EEEEEEEEMMMMMMMMEEEEEEEERRRRRRRRGGGGGGGGEEEEEEEENNNNNNNNCCCCCCCCEEEEEEEE DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA NNNNNNNNOOOOOOOOTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEE SSSSSSSSÛÛÛÛÛÛÛÛRRRRRRRREEEEEEEETTTTTTTTEEEEEEEE 6666666677777777 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: LLLLLLLLEEEEEEEE CCCCCCCCOOOOOOOONNNNNNNNTTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEE 6666666677777777 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEEMMMMMMMMAAAAAAAARRRRRRRRCCCCCCCCHHHHHHHHEEEEEEEESSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEESSSSSSSS 7777777733333333 SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEE MMMMMMMMIIIIIIIISSSSSSSSEEEEEEEE EEEEEEEENNNNNNNN OOOOOOOOEEEEEEEEUUUUUUUUVVVVVVVVRRRRRRRREEEEEEEE 8888888800000000 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEESSSSSSSS PPPPPPPPOOOOOOOOLLLLLLLLIIIIIIIITTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE OOOOOOOOUUUUUUUU «««««««« DDDDDDDDIIIIIIIIPPPPPPPPLLLLLLLLOOOOOOOOMMMMMMMMAAAAAAAATTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE »»»»»»»» 8888888800000000 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEE LLLLLLLLOOOOOOOOGGGGGGGGIIIIIIIISSSSSSSSTTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE 8888888833333333 CCCCCCCCOOOOOOOONNNNNNNNCCCCCCCCLLLLLLLLUUUUUUUUSSSSSSSSIIIIIIIIOOOOOOOONNNNNNNN 8888888866666666 TTTTTTTTAAAAAAAABBBBBBBBLLLLLLLLEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS AAAAAAAABBBBBBBBRRRRRRRREEEEEEEEVVVVVVVVIIIIIIIIAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS AAAAAAAAIIIIIIIISSSSSSSS :::::::: AAAAAAAAUUUUUUUUTTTTTTTTOOOOOOOOMMMMMMMMAAAAAAAATTTTTTTTIIIIIIIICCCCCCCC IIIIIIIIDDDDDDDDEEEEEEEENNNNNNNNTTTTTTTTIIIIIIIIFFFFFFFFIIIIIIIICCCCCCCCAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN SSSSSSSSYYYYYYYYSSSSSSSSTTTTTTTTEEEEEEEEMMMMMMMM AAAAAAAAUUUUUUUUTTTTTTTTFFFFFFFF :::::::: AAAAAAAASSSSSSSSSSSSSSSSOOOOOOOOCCCCCCCCIIIIIIIIAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEESSSSSSSS UUUUUUUUTTTTTTTTIIIIIIIILLLLLLLLIIIIIIIISSSSSSSSAAAAAAAATTTTTTTTEEEEEEEEUUUUUUUURRRRRRRRSSSSSSSS DDDDDDDDEEEEEEEE TTTTTTTTRRRRRRRRAAAAAAAANNNNNNNNSSSSSSSSPPPPPPPPOOOOOOOORRRRRRRRTTTTTTTT DDDDDDDDEEEEEEEE FFFFFFFFRRRRRRRREEEEEEEETTTTTTTT CCCCCCCCSSSSSSSSIIIIIIII :::::::: CCCCCCCCOOOOOOOONNNNNNNNTTTTTTTTAAAAAAAAIIIIIIIINNNNNNNNEEEEEEEERRRRRRRR SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTYYYYYYYY IIIIIIIINNNNNNNNIIIIIIIITTTTTTTTIIIIIIIIAAAAAAAATTTTTTTTIIIIIIIIVVVVVVVVEEEEEEEE IIIIIIIIAAAAAAAACCCCCCCCSSSSSSSS :::::::: IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL AAAAAAAASSSSSSSSSSSSSSSSOOOOOOOOCCCCCCCCIIIIIIIIAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN OOOOOOOOFFFFFFFF CCCCCCCCLLLLLLLLAAAAAAAASSSSSSSSSSSSSSSS SSSSSSSSOOOOOOOOCCCCCCCCIIIIIIIIEEEEEEEETTTTTTTTYYYYYYYY IIIIIIIISSSSSSSSPPPPPPPPSSSSSSSS CCCCCCCCOOOOOOOODDDDDDDDEEEEEEEE:::::::: IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL SSSSSSSSHHHHHHHHIIIIIIIIPPPPPPPP AAAAAAAANNNNNNNNDDDDDDDD PPPPPPPPOOOOOOOORRRRRRRRTTTTTTTT SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTYYYYYYYY CCCCCCCCOOOOOOOODDDDDDDDEEEEEEEE LLLLLLLLLLLLLLLL6666666666666666 :::::::: LLLLLLLLOOOOOOOOAAAAAAAADDDDDDDD LLLLLLLLIIIIIIIINNNNNNNNEEEEEEEESSSSSSSS 6666666666666666 OOOOOOOOCCCCCCCCDDDDDDDDEEEEEEEE :::::::: OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAANNNNNNNNIIIIIIIISSSSSSSSAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEE CCCCCCCCOOOOOOOOOOOOOOOOPPPPPPPPEEEEEEEERRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN EEEEEEEETTTTTTTT DDDDDDDDEEEEEEEE DDDDDDDDEEEEEEEEVVVVVVVVEEEEEEEELLLLLLLLOOOOOOOOPPPPPPPPPPPPPPPPEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT EEEEEEEECCCCCCCCOOOOOOOONNNNNNNNOOOOOOOOMMMMMMMMIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEESSSSSSSS OOOOOOOOEEEEEEEECCCCCCCCDDDDDDDD :::::::: OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAANNNNNNNNIIIIIIIISSSSSSSSAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN FFFFFFFFOOOOOOOORRRRRRRR EEEEEEEECCCCCCCCOOOOOOOONNNNNNNNOOOOOOOOMMMMMMMMIIIIIIIICCCCCCCC CCCCCCCCOOOOOOOO OOOOOOOOPPPPPPPPEEEEEEEERRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN AAAAAAAANNNNNNNNDDDDDDDD DDDDDDDDEEEEEEEEVVVVVVVVEEEEEEEELLLLLLLLOOOOOOOOPPPPPPPPMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT OOOOOOOOIIIIIIIITTTTTTTT :::::::: OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAANNNNNNNNIIIIIIIISSSSSSSSAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLLEEEEEEEE DDDDDDDDUUUUUUUU TTTTTTTTRRRRRRRRAAAAAAAAVVVVVVVVAAAAAAAAIIIIIIIILLLLLLLL //////// IIIIIIIILLLLLLLLOOOOOOOO :::::::: IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL LLLLLLLLAAAAAAAABBBBBBBBOOOOOOOOUUUUUUUURRRRRRRR OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAANNNNNNNNIIIIIIIIZZZZZZZZAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN OOOOOOOOMMMMMMMMIIIIIIII :::::::: OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAANNNNNNNNIIIIIIIISSSSSSSSAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLLEEEEEEEE //////// IIIIIIIIMMMMMMMMOOOOOOOO :::::::: IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIINNNNNNNNEEEEEEEE OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAANNNNNNNNIIIIIIIIZZZZZZZZAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN OOOOOOOOMMMMMMMMDDDDDDDD :::::::: OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAANNNNNNNNIIIIIIIISSSSSSSSAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN MMMMMMMMOOOOOOOONNNNNNNNDDDDDDDDIIIIIIIIAAAAAAAALLLLLLLLEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS DDDDDDDDOOOOOOOOUUUUUUUUAAAAAAAANNNNNNNNEEEEEEEESSSSSSSS ////////
  • WWWWWWWWCCCCCCCCOOOOOOOO :::::::: WWWWWWWWOOOOOOOORRRRRRRRLLLLLLLLDDDDDDDD CCCCCCCCUUUUUUUUSSSSSSSSTTTTTTTTOOOOOOOOMMMMMMMMSSSSSSSS OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAA OOOOOOOOPPPPPPPPAAAAAAAA :::::::: OOOOOOOOIIIIIIIILLLLLLLL PPPPPPPPOOOOOOOOLLLLLLLLLLLLLLLLUUUUUUUUTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN AAAAAAAACCCCCCCCTTTTTTTT SSSSSSSSOOOOOOOOLLLLLLLLAAAAAAAASSSSSSSS:::::::: SSSSSSSSAAAAAAAAFFFFFFFFEEEEEEEETTTTTTTTYYYYYYYY OOOOOOOOFFFFFFFF LLLLLLLLIIIIIIIIFFFFFFFFEEEEEEEE AAAAAAAATTTTTTTT SSSSSSSSEEEEEEEE SSSSSSSSTTTTTTTTCCCCCCCCWWWWWWWW:::::::: SSSSSSSSTTTTTTTTAAAAAAAANNNNNNNNDDDDDDDDAAAAAAAARRRRRRRRDDDDDDDDSSSSSSSS OOOOOOOOFFFFFFFF TTTTTTTTRRRRRRRRAAAAAAAAIIIIIIIINNNNNNNNIIIIIIII SSSSSSSSEEEEEEEEAAAAAAAAFFFFFFFFEEEEEEEERRRRRRRREEEEEEEERRRRRRRRSSSSSSSS IIIIIIIINNNNNNNNTTTTTTTTRRRRRRRROOOOOOOODDDDDDDDUUUUUUUUCCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN «« LLaa ssûûrreettéé eett llaa ssééccuurriittéé ssoonntt uu cciittooyyeennss eexxiiggeenntt ddeess mmeessuurreess cc LLooyyoollaa ddee PPaallaacciioo,, vviiccee pprrééssiiddeenn rreessppoonnssaabbllee ddeess ttrraannssppoorrttss eett dd mméémmooiirree :: iillss ttrraadduuiisseenntt llee ffaaiitt vvoolloonnttéé dd''ééllaabboorraattiioonn ddee rrèègglleemm mmaarriittiimmee mmaaiiss ééggaalleemmeenntt ddaannss IIll sseemmbblleerraaiitt qquuee ssééccuurriittéé eett ssûû rrééfflleexxiioonnss eennggaaggééeess ppoouurr ll''aamméé «« sseeccuurriittyy »» ppoouurr ssûûrreettéé eett «« ssaa mmaaiinntteennaanntt ppaarrttiieess dduu mmêêmmee ccoo CCee mméémmooiirree ttrraaiitteerraa ddoonncc ddee ccee ttrrèèss rréécceemmmmeenntt ffeerraa ll''oobbjjeett ddee PPoouurr ll''ééttuuddee ddee llaa pprreemmiièèrree ppaarr ccoonntteenntteerroonnss dd''ééttuuddiieerr cceettttee nnoo ccoonnssiiddéérreerraaii ll''aannnnééee 11991122 ccoommmm llaa ppoorrttééee iinntteerrnnaattiioonnaallee ddee llaa vvoo aappppaarruu rrééeelllleemmeenntt qquu''àà llaa ssuuiittee llaa ssééccuurriittéé mmaarriittiimmee ééttaanntt ssii vvaa eeuurrooppééeennnnee // OOMMII eett nnaattiioonnaauuxx ddeess EEttaattss--UUnniiss,, lleess aauuttrreess ppaarrttiie ssoonntt dd''aaiilllleeuurrss bbiieenn ssoouuvveenntt rrééee AAuujjoouurrdd''hhuuii llee nnoomm dduu ffeerrrryy pphhii ddee MMaanniillllee eennttrraaîînnaanntt ddaannss llaa mm ddee llaa ppooppuullaattiioonn eeuurrooppééeennnnee ;; cc pprreemmiièèrree ppaarrttiiee eesstt pprriinncciippaalleemm ééttaanntt llaa rrééssuullttaanntt ddee ll''aannaallooggiiee mmêêmmee ddee tteexxtteess ooffffiicciieellss ddee llaa CC mmaarriittiimmee eett ppoolllluuttiioonn dduu lliittttoorraall LLaa pprreemmiièèrree ppaarrttiiee ttrraaiitteerraa ddoonnc ccoonncceerrnnee ll''aannaallyyssee ddee ll''aappppaarriittiioo mmaarriittiimmee eett llaa llééggiittiimmiittéé ddeess ddiiff EEnn eeffffeett ddaannss uunn pprreemmiieerr tteemmppss rréégglleemmeennttaaiirree àà ssuuiivvii ppaass àà ppaass ccaauusseess qquuii oonntt eennttrraaîînnéé cceett éévvèè AAAAAAAANNNNNNNNIIIIIIIIZZZZZZZZAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN EEEEEEEEAAAAAAAA IIIIIIIINNNNNNNNGGGGGGGG,,,,,,,, CCCCCCCCEEEEEEEERRRRRRRRTTTTTTTTIIIIIIIIFFFFFFFFIIIIIIIICCCCCCCCAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN AAAAAAAANNNNNNNNDDDDDDDD WWWWWWWWAAAAAAAATTTTTTTTCCCCCCCCHHHHHHHHKKKKKKKKEEEEEEEE NNNNNNNN uunnee ddeess pprriioorriittééss mmaajjeeuurreess ddee cceettttee ccoonnccrrèètteess ddaannss ccee ddoommaaiinnee »» :: cceess pp nnttee ddee llaa CCoommmmiissssiioonn EEuurrooppééeennnnee eet ddee ll''éénneerrggiiee,, rrééssuummeenntt eenn ggrraannddee ppaa qquuee ll''ooppiinniioonn ppuubblliiqquuee ttiieenntt uunn rrôôllee mmeennttss ddaannss lleess sseecctteeuurrss ddee llaa ssééccuurriitt ss lleeuurr mmiissee eenn ooeeuuvvrree.. ûûrreettéé mmaarriittiimmee ssooiieenntt ddeevveennuueess iinnddiiss éélliioorraattiioonn dduu sseecctteeuurr mmaarriittiimmee.. FFaauuxx aaffeettyy »» ppoouurr ssééccuurriittéé,, cceess ddeeuuxx nnoottiioo ooddee ttiirréé ddee llaa CCoonnvveennttiioonn SSOOLLAASS.. eess ddeeuuxx nnoottiioonnss,, llaa nnoottiioonn ddee ssûûrreettéé llaa sseeccoonnddee ppaarrttiiee.. rrttiiee ccoonnssaaccrrééee àà llaa ssééccuurriittéé mmaarriittiimmee oottiioonn àà ppaarrttiirr dduu XXXXèèmmee ssiièèccllee eett pplluu mmee ppooiinntt ddee ddééppaarrtt,, llee bbuutt ddee cceettttee éé oolloonnttéé ppoolliittiiqquuee ssééccuurriittaaiirree,, iinntteerrnnaatt ee ddee llaa ccaattaassttrroopphhee dduu TTIITTAANNIICC.. DDee mm aassttee,, sseeuullee uunnee ééttuuddee ddeess rraappppoorrttss CC xx ppoouurr ccee qquuii eesstt ddee llaa FFrraannccee eett ddaann ieess dduu gglloobbeess aayyaanntt ééttéé vvoolloonnttaaiirreemmee eelllleemmeenntt,, qquuee ccee ssooiitt ddaannss lleess ffaaiittss oo iilliippppiinn DDOONNAA PPAAZZ qquuii aa ssoommbbrréé àà 1166 mmoorrtt 11663300 ppeerrssoonnnneess nn''éévvooqquuee pplluuss gg cceellaa ss''eesstt pprroodduuiitt eenn 11998877.. IInnvvoolloonnttaa mmeenntt aaxxééee ssuurr llee ttrraannssppoorrtt dd''hhyyddrrooccaa qquuee ffoonntt ggrraanndd nnoommbbrree ddee ppeerrssoonnnnee CCoommmmuunnaauuttéé EEuurrooppééeennnnee eett ddee ll''OOMM ll ncc ddee llaa ssééccuurriittéé mmaarriittiimmee eett llaa sseeccttiioo oonn dduu ccaaddrree rréégglleemmeennttaaiirree eenn mmaattiièè fffféérreennttss nniivveeaauuxx qquuii iinntteerrvviieennnneenntt dda ss nnoouuss ppoouurrrroonnss ccoonnssttaatteerr qquuee ll''ééllaabb ss ll''hhiissttooiirree ddeess ccaattaassttrroopphheess mmaarriittiimm èènneemmeenntt eett qquuee cceettttee ééllaabboorraattiioonn eesstt EEEEEEEEEEEEEEEEPPPPPPPPIIIIIIIINNNNNNNNGGGGGGGG FFFFFFFFOOOOOOOORRRRRRRR ccoommmmiissssiioonn :: nnooss pprrooppooss tteennuuss ppaarr MMmmee ett ccoommmmiissssaaiirree aarrttiiee ll''oobbjjeeccttiiff ddee ccee iimmppoorrttaanntt ddaannss llaa ttéé eett ddee llaa ssûûrreettéé ssssoocciiaabblleess lloorrss ddeess aammiiss eenn AAnnggllaaiiss,, oonnss ffaaiissaanntt nn''ééttaanntt aappppaarruuee qquuee ee nnoouuss nnoouuss uuss pprréécciisséémmeenntt jjee ééttuuddee ééttaanntt dd''éénnoonncceerr ttiioonnaalliissmmee qquuii nn''eesstt mmêêmmee llee ddoommaaiinnee ddee CCoommmmuunnaauuttéé nnss cceerrttaaiinnss ddoommaaiinneess eenntt ooccccuullttééeess.. EElllleess llee oouu ppoouurr llee mmééddiiaa.. 6600 kkiilloommèèttrreess aauu ssuudd ggrraanndd--cchhoossee aauupprrèèss aaiirreemmeenntt cceettttee aarrbbuurreess ppaarr mmeerr,, cceeccii eess eett jjoouurrnnaalliisstteess,, eett MMII,, eennttrree ssééccuurriittéé oonn uunnee ddee ccee cchhaappiittrree èèrree ddee ssééccuurriittéé aannss ccee sseecctteeuurr.. bboorraattiioonn ddee ccee ccaaddrree mmee aapprrèèss aannaallyyssee ddeess tt bbiieenn ssoouuvveenntt
  • mmoottiivvééee vvooiirree eennttrraavvéé ppaarr llee ccoo pprreessssiioonn ppooppuullaaiirree aa rrééuussssii àà ssuu DDaannss uunn sseeccoonndd tteemmppss nnoouuss ééttu nniivveeaauu dd''iinntteerrvveennttiioonn ddaannss llee ddo ssuupprraannaattiioonnaauuxx,, qquu''iillss ssooiieenntt mm ssooiieenntt ééttaattiiqquueess oouu rrééggiioonnaauuxx.. LLaa ttrraannssiittiioonn vveerrss llaa ddeeuuxxiièèmmee s rréégglleemmeennttaaiirree sseerraa rrééaalliisséé aauu mm llééggiissllaattiioonn eenn mmaattiièèrree ddee ppééttrrooll qquu''iill eexxiissttee àà ddééffiinniirr qquueellllee ddeevvrr dduu sseecctteeuurr ddee llaa ssééccuurriittéé mmaarriittii AApprrèèss aavvooiirr aannaallyysséé llee pprroocceessssuu ssééccuurriittéé mmaarriittiimmee,, iill ccoonnvviieennddrraa ppaarrttiiee llee ccaaddrree gglloobbaallee ddee llaa sséécc ssééccuurriittéé mmaarriittiimmee eett lleess mmeessuurree pplluuss gglloobbaallee dduu ddoommaaiinnee ttrrèèss llaa ppaarrttiiee ppaarr ll''ééttuuddee ddee llaa cchhaaîînnee dd aacctteeuurrss ddee llaa ssééccuurriittéé mmaarriittiimmee ccoommmmee nnoouuss ll''aauurroonnss pprréécciisséé pp nnaavviiggaattiioonn mmaarriittiimmee aayyaanntt ppoouurr cceettttee cchhaaîînnee ddee ssééccuurriittéé ssoonntt llee LLaa sseeccoonnddee nnoottiioonn,, cceellllee ddee llaa ss ttrraaiittéé ddee mmaanniièèrree aauussssii llaarrggee qquu ddeeuuxx pprriinncciippaalleess iiddééeess qquuii ffeerroonn IInnéévviittaabblleemmeenntt llaa pprreemmiièèrree sseecc mmaarriittiimmee aavveecc uunnee pprreemmiièèrree ssoo EEnn eeffffeett aavvaanntt dd''aalllleerr pplluuss aavvaann tteennaannttss eett lleess aabboouuttiissssaannttss cc''eess ss''eesstt ddéévveellooppppeerr cceettttee nnoottiioonn.. EE ssééccuurriittaaiirreess eennggaaggééeess ddeeppuuiiss ppee qquuii dduurreemmeenntt ttoouucchhééss ppaarr llee ttee lliiéé àà llaa ssûûrreettéé mmaarriittiimmee.. MMaallhheeuurreeuusseemmeenntt eett ttoouutt ccoommmm ll''oonntt ééttéé eenn rrééppoonnssee àà uunnee ccaattaa llééggiissllaattiioonn,, oobbjjeett dd''uunnee rrééaaccttiioonn sseennttiirr ttrrèèss rraappiiddeemmeenntt,, ddiiffffiiccuulltt ddiiffffiiccuullttééss aappppaarraaiisssseenntt ttaanntt ssuurr mmiissee eenn ppllaaccee ddeess mmooyyeennss ppoouurr .. PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRREEEEEEEE PPPPPPPPAAAAAAAARRRRRRRRTTTTTTTT MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE oonntteexxttee ééccoonnoommiiqquuee qquuee sseeuullee,, jjuussqquu uurrmmoonntteerr.. uuddiieerroonnss llaa llééggiittiimmiittéé eett ssuurrttoouutt ll''eeffff doommaaiinnee nnoorrmmaattiiff,, eenn pprreemmiieerr lliieeuu lleess mmoonnddiiaauuxx oouu eeuurrooppééeennss,, eett lleess nniivveeaauu sseeccttiioonn ééttuuddiiééee qquuii sseerraa cceellllee dduu rreess mmooyyeenn ddee ll''eexxeemmppllee ddee ll''éévvoolluuttiioonn ttoo lliieerr ddoouubbllee ccooqquuee aaffiinn ddee mmeettttrree eenn é rraaiitt êêttrree ll''aauuttoorriittéé ssuupprrêêmmee eenn mmaattiièè iimmee.. uuss dd''ééllaabboorraattiioonn ddee llaa rréégglleemmeennttaattiioonn aa dd''ééttuuddiieerr,, ddaannss llaa ddeeuuxxiièèmmee sseeccttiioo ccuurriittéé mmaarriittiimmee àà ssaavvooiirr lleess ddiifffféérreenntt eess ddééjjàà pprriisseess ddaannss cceess ddoommaaiinneess aaff aarrggee ddee llaa ssééccuurriittéé mmaarriittiimmee aavvaanntt dd ddee llaa ssééccuurriittéé mmaarriittiimmee,, cchhaaîînnee ccoonnss ee qquu''iillss ssooiieenntt ggoouuvveerrnneemmeennttaauuxx oouu pp pprrééccééddeemmmmeenntt nnoommbbrree ddee tteexxtteess rréégg rr oobbjjeett llaa ssééccuurriittéé mmaarriittiimmee eexxiisstteenntt eess ggaarraannttss ddee llaa mmiissee eenn ooeeuuvvrree ddee cc ssûûrreettéé,, ééttaanntt aappppaarruu ttrrèèss rréécceemmmmeenn uuee llaa nnoottiioonn ddee ssééccuurriittéé,, mmaaiiss nnoouuss p nntt aaiinnssii ll''oobbjjeett ddee ddeeuuxx sseeccttiioonnss.. ccttiioonn ttrraaiitteerraa ddee ll''aappppaarriittiioonn ddee cceettttee oouuss sseeccttiioonn qquuii nnoouuss ppeerrmmeettttrraa ddee «« nntt ddaannss ll''ééttuuddee ddee llaa ssûûrreettéé iill ccoonnvviieenn sstt--àà--ddiirree llee ccoonntteexxttee hhiissttoorriiqquuee eett éécc EEtt nnoouuss ppoouurrrroonnss eennssuuiittee ddééccoouuvvrriirr ll eeuu ppaarr lleess iinnssttaanncceess iinntteerrnnaattiioonnaalleess eerrrroorriissmmee ssee ssoonntt éérriiggééss eenn ppoorrttee ddrraa mmee ppoouurr llaa ssééccuurriittéé mmaarriittiimmee lleess ddéémm aassttrroopphhee qquuii aa mmaarrqquuéé lleess eesspprriittss.. EEtt nn,, lleess pprreemmiièèrreess ddiiffffiiccuullttééss àà llaa mmiissee ttééss qquuii sseerroonntt ttrraaiittééeess ddaannss llaa ddeeuuxxiièè rr llee ppllaann ddiipplloommaattiiqquuee qquuee ssuurr llee ppllaa rr rreessppeecctteerr cceettttee nnoouuvveellllee rréégglleemmeenntt TTTTTTTTIIIIIIIIEEEEEEEE :::::::: LLLLLLLLAAAAAAAA SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE uu''àà pprréésseenntt,, llaa ffiiccaacciittéé ddee cchhaaqquuee ss nniivveeaauuxx uuxx nnaattiioonnaauuxx,, qquu''iillss ssppeecctt ddee ccee ccaaddrree oouuttee rréécceennttee ddee llaa éévviiddeennccee llaa ddiiffffiiccuullttéé èèrree ddee rréégglleemmeennttaattiioonn nn eenn mmaattiièèrree ddee oonn ddee cceettttee pprreemmiièèrree ttss ddoommaaiinneess ddee llaa ffiinn dd''oobbtteenniirr uunnee vviissiioonn ddee ppoouuvvooiirr cclloorree cceettttee ssttiittuuééee ppaarr ttoouuss lleess pprriivvééss.. EEnn eeffffeett gglleemmeennttaanntt llaa tt mmaaiiss lleess aacctteeuurrss ddee cceess tteexxtteess.. nntt,, nnee ppoouurrrraa êêttrree ppoouuvvoonnss ddééjjàà ddééggaaggeerr ee nnoottiioonn ddee ssûûrreettéé ppllaanntteerr llee ddééccoorrss »».. nntt ddee ccoonnnnaaîîttrree lleess ccoonnoommiiqquuee ddaannss lleeqquueell lleess ddéémmaarrcchheess eett ppaarr lleess EEttaattss--UUnniiss aappeeaauu dduu mmoouuvveemmeenntt mmaarrcchheess eennggaaggééeess tt ttoouutt ccoommmmee nnoouuvveellllee eenn ooeeuuvvrree ssee ssoonntt ffaaiitt èèmmee sseeccttiioonn.. CCeess aann ddee llaa llooggiissttiiqquuee ddee ttaattiioonn.. EEEEEEEE
  • SSSSSSSSeeeeeeeeccccccccttttttttiiiiiiiioooooooonnnnnnnn 11111111 :::::::: SSSSSSSSOOOOOOOOUUUUUUUURRRRRRRRCCCCCCCCEEEEEEEE RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN SSSSSSSS IIll ccoonnvviieenntt ttoouutt dd''aabboorrdd dd''aannaallyy mmaattiièèrree ddee ssééccuurriittéé mmaarriittiimmee aav ppeeuutt êêttrree aattttrriibbuuééee.. SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: GGGGGGGGEEEEEEEENNNNNNNNEEEEEEEESSSSSSSSEEEEEEEE LLLLLLLL''''''''AAAAAAAAMMMMMMMMEEEEEEEELLLLLLLLIIIIIIIIOOOOOOOORRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA SSSSSSSSEEEEEEEECCCCCCCC CCoommpprreennddrree llee cchheemmiinneemmeenntt dd ssééccuurriittéé mmaarriittiimmee,, nnoouuss iimmppoossee ccoommmmeenntt éémmeerrggee llaa ccoonnsscciieennccee nnéécceessssaaiirree eett llaa ddeeuuxxiièèmmee ppoorrttee ccoonnsscciieennccee eett llaa vvoolloonnttéé ppoolliittiiqquu CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRR :::::::: LLLLLLLLEEEEEEEESSSSSSSS EEEEEEEEVVVVVVVVEEEEEEEENNNNNNNN §§11..11 :: LLEESS CCAATTAASSTTRROOPPHHEESS IINNSS AAvvrriill 11991122 :: LLee TTIITTAANNIICC((22)),, ppaaqq iinnaauugguurraallee eennttrree SSoouutthhssaammppttoonn ssoonn bboorrdd ,,ssoommbbrree aauu llaarrggee ddee TT ééggaalleemmeenntt ddee ll''oorrgguueeiill ddéémmeessuurr ((((((((11111111)))))))) :::::::: LLaa pprreessttiiggiieeuussee rrééccoommppeenn ttrraavveerrsséé ddee ll''aattllaannttiiqquuee llee pplluuss ccoommppaaggnniiee CCUUNNAARRDD.. LLeess ddiivveerrss ll''aarrmmaatteeuurr àà bboorrdd dduu TTIITTAANNIICC aa llaa vviitteessssee mmaallggrréé ddeess aalleerrtteess mm ppaarraaggeess dduu TTIITTAANNIICC LLaa rraappiiddiittéé àà llaaqquueellllee aa ssoommbbrréé pplluuss ddee 11550000 ppeerrssoonnnneess ((ffeemmmm ddééccoouuvvrree aalloorrss ll''aammpplleeuurr dd''uunnee mmaarriittiimmee qquuaanntt àà eeuuxx ddooiivveenntt rr oouubblliieerr aavveecc llaa mmooddeerrnniissaattiioonn tt jjaammaaiiss uunn mmiilliieeuu hhoossttiillee àà ll''hhoomm oouubblliieerr.. VVuu ll''aammpplleeuurr ddee llaa ccaattaa bbeeaauuccoouupp dd''aarriissttooccrraatteess AAnnggllaaiiss 11991144 eett mmiiss eenn éévviiddeennccee ddee nnoom aauuttrreess oonntt eennttrraaîînnéé cceett éévvèènneemm EEnn pprreennaanntt ll''eexxeemmppllee dduu TTIITTAANN ggrraanndd ppuubblliicc,, ccee ppaaqquueebboott ééttaaiitt lleess nnoommbbrreeuusseess llaaccuunneess ddaannss llee nnaavviirreess.. CC''eesstt aaiinnssii qquuee cceettttee éévvèènneemmeenn iinntteerrnnaattiioonnaalleess oobblliiggaattooiirreess ppoouu tteecchhnniiqquueess ddee ccoonnssttrruuccttiioonn ddee nn EEEEEEEETTTTTTTT LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE DDDDDDDD''''''''UUUUUUUUNNNNNNNNEEEEEEEE SSSSSSSSAAAAAAAANNNNNNNNSSSSSSSS CCCCCCCCEEEEEEEESSSSSSSSSSSSSSSSEEEEEEEE EEEEEEEENNNNNNNN EEEEEEEESSSSSSSSSSSSSSSSOOOOOOOORRRRRRRR :::::::: yysseerr llee pprroocceessssuuss dd''ééllaabboorraattiioonn dd''uunnee avvaanntt dd''ééttuuddiieerr àà qquuii llaa ttââcchhee ddee cceetttt EEEEEEEE DDDDDDDD''''''''UUUUUUUUNNNNNNNNEEEEEEEE RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN EEEEEEEENNNNNNNN FFFFFFFF CCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE :::::::: dee ll''aappppaarriittiioonn dd''uunn rrèègglleemmeenntt ddaannss llee ee ddeeuuxx rrééfflleexxiioonnss :: llaa pprreemmiièèrree ccoonnssii ee qquuee ddaannss tteell oouu tteell ddoommaaiinnee uunnee rréé eerraa ssuurr ll''ééttuuddee ddee llaa ffrroonnttiièèrree eennttrree uuee ddee ll''ééllaabboorraattiioonn dd''uunnee rréégglleemmeennttaa NNNNNNNNEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS DDDDDDDDEEEEEEEE MMMMMMMMEEEEEEEERRRRRRRR EEEEEEEETTTTTTTT LLLLLLLLEEEEEEEEUUUUUUUURRRRRRRR EEEEEEEENNNNNNNNSSSSSSSSEEEEEEEEIIIIIIIIGGGGGGGGNNNNNNNN SSTTRRUUCCTTIIVVEESS qquueebboott rrééppuuttéé iinnssuubbmmeerrssiibbllee qquuii eeffffee nn vviiaa QQuueeeennssttoowwnn eett NNeeww YYoorrkk aavveecc TTeerrrree NNeeuuvvee,, vviiccttiimmee dd''uunn hheeuurrtt aavveecc rréé ddee sseess pprroopprriiééttaaiirreess ((((((((11111111)))))))) .. nnssee dduu rruubbaann bblleeuu ééttaaiitt aattttrriibbuuééee aauu rraappiiddeemmeenntt ppoossssiibbllee,, rrééccoommppeennssee dd ss ttéémmooiiggnnaaggeess oonntt ppeerrmmiiss dd''ééttaabblliirr qq aa iinnfflluueennccéé llaa ddéécciissiioonn dduu ccoommmmaannddaa mmééttééoorroollooggiiqquueess ssiiggnnaallaanntt llaa pprréésseenncc é llee nnaavviirree ddaannss uunnee eeaauu ggllaacciiaallee ccaauu mmeess,, eennffaannttss,, aadduulltteess,, vviieeiillllaarrddss)).. LLee m ccaattaassttrroopphhee mmaarriittiimmee,, eett lleess pprrooffeess rreeddeevveenniirr hhuummbblleess,, aattttiittuuddee qquu''iillss aavv tteecchhnnoollooggiiqquuee.. IIllss ddeevvrroonntt aacccceepptteerr qq mmmmee,, ccee qquuee llaa rréévvoolluuttiioonn iinndduussttrriieellll aassttrroopphhee qquuii aa ttoouucchhéé ttoouutteess lleess ccoouuc ss,, uunnee ccoonnfféérreennccee iinntteerrnnaattiioonnaallee pprriiss mmbbrreeuuxx ffaacctteeuurrss aaccccaabbllaannttss,, qquuii ccoouu mmeenntt ddee mmeerr.. NNIICC,, iill eesstt cceerrttaaiinn qquuee ddaannss ll''eesspprriitt ddee tt iinnssuubbmmeerrssiibbllee.. IIll aa ffaalllluutt cceettttee ccaattaa ee ddoommaaiinnee dduu ccoommppaarrttiimmeennttaaggee eett dd nntt ddee mmeerr aa ccoonndduuiitt àà ll''ééllaabboorraattiioonn dd uurr lleess nnaavviirreess mmaarrcchhaannddeess,, rrèègglleess eenn nnaavviirree,, ddee ddéétteeccttiioonn iinncceennddiiee,, dd''ééqquuii :::::::: ee rréégglleemmeennttaattiioonn eenn ttee ééllaabboorraattiioonn ddooiitt oouu FFFFFFFFAAAAAAAAVVVVVVVVEEEEEEEEUUUUUUUURRRRRRRR DDDDDDDDEEEEEEEE ee sseecctteeuurr ddee llaa iisstteerraa àà ccoonnssttaatteerr éégglleemmeennttaattiioonn ddeevviieenntt cceettttee pprriissee ddee aattiioonn.. NNNNNNNNEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT :::::::: eeccttuuaaiitt ssoonn vvooyyaaggee 22335588 ppaassssaaggeerrss àà cc uunn iicceebbeerrgg ,, vviiccttiimmee nnaavviirree qquuii eeffffeeccttuuéé llaa ddéétteennuuee ppaarr llaa qquuee llee rreepprréésseennttaanntt ddee aanntt ddee nnee ppaass rréédduuiirree ccee dd''iicceebbeerrgg ddaannss lleess uussaa llaa ddiissppaarriittiioonn ddee mmoonnddee eennttiieerr ssssiioonnnneellss dduu sseecctteeuurr vvaaiieenntt tteennddaannccee àà qquuee llaa mmeerr rreesstteerraa àà llee aavvaaiitt uunn tteemmppss ffaaiitt ucchheess ssoocciiaalleess ddoonntt ss ppllaaccee àà LLoonnddrreess eenn uuppllééss lleess uunnss aauuxx eess aarrmmaatteeuurrss eett dduu aassttrroopphhee ppoouurr rréévvéélleerr ddee ll''ééqquuiippeemmeenntt ddeess dee rrèègglleess nngglloobbaanntt lleess ddoommaaiinneess iippeemmeenntt
  • ppyyrrootteecchhnniiqquuee eett ddee ddrroommee ddee s hhuummaaiinnee eenn mmeerr.. SSaannss eennttrreerr ddaannss uunnee ssiimmppllee éénn iinnddiissppeennssaabbllee ddee cciitteerr lleess aauuttrree uunnee ccrrééaattiioonn ddee tteexxttee eenn ffaavveeuurr LLee 1188 MMaarrss 11996677 llee ppééttrroolliieerr lliibb CCeett éévvèènneemmeenntt eennttrraaîînnaanntt uunnee 110000 kkiilloommèèttrreess ddeess ccôôtteess FFrraannçç 11996699 ssuurr llee ddrrooiitt dd''iinntteerrvveennttiioonn FFIIPPOOLL eenn 11997711,, ffoonndd dd''iinnddeemmnnii dd''hhyyddrrooccaarrbbuurreess aaiinnssii qquuee ddee llaa ppoolllluuttiioonn ooppéérraattiioonnnneellllee ppaarr hhyydd CC''eesstt eenn 11997788 qquuee llaa ccoonnvveennttiioo rréévviissiioonn aa ééttéé mmoottiivvééee ppaarr ll''éécchh lliibbéérriieenn,, qquuii ddéévveerrssaa pplluuss ddee 2244 PPeeuu ddee tteemmppss aapprrèèss,, llee 77 mmaarrss llaarrggee ddeess ccôôtteess ffrraannççaaiisseess,, ddéévvee aacccciiddeenntt ffûûtt àà ll''oorriiggiinnee dduu MMéémmo dduu ppoorrtt »» eett aa ppoouurr oobbjjeeccttiiff ddee QQuueellqquueess ffooiiss uunnee sseeuullee ccaattaassttrr ssééccuurriittéé mmaarriittiimmee :: aaiinnssii aalloorrss qq llaa BBeellggiiqquuee eenn 11998877 ccaauussaaiitt llaa mm aaddoopptteerr uunnee rrééssoolluuttiioonn eenn mmaattiiè àà bboorrdd dduu SSccaannddiinnaavviiaann SSttaarr,, ffee NNoorrdd ppoouurr rreennddrree oobblliiggaattooiirree ccee LL''éécchhoouueemmeenntt dduu ppééttrroolliieerr aamméé EEttaattss--UUnniiss àà aaddoopptteerr ll''OOiill PPoolllluutt rreepprriissee ddaannss cceess ggrraannddss ttrraaiittss pp MMAARRPPOOLL eett qquuii ccoonncceerrnnee ssuurrttoouu CC''eesstt àà llaa ssuuiittee dd''uunnee sséérriiee dd''aacc SSeeaa eenn 11999922 eett eennffiinn dduu BBrraaeerr ppoolliittiiqquuee ccoommmmuunnee ddee llaa ssééccuurrii EEnn 11999944 llee nnaauuffrraaggee ddee ll''EEssttoonnii ss''eennssuuiivvii ddeess mmooddiiffiiccaattiioonnss ddee SS rrééggiioonnaalleess ddéécciiddééeess ppaarr llaa ((((((((22222222)))))))) :::::::: PPééttrroolliieerr cchhyypprriioottee qquuii pprriiss eett ddee ssee bbrriisseerr eenn ddeeuuxx ddéévveerrssaa ((((((((33333333)))))))) :::::::: PPééttrroolliieerr lliibbéérriieenn qquuii ss''éécchh ccoonnfféérreennccee ddee SSttoocckkhhoollmm eett qquu rrééggiioonnss ddee llaa mmeerr bbaallttiiqquuee eett ddee ssaauuvveettaaggee ddaannss llee bbuutt dd''aamméélliioorreerr llee nnuumméérraattiioonn ddee ccaattaassttrroopphhee,, iill eesstt ccee eess pprriinncciippaauuxx éévvèènneemmeennttss aayyaanntt eennttrr rr ddee ll''aamméélliioorraattiioonn ddee llaa ssééccuurriittéé mmaa bbéérriieenn TToorrrreeyy ccaannyyoonn ss''éécchhoouuaa aauu llaarr ppoolllluuttiioonn ddee 225500 kkiilloommèèttrreess ddeess ccôôtte ççaaiisseess,, eesstt àà ll''oorriiggiinnee ddee ll''aaddooppttiioonn dd nn eenn hhaauuttee mmeerr,, llaa ccoonnvveennttiioonn CCLLCC 66 iissaattiioonn ddeess ddoommmmaaggeess ccaauussééss ppaarr llee aa ccoonnvveennttiioonn MMaarrppooll ddee 11997733,, ccoonnvveen ddrrooccaarrbbuurree.. oonn MMaarrppooll ssuubbiitt ddee nnoommbbrreeuusseess mmooddii hhoouueemmeenntt ddee ll''AAMMOOCCOO CCAADDIIZZ,, ppééttrroo 4400000000 TT ddee ppééttrroollee aauu llaarrggee PPoorrttssaallll 11998800 llee ppééttrroolliieerr ppaannaammééeenn TTAANNIIOO eerrssaanntt pplluuss ddee 66000000 ttoonnnneess ddee FFuueell moorreenndduumm ddee PPaarriiss aauuttrreemmeenntt aappppeelléé ppaalllliieerr lleess iinnssuuffffiissaanncceess ddeess ééttaattss dduu rroopphhee nnee ssuuffffiitt ppaass àà ffaaiirree pprrooggrreessssee qquuee llee nnaauuffrraaggee dduu HHeerraalldd ooff FFrreeee EEnn mmoorrtt ddee 119933 ppeerrssoonnnneess,, ccaattaassttrroopphhee ièèrree ddee ggeessttiioonn ddee llaa ssééccuurriittéé,, iill ffaalllluu eerrrryy ddaannooiiss,, eett cceess 115588 mmoorrttss eenn AAvvr eettttee rréégglleemmeennttaattiioonn.. éérriiccaaiinn EExxxxoonn VVaallddeezz aauu llaarrggee ddee ll''AAllaa ttiioonn AAcctt 9900,, rréégglleemmeennttaattiioonn uunniillaattéérraa ppaarr ll''OOMMII eenn 11999922,, aavveecc llaa mmooddiiffiiccaatt uutt ll''eexxcclluussiioonn ddeess nnaavviirreess ppééttrroolliieerr ssii cccciiddeennttss ccoommmmee cceelluuii dduu HHaavveenn ((((((((22222222)))))))) ee ((((((((33333333)))))))) eenn 11999933 qquuee llaa ccoommmmiissssiioonn EEuurroo iittéé mmaarriittiimmee.. iiaa eenn MMeerr BBaallttiiqquuee ccaauussaa llaa mmoorrtt ddee SSOOLLAASS ppaarr ll''OOMMII eett ssuurrttoouutt ll''ééttaabblliissss ss ffeeuu aauu mmoouuiillllaaggee ddaannss llee ggoollff ddee GG aanntt 3300000000 ttoonnnneess ddee ppééttrroollee.. hhoouuaa aauuxx îîlleess SShheettllaanndd ddéévveerrssaanntt 8844 uuii ccoonncceerrnnee llaa ssttaabbiilliittéé ddeess ffeerrrriieess aapp ee llaa mmeerr dduu nnoorrdd.. ee ssaauuvveettaaggee ddee llaa vviiee eeppeennddaanntt rraaîînnéé uunnee éévvoolluuttiioonn oouu aarriittiimmee.. rrggee ddee llaa CCoorrnnoouuaaiillllee.. teess bbrriittaannnniiqquueess eett ddee ddee llaa ccoonnvveennttiioonn ddee 6699 eett ddee llaa ccrrééaattiioonn dduu ee ttrraannssppoorrtt ppaarr mmeerr ennttiioonn qquuii ttrraaiittee ddee llaa iiffiiccaattiioonnss,, cceettttee oolliieerr bbaattttaanntt ppaavviilllloonn ssee rroommpptt eenn ddeeuuxx aauu lloouurrdd NN°°22 ;; ccee ddeerrnniieerr éé «« ccoonnttrrôôllee ppaarr ll''EEttaatt uu ppaavviilllloonn.. eerr llee ddoommaaiinnee ddee llaa nntteerrpprriissee aauu llaarrggee ddee ee qquuii ccoonndduuiissiitt ll''OOMMII aa uutt ll''iinncceennddiiee ssuurrvveennuuee rriill 11999900 eenn MMeerr dduu aasskkaa,, ppoouusssseerraa lleess aallee mmaaiiss qquuii sseerraa ttiioonn ddeess rrèègglleess iimmpplleess ccooqquueess .. eenn 11999911,, ddee AAeeggeeaann ooppééeennnnee pprrooppoossaa uunnee 885522 ppeerrssoonnnneess :: sseemmeenntt ddee nnoorrmmeess GGêênneess aavvaanntt dd''eexxpplloosseerr 4000000 ttoonnnneess ddee ppééttrroollee pprrèèss aavvaarriiee ppoouurr lleess
  • EEnnffiinn jjee cciitteerraaii iiccii lleess éévvèènneemmeenn ppuubblliicc,, pplluuss aatttteennttiivvee aauujjoouurrdd''hh ddee nnoouuvveelllleess mmeessuurreess éémmiisseess pp nnaauuffrraaggee dduu cchhiimmiiqquuiieerr EErriikkaa qquu ddeess ssoocciiééttééss ddee ccllaassssiiffiiccaattiioonn eett EEtt eennffiinn ddeerrnniièèrreemmeenntt llaa ppeerrttee d aaccccéélléérréé llee pprroocceessssuuss ddee bbaannnniiss ddééjjàà éénnoonnccééee ddaannss lleess pprrooppoossiitt ppaaqquueett EERRIIKKAA II eett EERRIIKKAA IIII.. VVooiiccii ddoonncc llaa lliissttee ddeess éévvèènneemmee ccrrééaattiioonn ddee tteexxtteess eenn ffaavveeuurr ddee ffoonnddaammeennttaallee ssuurr ll''éévvoolluuttiioonn ddee MMaallhheeuurreeuusseemmeenntt cceess mmeessuurreess nn''oonntt jjaammaaiiss ddeevvaannccéé lleess éévvèènnee llaa lleeccttuurree ddee cceettttee éénnuumméérraattiioonn LLaa ccaattaassttrroopphhee dduu TTIITTAANNIICC aa ddoo ssééccuurriittaaiirree ddaannss llee ddoommaaiinnee mmaa lloorrss ddee cceettttee ééttuuddee,, lleess aamméélliioorr ssoouuvveenntt llee ffrruuiitt dd''uunnee rrééfflleexxiioonn aacccciiddeennttss.. §§11..22 :: LLEESS EENNQQUUÊÊTTEESS AACCCCIIDDEENN CCoommmmee nnoouuss aavvoonnss ppuu llee ccoonnsstt eenn ffaavveeuurr ddee ll''aamméélliioorraattiioonn ddee ll dd''uunnee aannaallyyssee eeffffeeccttuuééee aaffiinn ddee eesstt eeffffeeccttuuéé lloorrss dd''uunnee eennqquuêêttee rréécceemmmmeenntt,, eellllee ss''iimmppoossee mmaaiinn ddaannss uunn aacccciiddeenntt mmaajjeeuurr.. LLaa pprreemmiièèrree «« eennqquuêêttee aacccciiddeennt cceellllee ccoonnssttiittuuééee àà llaa ssuuiittee dduu nnaa sséénnaattoorriiaallee ddeess EEttaattss--UUnniiss eett ppuu PPaarraallllèèlleemmeenntt àà cceettttee ccoommmmiissssii ddee ll''AAttllaannttiiqquuee àà LLoonnddrreess,, dduu ccoo CCoommmmeerrccee,, eennqquuêêttee qquuii ssee ddéérro CCeettttee ccoommmmiissssiioonn eennqquuêêttaa ssppéécc ddee ssaauuvveettaaggee eett aauuttrreess ééqquuiippeemm rreeccoommmmaannddaattiioonnss éémmiisseess ppaarr llaa nnoouuvveellllee rréégglleemmeennttaattiioonn.. BBiieenn qquuee llaa pprreemmiièèrree ccoonnvveennttiioo mmeerr eeuu lliieeuu àà LLoonnddrreess eenn 11991144 eennqquuêêtteess,, cceess mmeessuurreess rreessttèèrreenn ddee llaa pprreemmiièèrree gguueerrrree mmoonnddiiaallee DDoonncc ddeeppuuiiss llaa ccaattaassttrroopphhee dduu êêttrree rreemmiiss eenn ccaauussee.. nnttss qquuii oonntt ssaannss ddoouuttee mmaarrqquuéé ccoonnssii hhuuii aauu pprroobbllèèmmee dd''eennvviirroonnnneemmeenntt eett ppaarr llaa CCoommmmiissssiioonn EEuurrooppééeennnnee :: ccee ss uuii aa aammeennéé llaa ccoommmmiissssiioonn àà ss''iinntteerrrroo tt ll''aapppplliiccaattiioonn ddeess nnoorrmmeess ddee ssééccuurriitt dduu ppééttrroolliieerr PPRREESSTTIIGGEE aauu llaarrggee ddeess sssseemmeenntt ddeess nnaavviirreess ppééttrroolliieerrss ssiimmpp ttiioonnss ddee llaa ccoommmmiissssiioonn EEuurrooppééeennnnee ss eennttss mmaajjeeuurrss aayyaanntt aabboouuttii àà uunnee mmoo ee llaa ssééccuurriittéé mmaarriittiimmee mmaaiiss qquuii oonntt aa eess rréégguullaatteeuurrss eett ddeess aauuttoorriittééss nnoorrmm s ssoonntt ssyyssttéémmaattiiqquueess lleess ccoonnssééqquueenncc eemmeennttss.. JJ''iinnvviittee llee lleecctteeuurr àà eeffffeeccttuuee nn ddee ccaattaassttrroopphheess.. oonncc ffiinnaalleemmeenntt ééttéé llee ppooiinntt ddee ddééppaarr aarriittiimmee eett ccoommmmee nnoouuss ppoouurrrroonnss llee cc rraattiioonnss ddaannss llee ddoommaaiinnee ddee llaa ssééccuurriitt mmeennééee ssuuiittee àà uunnee ccaattaassttrroopphhee mmaarr NNTTSS :: ttaatteerr ddaannss ll''éénnuumméérraattiioonn pprrééccééddeennttee llaa ssééccuurriittéé mmaarriittiimmee llee ssoonntt ppoouurr llaa pp ee ccoonnnnaaîîttrree lleess cciirrccoonnssttaanncceess ddee ll''aacccc ee ddiittee eennqquuêêttee aacccciiddeenntt :: ccoommmmiissssiioonn nntteennaanntt aauuxx ééttaattss dduu ppaavviilllloonnss ddoonntt uu ntt »» mmaajjeeuurree mmeennééee àà llaa ssuuiittee dd''uunnee aauuffrraaggee dduu TTIITTAANNIICC :: eellllee aa ééttéé mmeenn uubblliiééee llee 2288 mmaaii 11991122 ((((((((44444444))))))))........ iioonn dd''eennqquuêêttee,, uunnee aauuttrree aannaallyyssee aavv oottéé dduu BBooaarrdd ooff TTrraaddee,, llee mmiinniissttèèrree BB oouullaa dduu 22 MMaaii 11991122 aauu MMeerrccrreeddii 33 JJuu cciiaalleemmeenntt ssuurr llee nnoommbbrree dd''eemmbbaarrccaatt mmeennttss ppoouurr llaa ssééccuurriittéé ddeess ppaassssaaggeerr aa ccoommmmiissssiioonn sséénnaattoorriiaallee rreepprriisseess aaf oonn iinntteerrnnaattiioonnaallee ppoouurr llaa ssaauuvveeggaarrddee ss''aappppuuyyaa ssuurr lleess éélléémmeennttss rreetteennuuss pp nntt lloonnggtteemmppss eenn ssoommmmeeiill ssuuiittee aauuxx ee((((((((55555555))))))))........ TTIITTAANNIICC,, ll''iinnttéérrêêtt ddeess eennqquuêêtteess aapprrèè iiddéérraabblleemmeenntt ll''ooppiinniioonn qquuii oonntt ééttéé àà ll''oorriiggiinnee ssoonntt eenn 11999999 llee ooggeerr ssuurr llee ccoonnttrrôôllee ttééss.. ccôôtteess ddee GGaalliiccee qquuii aa plleess ccooqquueess,, mmeessuurreess ssuuiittee àà ll''EERRIIKKAA ddiitt ooddiiffiiccaattiioonn,, àà llaa aauussssii eeuu uunnee iinncciiddeennccee mmaattiivveess.. cceess ddee ccaattaassttrroopphheess eett err cceettttee ccoonnssttaattaattiioonn àà rrtt dd''uunnee ssyynneerrggiiee ccoonnssttaatteerr pplluuss eenn aavvaall ttéé mmaarriittiimmee ssoonntt rriittiimmee,, lleess eennqquuêêtteess ee,, lleess mmeessuurreess pprriisseess pplluuss ppaarrtt àà llaa ssuuiittee cciiddeenntt.. CCeettttee aannaallyyssee nn aadd hhoocc eennccoorree uunn nnaavviirree eesstt iimmpplliiqquuéé ccaattaassttrroopphhee aa ééttéé nnééee ppaarr llaa ccoommmmiissssiioonn vaaiitt lliieeuu ddee ll''aauuttrree ccôôttéé BBrriittaannnniiqquuee dduu uuiilllleett 11991122.. ttiioonnss,, rraaddeeaauuxx,, eennggiinnss rrss,, eett ssuuiivvii lleess ffiinn dd''ééttaabblliirr uunnee ee ddee llaa vviiee hhuummaaiinnee eenn ppaarr cceess pprreemmiièèrreess éévvèènneemmeennttss ttrraaggiiqquueess èèss aacccciiddeennttss nnee ppeeuutt
  • CCeeppeennddaanntt iill nn''eexxiissttaaiitt ppaass ddee rr ll''oorrggaanniissmmee cchhaarrggéé ddee mmeenneerr ll'' LL''aappppaarriittiioonn ddeess ccoommmmiissssiioonnss dd eett ssuurrttoouutt llaa vviitteessssee ddee rrééaaccttiioonn LLee tteexxttee ffoonnddaatteeuurr qquuii ffiixxee ddééssoo aacccciiddeenntt ppoouurr llee mmaarriittiimmee eesstt llee eennqquuêêtteess ssuurr lleess aacccciiddeennttss eett iinn 11999977.. LL''OOMMII qquuii ss''eesstt ééggaalleemmeenntt ddoottéé IImmpplleemmeennttaattiioonn ((FFSSII )) ssuurr lleess «« LLaa ddiirreeccttiivvee EEuurrooppééeennnnee 11999999//33 ll''eexxppllooiittaattiioonn eenn ttoouuttee ssééccuurriittéé dd''eennggiinnss àà ppaassssaaggeerrss àà ggrraannddee ((((((((44444444)))))))) :: BBuulllleettiinn ddee llaa NNaavviiggaattiioonn ee SSéénnaattoorriiaallee ddeess EEttaattss--UUnniiss ssuurr l ((((((((55555555)))))))) :: IIll ffaalllluutt pprrèèss ddee 1155 aannss aavv vviitteessssee »» ssee rrééffèèrree eexxpplliicciitteemmeenn ffaaiitt mmeennttiioonn dd''eennqquuêêtteess oobblliiggaatt AA nnootteerr ll''eexxiisstteennccee dd''uunn FFoorruumm ((MMAAIIIIFF)),,eenn aannggllaaiiss llee MMaarriinnee AAcc oobbjjeett ddee ffaavvoorriisseerr lleess ccoonnttaaccttss dd ééttaanntt qquuee ddaannss cceerrttaaiinnss EEttaattss llee cchhaarrggééeess ddee llaa rréégglleemmeennttaattiioonn BBiieenn qquuee lleess eennqquuêêtteess aacccciiddeenntt cceeppeennddaanntt ddeess ccoommmmiissssiioonnss dd''ee qquuaalliittéé eett ddee ccoommppéétteennccee ccoommmm ll''AAnngglleetteerrrree .. LLaa FFrraannccee ppoossssèèddee ééggaalleemmeenntt uu ppllaann iinntteerrnnaattiioonnaall,, llee BBEEAA mmeerr (( LLee BBEEAA mmeerr nn''aa ééttéé mmiiss eenn ppllaacc ccrrééaattiioonn dduu BBEEAA ppoouurr rrééaalliisseerr dd dd''aapppplliiqquueerr lleess ddiissppoossiittiioonnss ddee ll ccoonndduuiittee ddeess eennqquuêêtteess ssuurr lleess aa CCee sseerrvviiccee eesstt ccoonnssttiittuuéé aauu sseeiinn LL''aannnnééee 22000022 aa ccoonnssttiittuuéé uunn ttoo ccrrééaattiioonn eenn ddéécceemmbbrree 11999977 eett jj rréégglleemmeennttaaiirree ssuuiittee àà ll''aarrrrêêttéé dd rrééeell ccaaddrree,, lleess eennqquuêêtteess ééttaanntt mmeennééss ''eennqquuêêttee ccoonnssttiittuuééee aauu ccaass ppaarr ccaass.. dd''eennqquuêêtteess aa ééttéé uunnee ggrraannddee aamméélliioorr nn.. oorrmmaaiiss lleess ccoonnddiittiioonnss eett mmooddaalliittééss dd ee tteexxttee ddee ll''OOMMII iinnttiittuulléé «« ccooddee ppoouurr nncciiddeennttss ddee mmeerr »» rrééssoolluuttiioonn AA 884499((22 éé dd''uunn ggrroouuppee ddee ttrraavvaaiill aauu sseeiinn dduu ss «« aacccciiddeennttss eett eennqquuêêtteess »».. 3355//CCEE dduu CCoonnsseeiill ddee ll''UUnniioonn EEuurrooppééee ddee sseerrvviicceess rréégguulliieerrss ddee ttrraannssbboorrddeeuu eett ddeess PPêêcchheess mmaarriittiimmeess,, rraappppoorrtt ddee llaa CCaattaassttrroopphhee dduu TTIITTAANNIICC,, ssoouurrccee :: vvaanntt qquuee cceess mmeessuurreess nnee ssooiieenntt aappppll nntt àà llaa rrééssoolluuttiioonn ddee ll''OOMMII pprrééccééddeemm ttooiirreess pprréévvuueess eenn ccaass dd''aacccciiddeenntt.. IInntteerrnnaattiioonnaall ddeess eennqquuêêtteeuurrss ssuurr llees cccciiddeenntt IInnvveessttiiggaattoorrss IInntteerrnnaattiioonnaall FF ddiirreeccttss eennttrree eennqquuêêtteeuurrss ddee ppaayyss ddiiff eess BBEEAA mmeerr nnee ssoonntt ppaass ddiissssoocciiééss ddee eett ddeess ccoonnttrrôôlleess.. ttss ss''iimmppoosseenntt mmaaiinntteennaanntt aauuxx EEttaattss dd eennqquuêêtteess ppeerrmmaanneenntteess ppoossssééddaanntt uunn mmee llee MMaarriinnee AAcccciiddeenntt IInnvveessttiiggaattiioonnss uunnee ccoommmmiissssiioonn dd''eennqquuêêttee ppeerrmmaannee ((BBuurreeaauu EEnnqquuêêttee AAcccciiddeenntt)).. ccee qquu''àà llaa ssuuiittee ddee ll''aarrrrêêttéé dduu 1166 ddéécc ddeess eennqquuêêtteess aapprrèèss éévvèènneemmeennttss ddee mm llaa rrééssoolluuttiioonn AA 884499((2200)) ddee ll''OOMMII ppoorr aacccciiddeennttss eett lleess iinncciiddeennttss ddee mmeerr »».. nn ddee ll''IInnssppeeccttiioonn ggéénnéérraallee ddeess aaffffaaiirree oouurrnnaanntt ddéécciissiiff ppoouurr llee BBEEAA mmeerr ;; eenn jjuussqquu''àà ffiinn 22000011,, llee BBEEAA mmeerr nn''aavvaaiitt dduu 1166 ddéécceemmbbrree 11999977 .. ss aauu ccoouupp ppaarr ccoouupp eett rraattiioonn ddaannss ll''eeffffiiccaacciittéé ddeess eennqquuêêtteess aapprrèèss rr llaa ccoonndduuiittee ddeess 2200)) dduu 2277 nnoovveemmbbrree soouuss ccoommiittéé FFllaagg SSttaattee eennnnee «« rreellaattiivvee àà uurrss rroouulliieerrss eett ee llaa ccoommmmiissssiioonn :: ggaalllliiccaa..bbnnff..ffrr.. liiqquuééeess.. mmmmeenntt mmeennttiioonnnnééee eett ss aacccciiddeennttss mmaarriittiimmee FFoorruumm,, qquuii aa ppoouurr fffféérreennttss.. LL''iinnttéérrêêtt eess aaddmmiinniissttrraattiioonnss dduu ppaavviilllloonn,, iill eesstt nnee rrééppuuttaattiioonn ddee ss BBrraanncchh ((MMAAIIBB )) ppoouurr eennttee rreeccoonnnnuuee ssuurr llee cceemmbbrree 11999977 ppoorrttaanntt mmeerr,, ppeerrmmeettttaanntt aaiinnssii rrttaanntt «« CCooddee ppoouurr llaa eess mmaarriittiimmeess.. eeffffeett,, ddeeppuuiiss ssaa tt qquu''uunnee eexxiisstteennccee
  • DDeeppuuiiss llee ddéébbuutt ddee ll''aannnnééee 220000 ssttaattuutt llééggiissllaattiiff ggrrââccee àà llaa llooii nn°° tteecchhnniiqquueess eett aaddmmiinniissttrraattiivveess aa CCee tteexxttee ddaannss ssoonn ttiittrree IIIIII,, ééllaarr ppeerrmmaanneennttss cchhaarrggééss ddee llaa ccoonndd nnaavviiggaattiioonn mmaarriittiimmee eett ddaannss ccee ccoooorrddiinnaattiioonn ddeess ttrraavvaauuxx ddeess BB ssaaiissiiee ddeess mmêêmmeess ffaaiittss eett eennffiinn EEttaattss ééttrraannggeerrss qquuii ppoouurrrraaiieenntt êê LLee ssttaattuutt dduu BBEEAA eesstt bbiieenn ssuurr llaa cceeppeennddaanntt ccee qquuii lluuii ccoonnffèèrree uunn ddooiitt mmeenneerr àà ddeess rrééssuullttaattss dd''eenn mmiilliieeuu pprrooffeessssiioonnnneell.. EEnn eeffffeett llee BBEEAA eesstt ccoonnssttiittuuéé dd''uu mmaarriittiimmee aauuttoouurr dduu ddiirreecctteeuurr dd mmiilliieeuu mmaarriittiimmee ccee qquuii llee ddiifffféérree eexxiissttaanntt qquuii oonntt ttrrèèss ppeeuu dd''aauuttoo DDee pplluuss llee ddiirreecctteeuurr ppeeuutt,, ss''iill llee tteemmppoorraaiirree ddaannss tteell oouu tteell ddoomm LLee ddoommaaiinnee ddee ccoommppéétteennccee ttoouu eeaauuxx tteerrrriittoorriiaalleess ffrraannççaaiisseess,, ttoo ffrraannççaaiissee oouu ttoouutt aacccciiddeenntt ddoonntt ffrraannççaaiiss tteell qquu''éénnuumméérréé ddaannss llee MMaallhheeuurreeuusseemmeenntt llee BBEEAA mmeerr nn dd''aaccttiioonn iimmppéérraattiivvee ssuurr lleess aaccttee mmiissee ssuurr llaa ppuubblliicciittéé ddeess rreeccoomm aannnnuueell)) eett llee ffaaiitt qquuee llee BBEEAA ppoo qquuii lluuii vvaauutt dd''êêttrree rreeccoonnnnuu ssuurr llee ccaass dduu «« PPRREESSTTIIGGEE »» ,, llaa CCoomm tteennuuee iinnffoorrmmééee dduu ddéérroouulleemmeenn rraapppprroocchhéé ddee sseess sseerrvviicceess àà cceett MMaaiiss llee ppooiinntt eesssseennttiieell ddee cceess cco dd''aamméélliioorraattiioonn ddee llaa ssééccuurriittéé mm LLee bbuutt pprreemmiieerr dduu BBEEAA ééttaanntt llaa dd''éévviitteerr qquu''iill nnee ssee rreepprroodduuiissee,, aavveecc lleess eennttrreepprriisseess ccoonncceerrnnééeess ddaannss uunnee aaffffaaiirree aaffii pplluuss àà mmêêmmee dd''aappppoorrtteerr ddeess éécc EEtt llee ddiiaalloogguuee ppeeuutt ppaarrffooiiss aappppoo mmaarriittiimmee ccoommmmee ccee ffûûtt llee ccaass pp 0022,, llee ssttaattuutt dduu BBEEAA mmeerr ss''eesstt vvuu mmoo °°22000022--33 dduu 33 jjaannvviieerr 22000022 ssuurr nnoottaamm aapprrèèss éévvéénneemmeennttss ddee mmeerr.. rrggiitt lleess ppoossssiibbiilliittééss dd''iinnvveessttiiggaattiioonn ddee dduuiittee ddeess eennqquuêêtteess tteecchhnniiqquueess ddaannss eelluuii ddeess ttrraannssppoorrttss tteerrrreessttrreess,, oorrggaannii BBEEAA aavveecc cceeuuxx ddeess aauuttoorriittééss jjuuddiicciiaaiirre n rrèèggllee llaa ccoollllaabboorraattiioonn aavveecc lleess êêttrree ccoonncceerrnnééss.. aa ppiieerrrree aanngguullaaiirree ffoonnddaattrriiccee ddee cceettttee nnee rrééeellllee llééggiittiimmiittéé eesstt ssoonn mmooddee ddee nnqquuêêtteess iinnddiissccuuttaabblleess aaffiinn dd''iimmppoosseerr uunn ccoollllèèggee ppeerrmmaanneenntt dd''eexxppeerrttss eett pp dduu BBEEAA rreepprréésseennttaanntt aaiinnssii uunn ppaanneell aa eenncciiee ddeess aauuttrreess bbuurreeaauuxx eennqquuêêttee aa oonnoommiiee ddaannss llee cchhooiixx ddee lleeuurrss ccoollllaabbo ee jjuuggee uuttiillee,, ss''aaddjjooiinnddrree lleess sseerrvviicceess mmaaiinnee aaffiinn dd''êêttrree llee pplluuss pprréécciiss ppoossssiibb uucchhee ttoouutt aacccciiddeenntt ddoonntt llee ddéérroouulleemmee oouutt aacccciiddeenntt ooùù ll''oonn ddéépplloorree uunnee vviiccttii tt lleess rrééppeerrccuuttiioonnss eennvviirroonnnneemmeennttaalleess ee ttiittrree IIIIII,, aarrtt 1144,,IIII.. nnee ppeeuutt qquu''éémmeettttrree ddeess rreeccoommmmaannddaa eeuurrss ddee llaa ssééccuurriittéé mmaarriittiimmee ;; cceeppeenndd mmmmaannddaattiioonnss((rrééccaappiittuullééeess cchhaaqquuee aann oossssèèddee ddee pplluuss eenn pplluuss uunnee iimmaaggee ddee llee ppllaann iinntteerrnnaattiioonnaall ppaarr llaa ccoommmmiissss mmmmiissssiioonn eeuurrooppééeennnnee aayyaanntt eexxpprriimm nntt ddeess ttrraavvaauuxx dd''eennqquuêêttee,, llee BBEEAAmmeerr tt eeffffeett.. oommmmiissssiioonnss dd''eennqquuêêtteess rreessttee lleeuurr ccoo mmaarriittiimmee :: a rreecchheerrcchhee dduu ffaaiitt tteecchhnniiqquuee aayyaanntt ee llee ddiirreecctteeuurr dduu BBEEAA ccoommppttee éénnoorrmméé iinn ddee ccoonnnnaaîîttrree lleess ppoossiittiioonnss ddee cceess ee ccllaaiirrcciisssseemmeennttss oouu mmêêmmee ddeess ssoolluuttiioo oorrtteerr ddee rrééeellss pprrooggrrèèss tteecchhnniiqquueess eenn ppoouurr ddeeuuxx rreeccoommmmaannddaattiioonnss éémmiisseess ooddiiffiiéé eett pprreennddrree uunn mmmmeenntt lleess eennqquuêêtteess eess oorrggaanniissmmeess llee sseecctteeuurr ddee llaa iissee ééggaalleemmeenntt llaa reess éévveennttuueelllleemmeenntt ee oorrggaanniissaattiioonn,, ffoonnccttiioonnnneemmeenntt qquuii ssaa ccrrééddiibbiilliittéé ddaannss llee pprrooffeessssiioonnnneellss aasssseezz ccoommpplleett dduu acccciiddeenntt eeuurrooppééeenn boorraatteeuurrss.. dd''uunn eexxppeerrtt bbllee ddaannss lleess eennqquuêêtteess.. eenntt aa eeuu lliieeuu ddaannss lleess iimmee ddee nnaattiioonnaalliittéé ss ttoouucchheenntt lleess iinnttéérrêêttss aattiioonnss eett nn''aa ppaass ddaanntt ssoonn ddiirreecctteeuurr nnnnééee ddaannss llee rraappppoorrtt ee pprrooffeessssiioonnnnaalliissmmee,, ssiioonn eeuurrooppééeennnnee ddaannss mméé ssoonn ssoouuhhaaiitt dd''êêttrree rr ss''eesstt ééggaalleemmeenntt oonnttrriibbuuttiioonn eenn mmaattiièèrree eennttrraaîînnéé ll''aacccciiddeenntt aaffiinn éémmeenntt ssuurr llee ddiiaalloogguuee eennttrreepprriisseess qquuii ssoonntt llee oonnss.. nn mmaattiièèrree ddee ssééccuurriittéé ss àà llaa ssuuiittee dduu
  • nnaauuffrraaggee dduu IIEEVVOOLLII SSUUNN,, ccoonnccee eett llee ccoonnssttrruucctteeuurr FFRRAAMMOO ppoouurr eenn ccoommppttee iimmmmééddiiaatteemmeenntt eett iinn DDee mmêêmmee ffoonntt ppaarrttii ddeess rreeccoommmm ddeemmaannddee dd''uunnee pplluuss ggrraannddee ttrraa BBEEAA qquuii ss''aattttaaqquuee aauussssii àà llaa nnoot mmiinniimmuumm ddee ssééccuurriittéé àà bboorrdd dd''uu qquuii ppaarrffooiiss nnee ccoonnssttiittuuee mmêêmmee rréégglleemmeennttaattiioonn ddeess tteemmppss ddee rree LLaa ccoonnttrriibbuuttiioonn ddeess eennqquuêêtteess ttee lleess ccoommmmiissssiioonnss ppeerrmmaanneenntteess ff MMaaiiss ppoouurrqquuooii aalloorrss lleess eennsseeiiggnn cceerrttaaiinnss ccaass aaffiinn ddee ffaaiirree éévvoolluuee ddoommaaiinnee ddee llaa ssééccuurriittéé ?? EEnn ffaaiitt qquuii aa eennttrraaîînnéé lleess oorrggaanneess rréégguu ssoouuvveenntt eennttrraavveerr llee ccoommmmeerrccee MMoonnssiieeuurr BBooiissssoonn(( ddiirreecctteeuurr ccoomm eenn aappppoorrttee ssaannss ddoouuttee uunn éélléémm SSaaffeerrsseeaass ((((((((88888888)))))))) :: «« llaa cchhaaîînnee ddee ll ccaattaassttrroopphhee pplluuss ttrraavvaaiill ssuurr lleess lleess ggoouuvveerrnneemmeenntt ddee rrééaaggiirr.. »».. ((((((((66666666)))))))) :::::::: VVooiirr ppoouurr ll''aassppeecctt tteecchhnniiqquu dd''eennqquuêêttee ffiinnaallee dduu IIEEVVOOLLII SSUUNN ((((((((77777777)))))))) :::::::: ttoouutteess cceess rreeccoommmmaannddaattiioo 11999999,, 22000000 eett 22000011 ((((((((88888888)))))))) :::::::: CCoollllooqquuee SSaaffeerrsseeaass,, oorrggaann MMaarriittiimmee eett PPrrootteeccttiioonn ddee ll''EEnnvvii CC''eesstt ssuurr ccee ppoossttuullaatt qquuee ssee ddéévv sseeccttiioonn ddee cceettttee ppaarrttiiee ccoonnssaaccrréé CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIII :::::::: DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA PPPPPPPPOOOOOOOOLLLLLLLLIIIIIIIITTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUU DDee llaa ssoommmmee ccaattaassttrroopphhee pplluuss ggoouuvveerrnneemmeennttss ddee rrééaaggiirr.. LL''iinntteerrrrooggaattiioonn pprriinncciippaallee qquuee ss ssuuppppoossee uunnee aaccttiioonn eenn rreettoouurr dd CC''eesstt eenn ééttuuddiiaanntt ttoouutt dd''aabboorrdd ll qquuee nnoouuss ppoouurrrroonnss yy ddéécceelleerr uunn EEnn eeffffeett aavvaanntt dd''aannaallyysseerr lleess eeff mmaarriittiimmee qquuii eesstt bbiieenn ssoouuvveenntt ll iiddééee ddeess eennjjeeuuxx ééccoonnoommiiqquueess qq eerrnnaanntt llee ccoonnssttrruucctteeuurr VVIINNEELL ppoouurr llee ssoonn ssyyssttèèmmee dd''aassssèècchheemmeenntt ddeess bbaa nnttééggrréé ddaannss lleeuurr nnoouuvveeaauu ssyyssttèèmmee..(((((((( mmaannddaattiioonnss dduu BBEEAA ssuuiittee àà llaa ccaattaasstt aannssppaarreennccee ccoonncceerrnnaanntt lleess ssoocciiééttééss dd ttiioonn ddee «« ssaaffee mmaannnniinngg cceerrttiiffiiccaatt »» aa uunn nnaavviirree,, eeffffeeccttiiff aapppprroouuvvéé ppaarr lleess E ppaass uunn mmiinniimmuumm ssuuffffiissaanntt aauu rreessppeecc eeppooss..((((((((77777777)))))))) eecchhnniiqquueess aapprrèèss aacccciiddeennttss nn''eesstt ddoonnc ffaacciilliittaanntt eennccoorree pplluuss llee ddéérroouulleemmeenntt nneemmeennttss ddeess ccaattaassttrroopphheess ssoonntt iillss pprr eerr oouu ddee ccrrééeerr uunn tteexxttee rréégglleemmeennttaaiirr tt llaa qquueessttiioonn eesstt ddee ssaavvooiirr qquueellllee eesstt uullaatteeuurrss eett nnoorrmmaattiiffss àà ééttaabblliirr ddeess rrèè mmaarriittiimmee eett ssoonn mmaaîîttrree mmoott «« llaa rree mmmmuunniiccaattiioonn eett aaffffaaiirreess jjuurriiddiiqquueess,, bb mmeenntt ddee rrééppoonnssee ddaannss sseess pprrooppooss tteenn ll''aamméélliioorraattiioonn ddee llaa ssééccuurriittéé mmaarriittiimm ccoonnsscciieenncceess ddee llaa ppaarrtt ddeess mmééddiiaass éé .. uuee lleess rreeccoommmmaannddaattiioonnss cchhaappiittrree 1100 NN :: hhttttpp::////wwwwww..eeqquuiippeemmeenntt..ggoouuvv..ffrr// oonnss ssoonntt rraappppeellééeess ddaannss lleess rraappppoorrttss nniisséé àà BBrreesstt lleess 1111--1166 MMaarrss 22000022,, CCoo iirroonnnneemmeenntt MMaarriinn vveellooppppeerraa mmoonn aarrgguummeennttaaiirree aauu ccoouu ééee àà llaa ssééccuurriittéé.. UUUUUUUUEEEEEEEE AAAAAAAATTTTTTTTTTTTTTTTEEEEEEEENNNNNNNNTTTTTTTTIIIIIIIISSSSSSSSTTTTTTTTEEEEEEEE AAAAAAAA LLLLLLLL''''''''OOOOOOOOBBBBBBBBLLLLLLLLIIIIIIIIGGGGGGGGAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDD''''''''AAAAAAAA pprreessssiioonn ddee ll''ooppiinniioonn ppuubblliiqquuee rrééssuulltt ssoouullèèvvee ccee ppoossttuullaatt eesstt ppoouurrqquuooii «« rréé dd''uunn éévvèènneemmeenntt,, eett nnoonn aannttiicciippaattiioonn llee ccoonntteexxttee ééccoonnoommiiqquuee qquuii rrééggiitt llee t nnee ggrraannddee ppaarrttiiee ddee llaa rrééppoonnssee.. ffffeettss ddee llaa pprreessssiioonn ppooppuullaaiirree ssuurr llee ss llaa ccaauussee ddee cceettttee rrééaaccttiioonn,, iill ffaauutt aauu qquu''iimmpplliiqquueenntt uunnee éévvoolluuttiioonn ddee llaa ssééc eess ddééggaaggeemmeenntt dd''aaiirr aallllaassttss qquuii oonntt ééttéé pprriiss ((((((((66666666)))))))) ttrroopphhee ddee ll''EERRIIKKAA,, llaa ddee ccllaassssiiffiiccaattiioonnss.. LLee aauuttrreemmeenntt ddiitt ll''eeffffeeccttiiff EEttaattss dduu ppaavviilllloonnss eett cctt ddee llaa ncc pplluuss àà ddéémmoonnttrreerr,, tt ddee cceess eennqquuêêtteess.. rriiss eenn ccoommppttee ddaannss rree ddaannss tteell oouu tteell tt llaa mmoottiivvaattiioonn rrééeellllee èègglleess qquuii ppeeuuvveenntt bbiieenn eennttaabbiilliittéé »».. bbuurreeaauu vveerriittaass)) nnoouuss nnuuss lloorrss dduu ccoollllooqquuee mmee eesstt ppoouurr ll''iinnssttaanntt :: ééggaall oobblliiggaattiioonn ppoouurr 00 dduu rraappppoorrtt //aaccttuuaalliitteess//rraappppoorrttss ss aannnnuueellss dduu BBEEAA ppoouurr oonnfféérreennccee SSééccuurriittéé uurrss ddee llaa pprroocchhaaiinnee AAAAAAAAGGGGGGGGIIIIIIIIRRRRRRRR ttee ll''oobblliiggaattiioonn ppoouurr lleess ééaaccttiioonn »»,, tteerrmmee qquuii ?? ttrraannssppoorrtt mmaarriittiimmee sseecctteeuurr ddee llaa ssééccuurriittéé u pprrééaallaabbllee aavvooiirr uunnee éccuurriittéé ddaannss llee sseecctteeuurr
  • mmaarriittiimmee aaffiinn ddee ccoommpprreennddrree qq qquuaassiimmeenntt iimmppeennssaabbllee ddee vvooiirr cc §§22..11 LLEE CCOONNTTEEXXTTEE EECCOONNOOMMIIQQ EEnn 22000011,, 55,,8899 mmiilllliiaarrddss ddee ttoonnnn mmaarriittiimmee,, llaa fflloottttee mmaarriittiimmee mmoo mmaarriittiimmee iinntteerrnnaattiioonnaall aa aauuggmmee dduu ccoommmmeerrccee iinntteerrnnaattiioonnaall.. CCeess cchhiiffffrreess ddéémmoonnttrreenntt llaa ppuuiiss mmaarriittiimmee.. LLeess ddeeuuxx tteerrmmeess lleess pplluuss eemmpplloo «« rreennttaabbiilliittéé »» eett «« ccoonnccuurrrreennccee EEnn eeffffeett qquuii ddiitt ccoonnccuurrrreennccee ddiitt eett ppoouurr oobbtteenniirr llaa mmeeiilllleeuurree rreenn ccoonnccuurrrreennccee,, llee ttrraannssppoorrtteeuurr (( ll ddeess ééccoonnoommiieess ssuurr lleess cchhaarrggeess ddee vvooyyaaggee.. AAiinnssii ccee sseerroonntt ssoouuvveenntt lleess cchhaar dd''ééqquuiippaaggee ssaannss ppaarrlleerr ddeess cchhaa mmaannaaggeemmeenntt,, aassssuurraannccee)),, ttrrooiiss LL''OOCCDDEE aa ddéémmoonnttrréé qquu''uunn aarrmmaa ssééccuurriittéé ppoouurrrraaiitt ééccoonnoommiisseerr jjuu 1100%% ddeess cchhaarrggeess gglloobbaalleess.. LLee CC aannaallyyssee ssuurr llee ssuurrccooûûtt dd''eexxppllooiitt ddee pprrootteeccttiioonn ddee ll''eennvviirroonnnneemmee ppoouurr uunn ppééttrroolliieerr ddee ttaaiillllee mmooyyee rrèègglleess mmiinniimmaalleess ddee ssééccuurriittéé.. AA ll''oorriiggiinnee ddee cceettttee ddéérriivvee ddaannss ffrreett mmaarriittiimmee :: llee ccooûûtt mmiinniimmuumm dduuqquueell llaa ssééccuurriittéé nnee ppeeuutt pplluuss cchhuuttéé àà 2255000000 ddoollllaarrss jjoouurr.. EEssssaayyoonnss dd''oobbtteenniirr uunn oorrddrree dd''ii rreessppeecctt ddeess rrèègglleess mmiinniimmaalleess dd SSuurr llee ppllaann dduu ccooûûtt dd''eexxppllooiittaattiioo aauu ffoonnccttiioonnnneemmeenntt ddee ll''eennttrreepprr ll''ééqquuiivvaalleenntt dduu ppaavviilllloonn ffrraannççaaiiss 2255 ppeerrssoonnnneess (( 44 ooffffiicciieerrss,, 66 ssoo ppaarr mmooiiss ssoouuss ppaavviilllloonn bbrriittaannnniiqq eesstt ddoonncc ddee 11 àà 33..((((((((99999999)))))))) ((((((((99999999)))))))) :::::::: SSoouurrcceess OOCCDDEE-- OOEECCDD((OOrrgg )) :: hhttttpp::////wwwwww..ooeeccdd..oorrgg// qquu''eeffffeeccttiivveemmeenntt ssaannss cceettttee pprreessssiioonn ccee sseecctteeuurr éévvoolluueerr ddee lluuii--mmêêmmee.. QQUUEE,, FFRREEIINN AAUUXX PPRROOGGRREESS SSEECCUURRIITTAA nneess ddee mmaarrcchhaannddiisseess oonntt ééttéé aacchheemmi oonnddiiaallee ccoommppoorrttaanntt pplluuss ddee 4466000000 nna eennttéé ddee 3355%% eenn 1100 aannss,, ppaarraallllèèlleemmee ssssaannccee qquuee ppeeuutt rreepprréésseenntteerr ttoouutt llee ooyyééss ddaannss llee mmoonnddee dduu ttrraannssppoorrtt mmaa ee »»,, ddeeuuxx nnoottiioonnss qquuii ssee ccoommppllèètteenntt ccooûûtt ddee ttrraannssppoorrtt ppoouurr llee cchhaarrggeeuurr nnttaabbiilliittéé ppoossssiibbllee ttoouutt eenn ééttaanntt ccoommpp ll''aarrmmaatteeuurr)) aauurraa ((pprreessqquuee)) ttoouujjoouurrss ffiixxeess dd''eexxppllooiittaattiioonn eett ssuurr lleess aauuttrreess arrggeess dd''eennttrreettiieenn eett ddoonncc ddee llaa ssééccuurrii aarrggeess ddee ffoonnccttiioonnnneemmeenntt ddee ll''eennttrreepprr ss ffaacctteeuurrss iinnddiissssoocciiaabblleess ddee llaa ssééccuurrii aatteeuurr qquuii ppaarrvviieennddrraaiitt àà nnee ppaass rreessppe uussqquu''àà 3300%% ddee sseess cchhaarrggeess dd''eexxppllooiitt CCoommiittéé ddeess TTrraannssppoorrttss MMaarriittiimmeess ddee ttaattiioonn ccoorrrreessppoonnddaanntt aauu rreessppeecctt ddeess eenntt :: llee ssuurrccooûûtt ppoouurrrraaiitt ss''éélleevveerr àà 11 eennnnee ssooiitt uunnee ééccoonnoommiiee ééqquuiivvaalleennttee ss llee ddoommaaiinnee ddee llaa ssééccuurriittéé mmaarriittiimmee, mm dd''uunn ggrrooss ttaannkkeerr eesstt ddee 4455000000 ddooll êêttrree ttoottaalleemmeenntt aassssuurrééee aalloorrss qquuee ll iiddééee ddeess mmoonnttaannttss ffiinnaanncciieerrss qquu''iimmpp ddee ssééccuurriittéé.. oonn hhoorrss aassppeecctt tteecchhnniiqquuee,, ccoonncceerrnnaann rriissee,, ssii ll''oonn pprreenndd llee ppaavviilllloonn bbrriittaannnnii ss dd''iimmmmaattrriiccuullaattiioonn KKeerrgguueelleenn )),, llee cc oouuss--ooffffiicciieerrss eett 1155 mmaarriinnss )) eesstt ddee 9955 qquuee,, eett ddee 3333 000000 $$ ssoouuss ppaavviilllloonn aass ggaanniissaattiioonn ffoorr EEccoonnoommiicc CCoo--ooppeerraattiioo ppooppuullaaiirree,, iill eesstt AAIIRREE miinnééss ppaarr vvooiiee naavviirreess ..LLee ttrraannssppoorrtt eenntt aauu ddéévveellooppppeemmeenntt sseecctteeuurr dduu ttrraannssppoorrtt aarriittiimmee ssoonntt ddaannss ccee sseecctteeuurr.. llee pplluuss ffaaiibbllee ppoossssiibbllee ppééttiittiiff ffaaccee àà llaa ss llaa tteennttaattiioonn ddee ffaaiirree ss cchhaarrggeess qquuee cceelllleess iittéé,, lleess cchhaarrggeess rriissee ((ttaaxxeess,, iittéé.. eecctteerr lleess rrèègglleess ddee ttaattiioonn eett aauu mmiinniimmuumm ee ll''OOCCDDEE aa mmeennéé uunnee rrèègglleess ddee ssééccuurriittéé eett mmiilllliioonn UUSS$$ ppaarr aann e ssaannss rreessppeecctt ddeess e,, llaa cchhuuttee dduu pprriixx dduu llllaarrss jjoouurr eenn ddeessssoouuss llee ttaauuxx ddee ffrreett aa lluuii pplliiqquuee jjuusstteemmeenntt llee nntt lleess cchhaarrggeess pprroopprreess iiqquuee (( qquuii eesstt uunn ppeeuu ccooûûtt dd''uunn ééqquuiippaaggee ddee 55 000000 $$ aamméérriiccaaiinnss ssiiaattiiqquuee.. LLee rraappppoorrtt oonn aanndd DDeevveellooppmmeenntt
  • CCeeccii nn''ééttaanntt qquuee llee ccooûûtt ddee ll''ééqq ppaavviilllloonn,, cc''eesstt--àà--ddiirree lleess ccoonnttrrôô ddaannss uunn ppaayyss qquuii ddéélliivvrree ddeess ppaa AAuuttrree eexxeemmppllee :: uunn nnaavviirree ddee cc ccoommbbiinnaaiissoonnss dd''iimmmmeerrssiioonnss qquuee qquuee llaa ccoonnvveennttiioonn SSOOLLAASS nn''eenn ii ééttaanntt dd''eennvviirroonn 880000 eeuurrooss ppiièèccee ffrraannççaaiiss aarrmméé ddee qquuiinnzzee mmeemmbb SSuurr llee ppllaann dduu ccooûûtt ddeess éévvoolluuttiioo iimmppoorrttaannttss :: PPoouurr eexxeemmppllee llee ssuurrccooûûtt qquu''aa ee ss''eessttiimmee àà 11 mmiilllliioonn dd''eeuurrooss,, ccee ccooqquuee eett uunn ppééttrroolliieerr ddoouubbllee ccoo uunniittéé.. AA llaa ssuuiittee ddee llaa ccaattaassttrroopphhee ddee ll''iinnssttaallllaattiioonn ddee ggaazz iinneerrttee aa ééttéé ppoorrtt eenn lloouurrdd ppaarr uunn pprroottooccoollee à dd''iinnssttaallllaattiioonn dd''eennvviirroonn 220000000000 DDee nnooss jjoouurrss ppoouurr uunnee ccoommppaaggnn mmiissee eenn ppllaaccee dd''uunnee tteellllee rréégglleemm CCeettttee lliimmiittee ddee 2200000000 ttoonnnneess ssee dduu ppééttrroolliieerr CCHHAASSSSIIRROONN ddee llaa ss eexxpplloossiioonn qquuii aa ccooûûttéé llaa vviiee àà uu AAiinnssii ttoouuttee éévvoolluuttiioonn ddeess tteexxtteess ddoouulleeuurr ppaarr lleess aarrmmaatteeuurrss qquuii nn pprréévveennttiioonn.. RRaappppeelloonnss qquuee ll''OOMM ppaavviilllloonnss ddiittss ddee ccoommppllaaiissaannccee cceess ééttaattss ffaaiirree eenntteennddrree llaa vvooiixx AAlloorrss ppoouurrqquuooii ll''éémmeerrggeennccee ddee dd''aabboorrdd,, mmaallhheeuurreeuusseemmeenntt àà llaa aauuccuunnee mmeessuurree aavveecc lleess ccooûûttss qq qquuee llaa ffaaccttuurree ddee llaa ccaattaassttrroopphhee eenn ddoommmmaaggeess eett iinnttéérrêêttss ppoouurr LLee ssuurrccooûûtt qquu''eennggeennddrreerraaiitt llaa mm dduu TTIITTAANNIICC ppoouurr êêttrree ccoonnffoorrmmee ssuupppplléémmeennttaaiirreess ((((((((1111111100000000)))))))) ssooiitt uunn ssuu aavveecc llaa ppeerrttee ddee 11551177 ppeerrssoonnnnee LLaa pprreessssiioonn ppooppuullaaiirree,, bbiieenn ssoouu ddéétteerrmmiinnaanntt qquuii ppeerrmmeett aauu sseecct ppooiiddss dduu ccoonntteexxttee ééccoonnoommiiqquuee.. §§22..22 LLAA PPRREESSSSIIOONN PPOOPPUULLAAIIRREE quuiippaaggee àà cceellaa iill ffaauuddrraaiitt aajjoouutteerr llee ccoo ôôlleess aannnnuueelllleess eett lleess ttaaxxeess qquuii ssoonntt llaa aavviilllloonnss ddee ccoommppllaaiissaanncceess.. cchhaarrggee,, ssoouuss ppaavviilllloonnss ffrraannççaaiiss,, ddooiitt ee ddee mmeemmbbrreess dd''ééqquuiippaaggee pprréévvuuss eenn iimmppoossee qquuee ttrrooiiss :: llee ccooûûtt dd''uunnee ccoomm ee,, llee ssuurrccooûûtt ffiinnaanncciieerr ppoouurr llee uunn nnaavv bbrreess dd''ééqquuiippaaggee eesstt ddoonncc dd''eennvviirroonn 11 oonnss tteecchhnniiqquueess,, lleess cchhiiffffrreess ddeevviieennnnee eennttrraaîînnéé llaa rréégglleemmeennttaattiioonn ssuurr lleess nnaa ee qquuii rreepprréésseennttee llaa ddiifffféérreennccee eennttrree uu ooqquuee dd''uunnee lloonngguueeuurr dd''eennvviirroonn 110000 mm ll''AARRGGOO MMEERRCCHHAANNTT llee 1144 ddéécceemmbbrree éé iimmppoossééee ssuurr lleess ppééttrroolliieerrss ddee pplluuss d àà llaa ccoonnvveennttiioonn SSOOLLAASS,, cceeccii àà rreepprréé 0 eeuurrooss ppaarr ssyyssttèèmmee ddee ggaazz iinneerrttee.. nniiee ppééttrroolliièèrree eexxppllooiittaanntt uunnee cciinnqquuaann mmeennttaattiioonn ccooûûtteerraaiitt 1100 mmiilllliioonnss dd''eeuu eerraa ppeeuutt êêttrree uunn jjoouurr rreemmiissee eenn ccaauu ssoocciiééttéé PPééttrroommaarriinnee lloorrss dd''uunnee ooppéérraa uunn mmaatteelloott.. ss eenn ffaavveeuurr ddee llaa ssééccuurriittéé eesstt bbiieenn ssoo nnee ssoonntt ffaattaalleemmeenntt gguuèèrree eenncclliinn àà uunn MMII ddee ppaarrtt ssaa nnaattuurree ppeerrmmeett aauuxx ppaayy ddee ppeesseerr lloouurrddeemmeenntt ddaannss lleess ddéécciissii xx ddeess aarrmmaatteeuurrss.. nnoorrmmeess,, ddee rréégglleemmeennttaattiioonn ddaannss ccee aa ssuuiittee ddeess ccaattaassttrroopphheess,, llee bbiillaann eesstt qquuii sseerraaiieenntt eennggeennddrrééss ppaarr uunnee pprréévv ee ddee ll''EEXXXXOONN VVAALLDDEEZZ aa aatttteeiinntt cciinnqq llee ggrroouuppee EEXXXXOONN.. mmiissee eenn ccoonnffoorrmmiittéé eenn tteerrmmee dd''eemmbbaa ee SSOOLLAASS,, sseerraaiitt dd''aauu mmooiinnss 3300 eemmbbaa uurrccooûûtt eessttiimméé àà 11 550000 000000 eeuurrooss ;; ee eess.. ?? uuvveenntt ll''éémmoottiioonn ppooppuullaaiirree,, eesstt cceerrttaaiinn ctteeuurr ddee llaa ssééccuurriittéé mmaarriittiimmee dd''éévvoolluu .. EENN FFAAVVEEUURR DDEE LLAA SSEECCUURRIITTEE MMAARRIITT ooûûtt dduu mmaaiinnttiieenn dduu aarrggeemmeenntt iinnfféérriieeuurr eemmppoorrtteerr aauuttaanntt ddee nn eexxppllooiittaattiioonn aalloorrss mmbbiinnaaiissoonn dd''iimmmmeerrssiioonn vviirree ssoouuss ppaavviilllloonn 1100000000 eeuurrooss.. eenntt bbiieenn pplluuss aavviirreess ddoouubblleess ccooqquueess uunn ppééttrroolliieerr ssiimmppllee mmèèttrreess,, ssooiitt uunnee ppeettiittee 11997766,, lloorrssqquuee ddee 2200000000 ttoonnnneess ddee éésseennttéé uunn ccooûûtt nnttaaiinnee ddee ppééttrroolliieerrss,, llaa uurrooss.. ussee ssuuiittee àà ll''eexxpplloossiioonn aattiioonn ddee llaavvaaggee,, oouuvveenntt aaccccuueeiillllii aavveecc nnee ppoolliittiiqquuee ddee yyss ddéélliivvrraanntt ddeess iioonnss eett ppaarr llee bbiiaaiiss ddee ee ccoonntteexxttee :: ttoouutt tt bbiieenn ssoouuvveenntt ssaannss vveennttiioonn.. CC''eesstt aaiinnssii mmiilllliiaarrddss ddee ddoollllaarrss aarrccaattiioonn ddee ssaauuvveettaaggee aarrccaattiioonnss eesstt ccee ccoommppaarraabbllee nneemmeenntt llee ffaacctteeuurr uueerr,, ssuurrmmoonnttaanntt llee TTIIMMEE
  • EEnn ffaaiitt ssaannss pprrééjjuuggeerr ddee llaa ppoossii qquu''iinntteerrnnaattiioonnaalleess eenn mmaattiièèrree dd ppoolliittiiqquuee dd''ééllaabboorraattiioonn oouu ddee mm aa,, jjuussqquu''àà pprréésseenntt ééttéé llee rrééssuullttaa éémmoottiioonn ppooppuullaaiirree mmaaiinntteennaanntt rr ccoommmmuunniiccaattiioonn ;; ttéélléévviissiioonn,, rraadd LLee mmééccoonntteenntteemmeenntt ssee ffaaiitt ccoonn aacctteeuurrss dduu mmiilliieeuu mmaarriittiimmee qquu''ii mmééccoonntteenntteemmeenntt ppeeuutt ssee ttrraadduu rrééssuullttaattss aauuxx éélleeccttiioonnss.. NNoouuss ppoouuvvoonnss ddoonncc ééttuuddiieerr lleess ppoouuvvooiirr ssuurr lleess iinntteerrvveennaannttss ddee pprrooffeessssiioonnnneell :: ((((((((1111111100000000)))))))) :: eessttiimmaattiioonn àà ppaarrttiirr ddee llaa nnaavviirreess àà ppaassssaaggeerrss.. aa)) ssuurr llee ppllaann ppoolliittiiqquuee :: AA ll''ééppoo ccee qquu''àà PPaarriiss,, rrééaalliissaaiitt uunn ttiirraaggee mmiilllliioonnss eenn pprroovviinncceess..((((((((1111111111111111)))))))) LLee TTIITTAANNIICC aavvaaiitt àà ssoonn bboorrdd ddee AAmméérriiccaaiinnee.. CC''eesstt ddaannss ccee ccoonnttee rreetteennttiisssseemmeenntt eexxttrraaoorrddiinnaaiirree.. rraappppoorrtt ddee llaa ccoommmmiissssiioonn sséénnaatt jjuussttiiffiiccaattiioonn ddee ll''ééttaabblliisssseemmeenntt ssoonntt ddoonncc ccoonnssttiittuuééeess rraappiiddeemmee aapprrèèss llaa ccaattaassttrroopphhee.. DDaannss llee ccaaddrree dduu TTIITTAANNIICC,, llee ffaa nnoommbbrree ddee ppeerrtteess hhuummaaiinneess eett ll''AAnngglleetteerrrree eett lleess EEttaattss UUnniiss.. DD''aauuttrreess éévvèènneemmeennttss ddee mmeerr qq llee mmêêmmee rreetteennttiisssseemmeenntt.. SSooiitt pp llooccaalliissaattiioonn dduu ssiinniissttrree oouu lleess vvii LL''aauuttrree sseecctteeuurr qquuii éémmeeuutt aaccttuuee ddeeppuuiiss ll''AAMMOOCCOO CCAADDIIZZ lleess aaccccii LL''OOPPAA aauurraaiitt iill vvuu llee jjoouurr eenn àà pp ssaannss llaa rreettrraannssmmiissssiioonn ddee mmiilllliiee ccoommmmee iill aa ppuu ll''eexxpprriimmeerr lloorrss dd CCeeppeennddaanntt llaa pprreessssiioonn mmééddiiaattiiqq mmééddiiaattiiqquuee :: LLoorrssqquuee ssuurrvviieenntt uu ppooppuullaattiioonn,, ppoouurr lleess iinnssttaanncceess pp ddeess ddéécciissiioonnss,, oonn nnee ppeeuutt bbiieenn ddaannss uunnee eenncceeiinnttee iinntteerrnnaattiioonnaa eett ll''oobbtteennttiioonn dd''uunn ccoonnsseennssuuss sso iittiioonn ffuuttuurree ddeess ddiifffféérreennttss oorrggaanneess ttaa ddee pprréévveennttiioonn,, ffoorrccee eesstt ddee ccoonnssttaatteerr mmiissee eenn ooeeuuvvrree ddee tteexxtteess ccoonncceerrnnaanntt aatt ddee llaa pprreessssiioonn ppooppuullaaiirree oouu ddee ll''éémm rreellaayyééee ppaarr lleess ddiifffféérreenntteess tteecchhnniiqquuee ddiioo,,iinntteerrnneett...... nnnnaaîîttrree eett ssee pprrooppaaggee ppaarr llee bbiiaaiiss ddeess iillss ssooiieenntt pprriivvééss oouu nnoorrmmaattiiffss ssaavveenntt uuiirree ppaarr ssooiitt uunn cchhiiffffrree dd''aaffffaaiirree eenn bbaa eeffffeettss ddee llaa pprreessssiioonn ppooppuullaaiirree ssoouuss ee llaa vviiee ppoolliittiiqquuee eett ssoonn ppoouuvvooiirr ssuurr lle rréégglleemmeennttaattiioonn SSOOLLAASS eenn vviigguueeuurr aa ooqquuee dduu nnaauuffrraaggee dduu TTIITTAANNIICC llaa pprree ee ddee cciinnqq mmiilllliioonn cciinnqq cceenntt mmiillllee eexxeemm eess mmeemmbbrreess ddee llaa hhaauuttee bboouurrggeeooiissiiee eexxttee qquuee ssuurrvvîînntt llaa ccaattaassttrroopphhee qquuii ee CCeettttee éémmoottiioonn eesstt mmeennttiioonnnnééee eenn iinn ttoorriiaallee ddeess EEttaattss--UUnniiss ((((((((1111111122222222)))))))) eett eesstt uunn ddee cceettttee ccoommmmiissssiioonn.. DDeeuuxx ccoommmmiisss eenntt,, ll''uunnee àà LLoonnddrreess,, ll''aauuttrree àà NNeeww YY aacctteeuurr qquuii aa ddéécclleenncchhéé cceettttee éémmoottiioonn qquuii pplluuss eesstt,, aappppaarrtteennaanntt àà ddeess ssoocc qquuii oonntt ccooûûttéé ééggaalleemmeenntt ddeess ppeerrtteess hh ppaarrccee qquuee sseeuullss lleess mmaarriinnss ééttaaiieenntt ccoo iiccttiimmeess nn''aappppaarrtteennaaiieenntt ppaass àà uunn ppaay eelllleemmeenntt llaa ssoocciiééttéé eesstt llee sseecctteeuurr ddee iiddeennttss ddee ppééttrroolliieerrss ssoonntt éénnoorrmméémmeenn ppeeiinnee 1188 mmooiiss aapprrèèss llaa ccaattaassttrroopphhee dd eerrss dd''ooiisseeaauuxx mmaazzoouuttééss.. MMoonnssiieeuurr BBoo dduu ccoollllooqquuee SSaaffeerrsseeaass..((((((((1111111133333333)))))))) qquuee ppeeuutt mmeenneerr àà llaa pprréécciippiittaattiioonn eett uunnee ccaattaassttrroopphhee qquuii éémmeeuutt uunnee ggrraann ppoolliittiiqquueess iill nnee ss''aaggiitt pplluuss ddee tteerrggiivvee ssoouuvveenntt ppaass pprreennddrree llee tteemmppss dd''uunnee aallee ccoommmmee ll''OOMMII.. LLeess ddééllaaiiss ppoouurr ll''éélla soonntt ttrroopp lloonnggss.. CC''eesstt aaiinnssii qquuee ddeess aanntt ééttaattiiqquueess rr qquuee llaa vvoolloonnttéé llaa ssééccuurriittéé mmaarriittiimmee mmoottiioonn ppooppuullaaiirree,, eess ddee ss mmééddiiaass,, eett ttoouuss lleess tt qquuee ccee aaiissssee,, ssooiitt ddee mmaauuvvaaiiss ss ddeeuuxx aassppeeccttss :: ssoonn ee mmiilliieeuu aaccttuueelllleemmeenntt ppoouurr lleess eessssee ééccrriittee,, nnee sseerraaiitt mmppllaaiirreess eett pplluuss ddee ssiixx ee AAnnggllaaiissee eett eeûûtt aaiinnssii uunn nnttrroodduuccttiioonn ddaannss llee nn ddeess aarrgguummeennttss ddee llaa sssiioonnss dd''eennqquuêêtteess ssee YYoorrkk mmooiinnss dd''uunn mmooiiss nn ééttaaiitt ddoonncc llee ggrraanndd cciiééttééss cciivviilliissééeess ccoommmmee hhuummaaiinneess nn''oonntt ppaass eeuu oonncceerrnnééss,, ssooiitt llaa ayyss ttrrèèss iinndduussttrriiaalliisséé.. ee ll''eennvviirroonnnneemmeenntt :: nntt mmééddiiaattiissééss.. ddee ll''EEXXXXOONN VVAALLDDEEZZ ooiissssoonn eenn ddoouuttee àà llaa ssuurreenncchhèèrree nnddee ppaarrttiiee ddee llaa eerrsseerr,, iill ffaauutt pprreennddrree ee rrééfflleexxiioonn mmeennééee laabboorraattiioonn ddeess tteexxtteess
  • ((((((((1111111111111111)))))))) :::::::: JJaaccqquueess WWoollggeennssiinnggeerr -- 11998899 ((((((((1111111122222222)))))))) :::::::: BBuulllleettiinn ddee llaa NNaavviiggaattiioonn SSéénnaattoorriiaallee ddeess EEttaattss--UUnniiss ssuurr l ((((((((1111111133333333)))))))) :::::::: VVooiirr nnoottee ((88)) ppaaggee 1133 ddéécciissiioonnss uunniillaattéérraalleess oouu rrééggiioonn iimmppoosséé ddee mmaanniièèrree uunniillaattéérraallee AA ll''hheeuurree aaccttuueellllee nnoommbbrreeuuxx ssoo ppééttrroolliieerrss ssiimmpplleess ccooqquueess iimmppoos qquu''àà ll''ééppooqquuee lleess cchhaannttiieerrss ddee ll ddéévveerrsseemmeenntt dd''hhyyddrrooccaarrbbuurree ssuu ((((((((1111111144444444)))))))) qquuii nn''aa jjaammaaiiss ééttéé ssuuiivvii dd''ee AA llaa ssuuiittee dduu PPRREESSTTIIGGEE uunnee ddéécc ddee mmaanniièèrree ttoouutt aauussssii rraappiiddee ssoo AAuu pprrééaallaabbllee llee ggoouuvveerrnneemmeenntt AA llaa ccrriissee eett ddeess mmoouuvveemmeennttss ddee ddaannss lleess rruueess ddee MMaaddrriidd eeuurreenntt LLaa mmiissee eenn ooeeuuvvrree ddee cceess aaccccoorr ddeemmaannddaanntt àà cceerrttaaiinnss nnaavviirreess dd TToouujjoouurrss àà llaa ssuuiittee dduu PPRREESSTTIIGG llee ppllaann nnaattiioonnaallee ttoouutt dd''aabboorrdd ll'' ccooqquuee dd''uunn ppoorrtt eenn lloouurrdd ddee pplluu pprrooppoossiittiioonn qquuii dd''uunn ppooiinntt ddee vvuu dd''uunnee tteellllee mmeessuurree rreennddaaiitt iimmppoo ggrraannddee mmaajjoorriittéé pplluuss ddee 660000 ttoo lloouurrddeemmeenntt lleess ppoorrttss ffrraannççaaiiss qq ppoorrtteess ccoonnttaaiinneerrss nnoottaammmmeenntt ;; ll''iinntteerrmmééddiiaaiirree dd''uunnee lleettttrree ddee dd iimmpplliiqquuééss ddaannss ccee ggeennrree ddee ttrraan pprroobbllèèmmee.. LL''iinndduussttrriiee aa ééggaalleemm ssttoocckkaaggee ssii uunnee tteellllee mmeessuurree éétt ll''iinntteerrmmééddiiaaiirree ddeess mmiinniissttrreess ddee 22000033 oonntt rreetteennuu uunn aassssoouupplliissssee eeuurrooppééeennnnee eenn rreeppoouussssaanntt llaa lliim ((((((((1111111144444444)))))))) :: EEEEEE ppoouurr EEccoonnoommiiqquuee EEuu ddee ll''AAttllaannttiiqquuee .. LLee ssyyssttèèmmee ééttaa eemmppêêcchhaaiitt ttoouutt ddéévveerrsseemmeenntt ddee ppoorrtt eenn lloouurrdd eett eenn aaccccoorrddaanntt uu ddaannss lleess ppoorrttss (( rraavviittaaiilllleemmeenntt )) MMaaiiss eennccoorree uunnee ffooiiss lleess pprreemmiièè aatttteenntteess ddee ll''ooppiinniioonn ppuubblliicc ééttaaii LLaa ggrraannddee aavveennttuurree ddee llaa pprreessssee -- DD nn eett ddeess PPêêcchheess mmaarriittiimmeess,, rraappppoorrtt dd llaa CCaattaassttrroopphhee dduu TTIITTAANNIICC,, ssoouurrccee :: nnaalleess vvooiieenntt llee jjoouurr :: cc''eesstt llee ccaass ppoouu ppaarr lleess EEttaattss--UUnniiss eett ssuurrttoouutt ssaannss ccoo oonntt lleess pprrooffeessssiioonnnneellss qquuii ss''iinntteerrrrooggee ossééss ppaarr lleess EEttaattss--UUnniiss ddaannss llee ccaaddrree ll''AAttllaannttiiqquuee pprrooppoossaaiitt uunnee aauuttrree ssoolluu uuiittee àà uunn nnaauuffrraaggee oouu uunn éécchhoouueemmeenn eeffffeett ppoouurr rraaiissoonn ccoommmmeerrcciiaallee.. cciissiioonn ppoolliittiiqquuee bbii llaattéérraallee FFrraannccoo-- EEs oouuss llee ccoouupp ddee ll''éémmoottiioonn ppuubblliiqquuee :: ll AAzznnaarr ffûûtt vviivveemmeenntt ccrriittiiqquuéé ppoouurr ssaa pprrootteessttaattiioonnss rrééuunniissssaanntt ddeess mmiilllliieerrs tt lliieeuu.. rrddss iinntteerrvveennaaiitt llaa sseemmaaiinnee ssuuiivvaannttee l ddee ssoorrttiirr ddee llaa zzoonnee ééccoonnoommiiqquuee eexxccl GGEE,, llaa FFrraannccee ttoouutt dd''aabboorrdd aa ééttéé ttrrèèss ''iinntteerrddiiccttiioonn iimmmmééddiiaattee àà ttoouutt nnaavviirree uuss ddee 660000 ttoonnnneess ddee ttrraannssppoorrtteerr ddeess uuee mmééddiiaattiiqquuee aa uunn iimmppaaccttee iimmppoorrttaa oossssiibbllee llee rreennoouuvveelllleemmeenntt ddeess ssoouutteeuu oonnnneess ddee ppoorrtt eenn lloouurrdd ;; uunnee tteellllee mmee qquuii nnee ppoossssééddaaiitt pplluuss ddee sseerrvviiccee ddee ss ;; hheeuurreeuusseemmeenntt llee ccoommiittéé cceennttrraallee aa ddoollééaannccee rreeggrroouuppaanntt lleess rreemmaarrqquueess d annssppoorrtt aa ppeerrmmiiss ddee ffaaiirree pprreennddrree ccoonn mmeenntt ffaaiitt ccoonnnnaaîîttrree sseess ccrraaiinntteess ccoonnccee ttaaiitt aaddooppttééee eenn ll''ééttaatt.. LLaa FFrraannccee ppuuiiss eess ttrraannssppoorrttss qquuii ssee ssoonntt rrééuunniiss àà BBrr eemmeenntt ddeess pprrooppoossiittiioonnss ffaaiitteess iinniittiiaallee immiittee mmiinniimmuumm ddee 660000 àà 55000000 ttoonnnnee uurrooppééeenn EEnnvviirroonnnneemmeenntt.. PPééttrroolliieerr ccoo aaiitt bbaasséé ssuurr lleess ééqquuiilliibbrreess hhyyddrroossttaattii ee ppééttrroollee ddaannss llaa mmeerr eenn ccaass dd''éécchhoouu uunnee ddéérrooggaattiioonn ppoouurr lleess ppééttrroolliieerr nnaavv )).. èèrreess mmeessuurreess qquuii ssee vvoouullaaiieenntt ttrrèèss rraa iieenntt ddaannss ll''aabbssoolluuee ttrrèèss nnoobblleess,, aauurraa DDééccoouuvveerrtteess GGaalllliimmaarrdd ddee llaa CCoommmmiissssiioonn :: ggaalllliiccaa..bbnnff..ffrr uurr ll''OOPPAA qquuii aa ééttéé oonnssuullttaattiioonn.. eenntt ssuurr ll''eeffffiiccaacciittéé ddeess ee mmêêmmee ddee ll''OOPPAA aalloorrss uuttiioonn aauu pprroobbllèèmmee dduu nntt :: llee ssyyssttèèmmee EEEEEE Essppaaggnnoollee aa ééttéé pprriissee lleess aaccccoorrddss ddee MMaallaaggaa.. ggeessttiioonn eerrrraattiiqquuee ddee rss ddee mmaanniiffeessttaannttss llee nnaauuffrraaggee,, llaa FFrraannccee clluussiivvee.. vviivvee àà ddeemmaannddeerr ssuurr ee ppééttrroolliieerr ssiimmppllee ss ffuueellss lloouurrddss,, aanntt mmaaiiss llaa ssoouuddaaiinneettéé uurrss qquuii ffoonntt ppoouurr llaa eessuurree ppéénnaalliissaaiitt ttrrèèss ssoouuttaaggee ppoouurr lleess aarrmmaatteeuurr ppaarr ddee ttoouuss lleess aarrmmaatteeuurrss nnsscciieennccee ddee ccee eerrnnaanntt lleess ccaappaacciittééss ddee ss eennssuuiittee ll''EEuurrooppee ppaarr rruuxxeellllee llee 2277 MMaarrss eemmeenntt àà llaa ccoommmmiissssiioonn eess ddee oonnssttrruuiitt aauu CChhaannttiieerr iiqquueess ccee qquuii uueemmeenntt dduu ppééttrroolliieerr.. vviiggaanntt eexxcclluussiivveemmeenntt aappiiddeess ffaaccee aauuxx aaiieenntt ccaauusséé dd''éénnoorrmmeess
  • ddiiffffiiccuullttééss ddaannss llee ttrraannssppoorrtt mmaa rraaiissoonnnnaabblleemmeenntt iill aa ééttéé ddéécciiddéé àà 660000 ttoonnnneess ddaannss uunn ddééllaaii ddee LL''aaffffaaiirree dduu BBIIZZAANNTTIIOO,, ppééttrroolliieer qquuiitttteerr ll''EEssttoonniiee ppoouurr SSiinnggaappoouur ttrraannssppoorrttaanntt llee mmêêmmee ttyyppee ddee cc rrééssuullttaannttee ddee llaa pprreessssiioonn mmééddiiaa ppuubblliiqquuee.. DDaannss cceettttee aaffffaaiirree llaa FFrraannccee aa ffaa ccee nnaavviirree àà ssoonn aarrrriivvéé àà TTaalllliinnee dd''uunn ccoonnttrrôôllee ddee ll''EEttaatt dduu ppoorrtt àà ddééffiicciieenncceess mmaajjeeuurreess qquuii eennttrreenn ddaannss ccee ccaass ppoouurrqquuooii ddeemmaannddee PPrreeuuvvee ddee llaa pprreessssiioonn eexxeerrccééee pp NNoovveemmbbrree 22000022 dduu sseeccrrééttaaiirree dd eesstt eenn EEssttoonniiee,, qquuii eesstt uunn ppaayy vvaa vvooiirr ssii ll''EEssttoonniiee aa vvrraaiimmeenntt ddéécciiddéé «« àà aaggiirr iimmmmééddiiaatteemmeenn vvéérriiffiiéé »».. AAjjoouuttaanntt ééggaalleemmeenntt :: «« SS''iill vveenn ddaannss lleess zzoonneess mmaarriittiimmeess dd''uunn iinntteerrvveenniirr »»,, «« lleess mmeessuurreess ddee MM LLeess iinntteennttiioonnss ddee MMrr BBuusssseerreeaauu aapppplliiccaabblleess àà ccee nnaavviirree,, iill vvoouullaa aavveecc dduu rreeccuull,, ssaannss llaa pprreessssiioonn ttrraannssppoorrttaanntt dduu ffuueell lloouurrdd,, rrééppoo ddaannss cceett aaccccoorrdd qquuii aauurraaiitt ppeerrmm ddééttoouurrnneerr.. IIll aauurraaiitt ddoonncc ffaalllluu ffa nn''aauurraaiitt ssaannss ddoouuttee rriieenn ddoonnnnéé,, sseemmaaiinnee pplluuss ttôôtt.. bb)) ssuurr llee ppllaann pprrooffeessssiioonnnneell :: LLaa ccaattaassttrroopphheess mmaarriittiimmeess :: ddeess mm ccoonnssttaatteerr ,, eenn ddiirreecctt ,, hheeuurreess pp ll''AAMMOOCCOO CCAADDIIZZ :: ddeess ooiisseeaauuxx ee QQuueellqquueess aannnnééeess pplluuss ttaarrdd ccee ss ddééssaassttrree ooccccaassiioonnnnéé àà ll''eennvviirroonn PPeennddaanntt pplluussiieeuurrss jjoouurrss llee mmoonn cchheemmiinnééee dduu ppééttrroolliieerr.. LLeess pprrooffeessssiioonnnneellss dduu ttrraannssppoorrtt lliiggnnee eett cc''eesstt aaiinnssii qquuee ddeess iinnssttrr mmaassqquueerr ttoouutt ssyymmbboollee ppoouuvvaanntt ccaattaassttrroopphhee.. aarriittiimmee eett ddaannss llee sseecctteeuurr ddee ll''iinndduussttr éé dd''eeffffeeccttuueerr ccee ppaassssaaggee ddee 55000000 ttoonn 33 aannss.. err àà ccooqquuee ssiimmppllee,, vviieeuuxx ddee 2266 aannss,, qq urr ppeeuu ddee tteemmppss aapprrèèss llee nnaauuffrraaggee dduu ccaarrggaaiissoonn,, ppeeuutt êêttrree ééggaalleemmeenntt ccoonnss aattiiqquuee iinnddiirreeccttee oouu pplluuss pprréécciisséémmeenntt faaiitt pprreessssiioonn ssuurr ll''EEssttoonniiee ppoouurr qquuee llee aalloorrss qquuee cceelluuii--ccii aavvaaiitt ffaaiitt ll''oobbjjeett,, uu àà RRootttteerrddaamm ssaannss qquuee ccee ccoonnttrrôôllee nnee nntt ddaannss llee ccaaddrree dduu MMeemmoorreenndduumm ooff eerr uunn aauuttrree ccoonnttrrôôllee eexxpprreesssséémmeenntt ?? ppaarr llaa FFrraannccee àà ccee mmoommeenntt ,, llaa ddééccllaa dd''EEttaatt aauuxx TTrraannssppoorrttss DDoommiinniiqquuee BBuu yyss qquuii vvaa eennttrreerr ddaannss ll''EEuurrooppee pprroocchhaa llaa vvoolloonnttéé ddee rreennttrreerr ddaannss ll''EEuurrooppee » nntt àà nnoottrree ddeemmaannddee ppoouurr ffaaiirree eenn ssoorr nnaaiitt pprrèèss ddee nnooss ccôôtteess,, iill ppéénnèèttrreerraaiitt cceerrttaaiinn nnoommbbrree ddee ppaayyss ..NNoouuss ppoouurrrr MMaallaaggaa ss''aapppplliiqquueerraaiitt àà ccee nnaavviirree »».. uu ééttaaiieenntt ccllaaiirreess lloorrssqquu''iill ppaarrllaaiitt ddeess mm aaiitt ddééttoouurrnneerr llee nnaavviirree hhoorrss ddee llaa ZZEEEE mmééddiiaattiiqquuee,, ccee nnaavviirree bbiieenn qquuee ddaattaa oonnddaaiitt ddee mmaanniièèrree ffaavvoorraabbllee àà ttoouuss ll mmiiss ddee lluuii ddeemmaannddeerr ddee ssee faaiirree uunn ccoonnttrrôôllee dduu nnaavviirree eenn pplleeiinnee ,, llee nnaavviirree aayyaanntt ééttéé ccoonnttrrôôlléé ddaannss llee aa ttéélléévviissiioonn aa ddoonnnnéé uunn aassppeecctt ssppeecctt mmiilllliioonnss ddee ttééllééssppeeccttaatteeuurrss ffrraannççaaiiss oo ppaarr hheeuurreess ,, lleess ddééggââttss ooccccaassiioonnnnééss pp eenngglluuééss eett ddeess ppllaaggeess ssoouuiillllééeess.. ssoonntt lleess aamméérriiccaaiinnss eett llee mmoonnddee eennttiie nnnneemmeenntt ppaarr ll''EEXXXXOONN VVAALLDDEEZZ.. nnddee eennttiieerr ppoouurrrraa oobbsseerrvveerr lleess lleettttrreess tt mmaarriittiimmee ppééttrroolliieerr ssee ssoonntt ddoonncc rreett rruuccttiioonnss oonntt ééttéé éémmiisseess eennvveerrss lleess bb tt rraattttaacchheerr uunn nnaavviirree àà llaa ssoocciiééttéé pprroo trriiee.. PPlluuss nnnneess ddee ppoorrtt eenn lloouurrdd qquuii ss''aapppprrêêttaaiitt àà uu PPRREESSTTIIGGEE eett ssiiddéérréé ccoommmmee llaa tt ddee ll''éémmoottiioonn eess aauuttoorriittééss ccoonnttrrôôlleenntt uunnee sseemmaaiinnee pplluuss ttôôtt,, ee rréévvèèllee ddee ff uunnddeerrssttaannddiinngg,, aalloorrss aarraattiioonn ssuurr iiTTVV llee 2277 uusssseerreeaauu:: «« ccee nnaavviirree aaiinneemmeenntt eett llaa FFrraannccee »» eett ssii ccee ppaayyss eesstt rrttee qquuee ccee nnaavviirree ssooiitt uunn cceerrttaaiinn mmoommeenntt rriioonnss ééggaalleemmeenntt mmeessuurreess ddee MMaallaaggaa EE ddee llaa FFrraannccee mmaaiiss aanntt ddee 11997766 eett lleess ccrriittèèrreess ddééffiinniiss e mmeerr,, ccoonnttrrôôllee qquuii ee ccaaddrree dduu MMOOUU uunnee ttaaccuullaaiirree aauuxx oouu ééttrraannggeerrss oonntt ppuu ppaarr ll''éécchhoouueemmeenntt ddee ieerr qquuii ddééccoouuvvrreenntt llee ss EEXXXXOONN ssuurr llaa ttrroouuvvééss eenn pprreemmiièèrree bboorrddss ppoouurr eessssaayyeerr ddee oopprriiééttaaiirree eenn ccaass ddee
  • PPaarr llaa ssuuiittee lleess pprriinncciippaalleess mmaajjoo mmaarriittiimmee ddee mmaanniièèrree ddiirreeccttee.. EEnn ffaaiitt lleess pprriinncciippaalleess ccoommppaaggnn ssyyssttèèmmee ddee ll''aaffffrrèètteemmeenntt ppoouurr e pprreemmiieerr lliieeuu lleess rreessppoonnssaabbiilliittéé dd ccaaddrree ddee ll''OOPPAA ooùù llee cchhaarrggeeuurr nn mmééccoonntteenntteemmeenntt ppooppuullaaiirree.. DDee pplluuss ll''aappppaarriittiioonn eett llee ddéévveelloo ddoonnnneerr ssoonn aavviiss eett uunnee ccaammppaagg ssiitteess ppaarrooddiiaanntt llee nnoomm ddee TTOOTTAA LL''éémmoottiioonn qquuee ccrréééé uunnee ccaattaassttrr cc''eesstt aauussssii llee ddaannggeerr ddee llaa pprreess mmaarriittiimmee ddooiivveenntt iinnttééggrreerr cceettttee AAiinnssii llee ddeeuuxxiièèmmee oobbjjeeccttiiff dduu ddéé ppaass ééttéé aatttteeiinntt ccoommmmee nnoouuss aavv cchhaarrggeeuurr,, TTOOTTAALL,, aa ééttéé pprrooppuullss ccoonnssttaatteerr qquuee lloorrssqquu''uunnee ccaattaasstt aauuttoommaattiiqquueemmeenntt mmiiss eenn ccaauussee ttrraannssppoorrtteeuurr eesstt ooccccuullttéé ppaarr cceell DDaannss ccee ccoonntteexxttee ll''iimmppaaccttee eesstt lleess mmééddiiaass qquuee lloorrssqquuee llee nnoomm llaa pprrooppoorrttiioonn ddee llaa ppooppuullaattiioonn qq qquuee ll''eennqquuêêttee eeuu bbeeaauuccoouupp ddee dd nnaavviirree )) eett llaa pprrooppoorrttiioonn ddee llaa LLeess aarrmmaatteeuurrss qquuaanntt àà eeuuxx nnee ss lliieeuu,, ccaarr ccoonnttrraaiirreemmeenntt aauuxx ccoomm iillss nn''oonntt ccoommmmee pprriinncciippaauuxx iinnttee êêttrree ttoouucchhééss qquuee ppaarr ttrraannssiittiivviitt LLee pprriinncciippee ddeess vveettttiinnggss ((iinnssppeecc aa ddoonncc ééttéé ggéénnéérraalliisséé aaffiinn ddee rréé pplluuss ssaannss qquu''uunn nnaavviirree ssooiitt ccoonns ddooiivveenntt ssaattiissffaaiirree aauuxx ccrriittèèrreess dd AAiinnssii ddaannss llee mmiilliieeuu pprrooffeessssiioonnnn ffaacctteeuurrss ddee ll''aamméélliioorraattiioonn ddee llaa ddee nnaavviirreess iinntteerrddiittss ddee rreepprreennddr qquuii bbiieenn ssoouuvveenntt nnee pprréésseenntteenntt mmiiss eenn pprreemmiieerr ppllaann ddee ll''aaccttuuaall LLaa mmééddiiaattiissaattiioonn aa uunn eeffffeett ppeerrvv gglloobbaallee,, eenn eeffffeett ddee nnoommbbrreeuuxx n ccoonnddiittiioonnss ééddiiccttééeess pprrééccééddeemmmm sseennssiibblleess ssuurr llee ssuujjeett ddee llaa ssééccuu pprreeuuvvee eennccoorree ss''iill eenn ééttéé bbeessooiinn ppeerrmmaanneennccee llee mmiilliieeuu dduu ttrraannsspp oorrss ssee ssoonntt ddéésseennggaaggééss pprrooggrreessssiivveemm nniieess ppééttrroolliièèrreess uuttiilliisseenntt mmaaiinntteennaanntt p eeffffeeccttuueerr llee ttrraannssppoorrtt dd''hhyyddrrooccaarrbbuurr dduu ttrraannssppoorrtteeuurr,, ccee qquuii aa dd''aaiilllleeuurrss pp nn''eesstt pplluuss rreessppoonnssaabbllee,, eett eenn sseeccoonndd ooppppeemmeenntt dd''iinntteerrnneett aa ppeerrmmiiss aauu cciittoo ggnnee ddee ddéénniiggrreemmeenntt ccoommmmee llaa vvééccuu AALL aa uunn iimmppaaccttee mmééddiiaattiiqquuee iimmppoorrttaa rroopphhee eesstt rreellaayyééee ddiirreecctteemmeenntt eett bbiiee ssssiioonn ppooppuullaaiirree eett lleess pprriinncciippaauuxx aaccttee ee nnoottiioonn.. éésseennggaaggeemmeenntt dduu ttrraannssppoorrtt mmaarriittiimm vvoonnss ppuu llee ccoonnssttaatteerr ddaannss llee ccaass ddee ll'' sséé ssuurr llee ddeevvaanntt ddee llaa ssccèènnee.. EEtt mmaaiinn ttrroopphhee ppééttrroolliièèrree ssuurrvviieenntt,, llee cchhaarrggee ee ppaarr llee ggrraanndd ppuubblliicc.. SSoouuvveenntt mmêêmmee lluuii dduu cchhaarrggeeuurr.. bbiieenn ssuuppéérriieeuurr lloorrssqquuee llee nnoomm ddee TTOO dduu ttrraannssppoorrtteeuurr eesstt rréévvéélléé :: ddeemmaannd qquuii ssee ssoouuvviieenntt dduu nnoomm ddee ll''aarrmmaatteeuu ddiiffffiiccuullttéé ppoouurr rreemmoonntteerr aauu vvéérriittaabbllee ppooppuullaattiioonn qquuii ssee ssoouuvviieenntt qquuee ll''aaffffrr ssoonntt ppaass eexxppoossééss àà cceettttee pprreessssiioonn ppo mmppaaggnniieess ppééttrroolliièèrreess oouu bbiieenn mmêêmmee eerrllooccuutteeuurrss qquuee ddeess pprrooffeessssiioonnnneellss,, ii ttéé oouu ppaarr uunn ppoouuvvooiirr rréégguullaatteeuurr.. ccttiioonn rrééaalliissééee ppaarr ll''aaffffrréétteeuurr ppoouurr ééttaa ééppoonnddrree aauuxx ddeeuuxx ffaacctteeuurrss :: lleess aaffffrréé nssiiddéérréé eenn bboonn ééttaatt ppaarr dd''aauuttrreess mmaajjoo ddee qquuaalliittéé iimmppoossééss ppaarr lleess mmaajjoorrss.. nneell,, llaa pprreessssiioonn ppooppuullaaiirree aa ééttéé cceerrttaa a ssééccuurriittéé mmaarriittiimmee,, cc''eesstt ppoouurrqquuooii llee drree llaa mmeerr ppaarr lleess aauuttoorriittééss dd''uunn ééttaatt tt ppaass ddee rriissqquuee ppoouurr ll''eennvviirroonnnneemmeenn lliittéé ((((((((1111111155555555)))))))).. vveerrss ééggaalleemmeenntt qquu''iill ccoonnvviieenntt ddee ssoouu nnaavviirreess ppééttrroolliieerrss qquuii nnee ssoonntt pplluuss ee mmeenntt ss''ééxxooddeenntt vveerrss ddeess rrééggiioonnss aaccttuu uurriittéé mmaarriittiimmee ccoommmmee ll''AAffrriiqquuee ddee ll''o nn qquuee llaa pprreessssiioonn ppooppuullaaiirree rrééggiitt mmaa ppoorrtt mmaarriittiimmee.. mmeenntt dduu ttrraannssppoorrtt pprriinncciippaalleemmeenntt llee rree aaffiinn ddee ffuuiirr eenn ppuu êêttrree ffaaiitt ddaannss llee dd lliieeuu dd''éévviitteerr llee ooyyeenn llaammbbddaa ddee TTOOTTAALL aavveecc pplluussiieeuurrss anntt.. eenn ssoouuvveenntt ssaannss rreeccuull :: eeuurrss dduu ttrraannssppoorrtt mmee ppaarr lleess mmaajjoorrss nn''aa ''EERRIIKKAA ooùù llee nntteennaanntt ffoorrccee eesstt ddee eeuurr eesstt ee llee nnoomm dduu OOTTAALL eesstt eexxppllooiittéé ppaarr ddoonnss nnoouuss qquueellllee eesstt uurr ddee ll''EERRIIKKAA (( bbiieenn ee pprroopprriiééttaaiirree dduu rréétteeuurr ééttaaiitt TTOOTTAALL?? pooppuullaaiirree eenn pprreemmiieerr aauuxx ggoouuvveerrnneemmeennttss,, iillss nnee ppeeuuvveenntt ddoonncc aabblliirr ll''ééttaatt dduu nnaavviirree)) éétteeuurrss nnee ss''eennggaaggeenntt oorrss eett lleess aarrmmaatteeuurrss aaiinneemmeenntt uunn ddeess ee pplluuss ggrraanndd nnoommbbrree tt ssoonntt ddeess vvrraaqquuiieerrss ntt eett ddoonncc nnee ssoonntt ppaass uulliiggnneerr,, eellllee nn''eesstt ppaass eexxppllooiittaabblleess ddaannss lleess uueelllleemmeenntt mmooiinnss 'oouueesstt oouu ll''AAssiiee,, aaiinntteennaanntt eenn
  • ((((((((1111111155555555)))))))) :::::::: ssoouurrccee MMOOUU :: hhttttpp ;;////wwww CCee ttaabblleeaauu ppeessssiimmiissttee ddrreesssséé lloo ppeerrmmeetttteenntt dd''eessppéérreerr uunnee éévvoolluu qquueell ppooiinntt lleess oorrggaanneess rréégguullaattee rreellaattiivvee àà cceettttee pprrooggrreessssiioonn.. IIll ddeevviieenntt ddoonncc nnéécceessssaaiirree àà ccee llaa ssééccuurriittéé mmaarriittiimmee ddooiitt ssee ffaaiirr sseeccttiioonn ssuuiivvaannttee.. SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMM DDDDDDDD''''''''IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRVVVVVVVVEEEEEEEENNNNNNNNTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN NNoouuss ppoouurrrroonnss aarrttiiccuulleerr cceettttee éé llee nniivveeaauu nnaattiioonnaall.. CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRR :::::::: LLLLLLLLEEEEEEEE NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAA LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE EEEEEEEETTTTTTTT GGGGGGGGLLLLLLLLOOOOOOOOBBBBBBBBAAAAAAAALLLLLLLLIIIIIIIITTTTTTTTEEEEEEEE NNoouuss aalllloonnss ddiissttiinngguueerr mmaaiinntteenn qquuii ddeerrnniièèrreemmeenntt aa pprriiss uunnee ppaa ssééccuurriittéé mmaarriittiimmee.. §§11 ..11 :: LLEE NNIIVVEEAAUU IINNTTEERRNNAATTIIOO DDee ppaarrtt ll''aassppeecctt iinntteerrnnaattiioonnaall dd nnee ffaaiitt nnuull ddoouuttee qquuee llaa ccoommppéétt nnee ppeeuutt ssee ffaaiirree eesssseennttiieelllleemmeenn CC''eesstt àà llaa ssuuiittee dduu nnaauuffrraaggee dduu ssuurr llaa ssééccuurriittéé mmaarriittiimmee àà LLoonndd AA llaa ffiinn ddeess aannnnééeess 4400 ,, cchhaaqquuee mmaarriittiimmee,, lleess ssttaannddaarrddss ééttaanntt aa EEttaattss.. CCeettttee ssiittuuaattiioonn ééttaaiitt ttrrèèss ddoommmmaaggeeaabbllee àà llaa ssééccuurriittéé mmaarr iinntteerrnnaattiioonnaallee ffûûtt ccrrééééee eenn 119944 eenn mmaattiièèrree ddee ttrraannssppoorrtt mmaarriittiimm CCrrééééee ppaarr uunnee ccoonnvveennttiioonn iinntteerr vviigguueeuurr 1100 aannss pplluuss ttaarrdd llee 1177 MM LL''OOMMII eesstt ll''iinnssttiittuuttiioonn ssppéécciiaalliisséé LLee bbuutt ddee cceettttee oorrggaanniissaattiioonn eess ffoouurrnniirr uunn mmooyyeenn ddee ccooooppéérraattiioo aaffffeeccttaanntt llee ccoommmmeerrccee iinntteerrnnaattii wwww..ppaarriissmmoouu..oorrgg oorrss ddee cceettttee pprreemmiièèrree sseeccttiioonn ccoonncceerr uuttiioonn ddaannss llee sseecctteeuurr ddee llaa ssééccuurriittéé mm eeuurrss ddaannss ccee ddoommaaiinnee ffoonntt pprreeuuvvee dd''uu e ssttaaddee dd''eessssaayyeerr ddee ddééffiinniirr àà qquueell nnii rree eett qquueellllee eenn eesstt ll''eeffffiiccaacciittéé,, cceeccii ffaa MMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE EEEEEEEETTTTTTTT EEEEEEEEFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCAAAAAAAACCCCCCCCIIIIIIIITTTTTTTTEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFEEEEEEEE ééttuuddee aauuttoouurr ddee ddeeuuxx ppooiinnttss :: llee nniivvee AAAAAAAAUUUUUUUU SSSSSSSSUUUUUUUUPPPPPPPPRRRRRRRRAAAAAAAA--------NNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL :::::::: EEEEEEEENNNNNNNNTTTTTTTTRRRRRRRREEEEEEEE naanntt llee nniivveeaauu iinntteerrnnaattiioonnaall eett llee nniivvee arrtt ddee pplluuss eenn pplluuss iimmppoorrttaannttee ddaannss ll OONNAALL duu ttrraannssppoorrtt mmaarriittiimmee eett ddee ll''éévvoolluuttiioo tteennccee ppoouurr llee ccoonnttrrôôllee eett llaa rréégglleemmeenn nntt qquuee ddee mmaanniièèrree iinntteerrnnaattiioonnaallee.. TTIITTAANNIICC qquu''eeuu lliieeuu llaa pprreemmiièèrree ccoonnff ddrreess eenn 11991144 .. ee nnaattiioonn mmaarriittiimmee ppoossssééddaaiitt ssaa pprroopprr aaiinnssii ttrrèèss ddiifffféérreennttss eett ppaarrffooiiss ccoonnttrraa rriittiimmee eett cc''eesstt ttoouutt llooggiiqquueemmeenntt qquu''uu 4488 aaffiinn ddee mmeettttrree eenn ccoommmmuunn lleess pprréé mmee,, ll''OOMMII ééttaaiitt nnééee :: rrnnaattiioonnaallee aaddooppttééee llee 66 MMaarrss 11994488 àà MMaarrss 11995588.. ééee ddaannss llee ddoommaaiinnee ddee llaa nnaavviiggaattiioonn sstt ccoonntteennuu ddaannss ll''aarrttiiccllee 11((AA)) ddee llaa ccoo oonn eennttrree lleess ggoouuvveerrnneemmeennttss ddaannss llee iioonnaall mmaarriittiimmee.. rrnnaanntt lleess rraaiissoonnss qquuii mmaarriittiimmee ddéémmoonnttrree àà uunnee vvoolloonnttéé ttoouuttee iivveeaauu llaa rréégguullaattiioonn ddee aaiissaanntt ll''oobbjjeett ddee llaa EEEEEEEERRRRRRRREEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUUXXXXXXXX eeaauu ssuupprraa--nnaattiioonnaall eett eeaauu ccoommmmuunnaauuttaaiirree llee sseecctteeuurr ddee llaa oonn rraappiiddee ddee cceelluuii--ccii,, iill nnttaattiioonn ddee ccee mmiilliieeuu fféérreennccee iinntteerrnnaattiioonnaallee rree llééggiissllaattiioonn aaddiiccttooiirreess eennttrree lleess uunnee iinnssttiittuuttiioonn ééooccccuuppaattiioonnss ddeess ééttaattss GGeennèèvvee eett eennttrrééee eenn mmaarriittiimmee ddee ll''OONNUU.. oonnvveennttiioonn :: iill ss''aaggiitt ddee ccaaddrree ddee ttoouuttee cchhoossee
  • TToouutt dd''aabboorrdd oorrggaanniissaattiioonn ccoonnssu OOrrggaanniissaattiioonn MMaarriittiimmee CCoonnssuullttaa TTOORRRREEYY CCAANNIIOONN eenn 11996677 ppoouurr aaccttiioonn ddaannss ddeess ddoommaaiinneess jjuurriidd ppeeuu ddee tteemmppss aapprrèèss eett pprriiss llee nn EEllllee ccoommppttee aauujjoouurrdd''hhuuii 116622 EEttaa 11995522 eett ppoossssèèddee ssoonn ssiièèggee àà LLoo TToouuss lleess EEttaattss mmeemmbbrreess ssoonntt rree ttoouuss lleess 22 aannss.. UUnn ccoonnsseeiill ccoonnsstt éélluuss ppaarr ll''aasssseemmbbllééee jjoouuee llee rrôôll PPoouurr ssee rreennddrree ccoommppttee dduu ttrraavvaa ddee pprréécciisseerr qquu''uunnee ttrreennttaaiinnee ddee LLee ttaabblleeaauu ccii--ddeessssoouuss ddéémmoonnttrree ((((((((1111111166666666)))))))) :::::::: ssoouurrccee IIMMOO :: wwwwww..iimmoo..oo CCCCCCCCoooooooonnnnnnnnvvvvvvvveeeeeeeennnnnnnnttttttttiiiiiiiioooooooonnnnnnnn NNNNNNNNoooooooommmmmmmm LLooaadd LLiinneess 11996666 SSOOLLAASS 11997744 SSTTCCWW 11997788 CCoolllliissiioonn RReegguullaattiioonnss 11997722 TToonnnnaaggee 11996699 MMAARRPPOOLL 7733//7788 NNoouuss vveennoonnss ddoonncc ddee vvooiirr qquuee l lleess mmaattiièèrreess ccoonncceerrnnaanntt llaa ssééccuu SSaa llééggiittiimmiittéé àà ccee nniivveeaauu eesstt iinnd dd''hhaarrmmoonniisseerr ssuurr llee ppllaann mmoonnddii llééggiittiimmiittéé ccoonnffoorrttééee ppaarr lleess ssttaatt nnaavviirree ccoonnttiinnuuee ddee ddiimmiinnuueerr :: EE ddiissppaarraaiissssaaiieenntt.. LLeess ééttuuddeess ppoouu ll''oonn eesstt cceeppeennddaanntt eenn ddrrooiitt ddee ss ppeerrttiinneennccee aaddééqquuaattee:: eenn eeffffeett ii ddee ll''oorrggaanniissaattiioonn eett eennssuuiittee ssuurr SSuurr llee ppllaann ddee ll''oorrggaanniissaattiioonn iinntt 7700 aavveecc ll''aaddooppttiioonn ddee ll''aammeennddee ffaaiissaaiitt pprrééccééddeemmmmeenntt uunnee rrééssoo àà mmooiinnss qquu''eellllee aaii ééttéé eexxpprreesssséé AAiinnssii llee ddééllaaiiss ppoouurr ll''eennttrrééee eenn 1188 mmooiiss suullttaattiivvee ddee ll''OONNUU,, ccoommmmee ssoonn nnoomm ll aattiivvee IInntteerrnnaattiioonnaallee )),, eellllee pprrooffiittaa ddee rr ss''éévvaaddeerr ddee ssoonn sseecctteeuurr tteecchhnniiqquuee p ddiiqquueess.. EEllllee ss''eesstt eennffiinn ddoottééee dd''uunn ccoom nnoomm dd''OOMMII eenn 11998822 aattss mmeemmbbrreess ddoonntt llaa FFrraannccee qquuii aa rraa oonnddrreess.. eepprréésseennttééss aauu sseeiinn ddee ll''aasssseemmbbllééee qq ttiittuuéé ddee 3322 ggoouuvveerrnneemmeennttss mmeemmbbrree llee dd''oorrggaannee ddiirreecctteeuurr eennttrree lleess sseessssiioo aaiill ddee ll''OOMMII eenn mmaattiièèrree ddee ssééccuurriittéé mm ee CCoonnvveennttiioonnss eett pprroottooccoolleess oonntt ééttéé aa ee ll''éétteenndduu ddee llaa ppoorrttééee ddeess ccoonnvveennttiio oorrgg mmmmmmmmbbbbbbbbrrrrrrrreeeeeeeessssssss dddddddd''''''''ééééééééttttttttaaaaaaaattttttttssssssss ssssssssiiiiiiiiggggggggnnnnnnnnaaaaaaaattttttttaaaaaaaaiiiiiiiirrrrrrrreeeeeeeessssssss %%%%%%%% dddddddduuuuuuuu ttttttttoooooooonnnnnnnnnnnnnnnn 114400 113366 113300 113300 111188 110022 ll''OOMMII eesstt ssaannss ddoouuttee llaa rrééppoonnssee àà ll''éé uurriittéé mmaarriittiimmee.. ddiissccuuttaabbllee ppuuiissqquuee éémmaanneenntt ddee llaa vvoo iiaall lleess rréégglleemmeennttaattiioonnss qquuii ééttaaiieenntt dd' ttiissttiiqquueess dduu LLllooyydd''ss rreeggiisstteerr ,, llee ttaauuxx EEnn 11999955 ,, 33 nnaavviirreess ssuurr 11000000,, eenn 2200 uurr lleess ddéévveerrsseemmeennttss mmoonnttrreenntt llaa mmêê ssee ddeemmaannddeerr ssii llee nniivveeaauu mmoonnddiiaall eess iill ss''aaggiitt dd''uunnee qquueessttiioonn dd''éécchheellllee ttoouutt r llee ppllaann ggééooggrraapphhiiqquuee.. tteerrnnee ddee ll''OOMMII,, uunnee ééttaappee aa ééttéé ffrraann eemmeenntt ddee ll''aacccceeppttaattiioonn ttaacciittee :: ccoonnttrraa oolluuttiioonn eesstt aauuttoommaattiiqquueemmeenntt aacccceeppttéé émmeenntt rreejjeettééee ppaarr uunn cceerrttaaiinn nnoommbbrree vviigguueeuurr ddeess ddeerrnniieerrss aammeennddeemmeennttss ll''iinnddiiqquuaaiitt ,, OOMMCCII (( ee ll''éévvèènneemmeenntt dduu ppoouurr ddéévveellooppppeerr ssoonn mmiittéé jjuurriiddiiqquuee ttrrèèss aattiiffiiéé llaa ccoonnvveennttiioonn eenn qquuii ssee rrééuunniitt uunnee ffooiiss eess,, ddoonntt llaa FFrraannccee,, oonnss ddee ll''aasssseemmbbllééee.. mmaarriittiimmee,, iill ccoonnvviieenntt aaddooppttééss.. ioonnss ddee ll''OOMMII ::((((((((1111111166666666)))))))) nnnnnnnnaaaaaaaaggggggggeeeeeeee mmmmmmmmoooooooonnnnnnnnddddddddiiiiiiiiaaaaaaaallllllll ccccccccoooooooouuuuuuuuvvvvvvvveeeeeeeerrrrrrrrtttttttt 9988..1199 9988..2277 9977..5555 9966..2200 9977..5511 9933..4488 éécchheellllee mmoonnddiiaallee ppoouurr oolloonnttéé iinntteerrnnaattiioonnaallee d''oorrddrree nnaattiioonnaall,, xx ddee ppeerrttee ttoottaall ddee 000000 11..99 ssuurr 11000000 êêmmee tteennddaannccee.. MMaaiiss sstt bbiieenn llee ddeeggrréé ddee tt dd''aabboorrdd ssuurr uunn ppllaann nncchhiiee ddaannss lleess aannnnééeess aaiirreemmeenntt àà ccee qquuii ssee ééee àà uunnee ddaattee ddéécciiddééee ee dd''ééttaattss.. SSOOLLAASS aa ééttéé rréédduuiitt àà
  • aalloorrss qquu'' eenn ccoommppaarraaiissoonn lleess mm qquu''eenn 11993333 ssooiitt pprrèèss ddee 2200 aannnn ddeeuuxxiièèmmee ccoonnvveennttiioonn eesstt ééttéé aadd CCeeppeennddaanntt llee vvrraaii pprroobbllèèmmee dduu cchhaaqquuee ééttaatt eenn ssoonn sseeiinn.. UUnn ddeess ppooiinnttss ccllééss qquuii ppeeuutt nnoouu ééttaattss aauu sseeiinn ddee ll''OOMMII ccoonncceerrnnee aalliimmeennttéé ppaarr llaa ccoonnttrriibbuuttiioonn ddee ttoonnnnaaggee ddee llaa fflloottttee ddee ccoommmmeerr ssooiitt 11,,4411%% dduu ttoottaall..((((((((1111111177777777)))))))) LLeess mmooddaalliittééss ddee vvoottee aauu sseeiinn dd rreeccoonnnnaaîîtt ppaass llee sscchhéémmaa dd''eexxpprr mmaaiiss aauu ccoonnttrraaiirree éévvaalluuee llee ppooiidd mmoonnddiiaallee ppoouurr ééttaabblliirr lleess pprrooccéé LLiibbéérriiaa eett dd''aauuttrreess ppaayyss ddoonntt ll''aa dd''uunn ppooiiddss ttoottaalleemmeenntt ddiisspprrooppoo ttrraannssppoorrtt mmaarriittiimmee iinntteerrnnaattiioonnaa LL''OOMMII eesstt aaiinnssii ddoommiinnééee ppaarr lleess CCeeppeennddaanntt lleess ddééllaaiiss rreessttee ttrrèèss mmaarriittiimmeess.. DDee pplluuss eenn mmaattiièèrree ddee rrèègglleess iinn eett iill nn''yy aa ppaass ddee ttrriibbuunnaauuxx.. AAiinn llaa DDiirreeccttiioonn GGéénnéérraall EEnneerrggiiee eett «« LLeess rrèègglleess ddee ll''OOMMII ppeeuuvveenntt êê ppoouurr aalllleerr vvéérriiffiieerr ssii lleess ppaayyss rree ((((((((1111111177777777)))))))) :::::::: ssoouurrccee ssiittee wweebb dduu MMiinniiss TToouurriissmmee eett ddee llaa MMeerr :: wwwwww..mm LL''éécchheellllee ggééooggrraapphhiiqquuee ppeeuutt éégg ffaauutt ffaaiirree pprreennddrree ccoonnsscciieennccee àà dd''aauuttrreess EEttaattss mmeemmbbrreess ssiittuuééss dd''oorrddrree ééccoonnoommiiqquuee ;; rraappppeelloonnss tteecchhnniiqquuee eett ssee sseennttiirr ccoonncceerrnnéé pphhyyssiiqquueemmeenntt rreessttee ppaarrffooiiss ddiiffff AAiinnssii ddoonncc bbiieenn qquuee llaa llééggiittiimmiittéé aa ppuu ccoonnssttaatteerr ll''éémmeerrggeennccee dd''uu ddeerrnniièèrreess aannnnééeess,, ppoouuvvooiirr qquuii oo iill ss''aaggiitt ddee llaa ccoommmmuunnaauuttéé eeuurroo §§11 ..22 :: LLEE NNIIVVEEAAUU CCOOMMMMUUNNAAUU BBiieenn qquuee ppllaaccééee àà uunn nniivveeaauu ssuu cceerrttaaiinn aassppeecctt êêttrree ccoonnssiiddéérrééee pp qquueellqquuee ssoorrttee uunnee rrééggiioonn dduu mmoo mmeessuurreess eenn rrééaaccttiioonn aauu TTIITTAANNIICC nnee ss nnééeess aapprrèèss llaa ccaattaassttrroopphhee eett sseeuulleemmee ddooppttééee eenn 11992299.. u ffoonnccttiioonnnneemmeenntt ddee ll''OOMMII rreessttee llee rrôô uuss aaiiddeerr àà ccoommpprreennddrree qquueell eesstt llee ppoo ee llaa qquueessttiioonn dduu bbuuddggeett :: eenn eeffffeett llee cchhaaqquuee ppaayyss eett ccee eenn ffoonnccttiioonn eessssee rrccee.. LLaa FFrraannccee ccoonnttrriibbuuee àà hhaauutteeuurr dd ddee ll''OOMMII ggéénnèèrreenntt ddeess bbllooccaaggeess rrééccuu rreessssiioonn ddéémmooccrraattiiqquuee ccllaassssiiqquuee «« uunn ddss ddee cchhaaqquuee ppaayyss aauu ppoouurrcceennttaaggee dd éédduurreess ddee vvoottee.. AAiinnssii ddeess ppaayyss ccoommmm aaddmmiinniissttrraattiioonn mmaarriittiimmee eesstt rreellaattiivveemm oorrttiioonnnnéé ssuurr ttoouutteess ddiissppoossiittiioonnss tteennddaa aall.. ss ppaavviilllloonnss ddee ccoommppllaaiissaannccee.. s lloonnggss ppoouurr lleess vviiccttiimmeess eenn pprreemmiieerr nntteerrnnaattiioonnaalleess,, iill nn''yy aa ppaass ddee ccoonnttrrôô nnssii MMoonnssiieeuurr FFrraannççooiiss LLaammoouurreeuuxx,, DDi TTrraannssppoorrtt,, ccoommmmiissssiioonn EEuurrooppééeennnnee êêttrree ppaarrffaaiitteess,, mmaaiiss iill nn''yy aa ppaass,, ppoouu eessppeecctteenntt lleess rrèègglleess »» ssttèèrree ddee ll''EEqquuiippeemmeenntt,, ddeess TTrraannssppoorrtt mmeerr..ggoouuvv..ffrr ggaalleemmeenntt êêttrree uunn ffaacctteeuurr ddee rraalleennttiissss àà uunn cceerrttaaiinn nnoommbbrree dd''EEttaattss mmeemmbbrree àà ddeess mmiilllliieerrss ddee kkiilloommèèttrreess ;; llaa ssoollii ss lleess ccooûûttss qquuee ppeeuuvveenntt eennggeennddrreerr uu éé ddaannss cceess ccoonnddiittiioonnss lloorrssqquuee ll''oonn eess ffiicciillee.. éé ddee ll''OOMMII nn''eesstt ppaass rreemmiissee eenn ccaauussee uunn nnoouuvveeaauu ppoouuvvooiirr iinntteerrnnaattiioonnaall nnoorr oossee ssee ccoonnffrroonntteerr àà ll''OOMMII ssuurrttoouutt eenn ooppééeennnnee.. UUTTAAIIRREE uupprraa--nnaattiioonnaall,, llaa ccoommmmuunnaauuttéé eeuurroopp ppaarr uunnee aapppprroocchhee rrééggiioonnaallee.. LL''EEuurroopp oonnddee eett aaiinnssii ppeeuutt êêttrree pplluuss rrééaaccttiivvee ssoonntt eennttrrééee eenn vviigguueeuurr eenntt aapprrèèss qquu''uunnee ôôllee qquuee ppoossssèèddee ooiiddss ddeess ddiifffféérreennttss bbuuddggeett ddee ll''OOMMII eesstt eennttiieelllleemmeenntt dduu ddee 224477 330000££ ppaarr aann uurrrreennttss.. LL''OOMMII nnee nnee ppaayyss == uunnee vvooiixx »» ddee lleeuurr fflloottttee mmee llaa GGrrèèccee,, MMaallttee,, llee mmeenntt rréédduuiittee ppèèsseenntt aanntt àà rréégglleemmeenntteerr llee lliieeuu ddeess ccaattaassttrroopphheess ôôllee,, ppaass ddee ssaannccttiioonnss Diirreecctteeuurr GGéénnéérraall ppoouurr ee,, ddee rreeggrreetttteerr :: uurr llee mmoommeenntt dd''oouuttiill ttss,, dduu LLooggeemmeenntt,, dduu sseemmeenntt :: eenn eeffffeett iill eess ddeess pprrééooccccuuppaattiioonnss iiddaarriittéé aa ddeess lliimmiitteess uunnee rrééssoolluuttiioonn dd''oorrddrree sstt ppaass iimmpplliiqquuéé ee,, llee mmoonnddee mmaarriittiimmee rrmmaattiiff ppeennddaanntt cceess 1100 nn mmaattiièèrree ddee ppoolllluuttiioonn ;; ppééeennnnee ppeeuutt ssoouuss ppee eesstt mmaaiinntteennaanntt eenn ee ffaaccee àà uunnee
  • ccaattaassttrroopphhee.. LLeess iinnttéérrêêttss ccoommmm ll''éécchheellllee mmoonnddiiaallee.. LL''aarrttiiccllee 8800 dduu ttrraaiittéé dd''AAmmsstteerrdd ttrraaiittéé,, ssuurr lleess ttrraannssppoorrttss,, ss''aapppp iinnttéérriieeuurreess,, mmaaiiss qquuee llee ccoonnsseeiill aapppprroopprriiééeess ppoouurr llaa nnaavviiggaattiioonn MMaaiiss ll''UUnniioonn EEuurrooppééeennnnee eenn mmaa qquueessttiioonnss dd''oouuvveerrttuurree ddeess mmaarrcc ffoonnddaammeennttaauuxx dduu ttrraaiittéé ddee RRoomm EEnn mmaattiièèrree ddee ssééccuurriittéé mmaarriittiimm iinnssttiittuuttiioonnnneell,, ddeeppuuiiss ll''aacccciiddeenntt BBiieenn aavvaanntt ll''éévvèènneemmeenntt dduu BBRRAA CCoommmmiissssiioonn aavvaaiitt àà pplluussiieeuurrss rree ccaaddrreess ccllaassssiiqquueess dd''aaccttiioonn iinntteerr ééttaaiieenntt iinnssuuffffiissaannttss ppoouurr ss''aattttaaqquueerr aauuxx LLaa ssééccuurriittéé mmaarriittiimmee nn''aa ttoouutteeffoo dduurraanntt cceettttee ppéérriiooddee.. LL''UUnniioonn EE mmaarriittiimmee qquuee ddeeppuuiiss llee ttrraaiittéé dde ccoommppéétteennccee ssuurr llaa ssééccuurriittéé ddeess LLaa ccoommmmiissssiioonn aa ddiiffffuusséé,, llee 2244 ppoolliittiiqquuee ccoommmmuunnee ddee llaa ssééccuurrii ccoommmmuunnee aa ppoouurr bbuutt ddee ffaaiirree pp ppoolllluuttiioonn ddeess mmeerrss eenn EEuurrooppee :: EEnn ffaavvoorriissaanntt llaa ccoonncceerrttaattiioonn ee ppoossiittiivvee aauu sseeiinn ddee ll''OOMMII eett qquu'' aaffiinn dd''éévviitteerr ddeess ddiissttoorrssiioonnss ddee EEnn rreennffoorrççaanntt lleeuurr lluuttttee ccoonnttrree ppaass ccoorrrreecctteemmeenntt lleess rrèègglleess ddee EEnn ddééffiinniissssaanntt ddeess nnoorrmmeess ccoomm AAiinnssii ll''UUnniioonn EEuurrooppééeennnnee ss''eesstt dd ccaarr qquu''eellllee aa ppuu ss''aappppuuyyeerr ssuurr llee nnoottaammmmeenntt :: LLee pprriinncciippee ddee ll''iinnttééggrraattiioonn ddee ppoolliittiiqquueess ccoommmmuunnaauuttaaiirreess.. LLee nnoouuvveell oobbjjeeccttiiff ssééccuurriittaaiirree LLaa ssttrraattééggiiee pprrooppoossééee ppaarr llaa CCoo ddiirreeccttiivveess eett 33 rrèègglleemmeennttss ss''eenn mmuunnss ssoonntt bbeeaauuccoouupp pplluuss ffaacciilleemmeenntt ddaamm (( 8844 dduu ttrraaiittéé ddee RRoommee)) pprréécciissee plliiqquuee aauuxx ttrraannssppoorrttss ppaarr rroouuttee,, rraaiill ee ll ddeevvaaiitt àà llaa mmaajjoorriittéé qquuaalliiffiiééee ddéécciiddee mmaarriittiimmee-- eett aaéérriieennnnee.. aattiièèrree mmaarriittiimmee ééttaaiitt pprriinncciippaalleemmeenntt cchhééss eett ddee ccoonnccuurrrreennccee lleess pplluuss pprroocc mmee.. mmee,, ll''UUnniioonn EEuurrooppééeennnnee eesstt aappppaarruuee dd t dduu BBRRAAEERR eenn 11999933.. AAEERR ,, ssuuiittee àà ll''aacccciiddeenntt ddee ll''AAMMOOCCOO CC eepprriisseess aattttiirréé ll''aatttteennttiioonn dduu CCoonnsseeiill ss rrnnaattiioonnaallee eenn mmaattiièèrree ddee ssééccuurriittéé mmaa xx ccaauusseess ddeess aacccciiddeennttss.. fooiiss ffaaiitt ll''oobbjjeett qquuee ddee qquueellqquueess rreettoouu EEuurrooppééeennnnee nn''aa ccoommppéétteennccee eenn mmaattiièè dee MMaaaassttrriicchhtt,, qquuii aattttrriibbuuee àà ll''UUnniioonn EE ss ttrraannssppoorrttss eenn ggéénnéérraall.. FFéévvrriieerr 11999933,, llaa ccoommmmuunniiccaattiioonn iinnttii iittéé mmaarriittiimmee »»((((((((1111111188888888)))))))).. LLee ffoonnddeemmeenntt ddee pprrooggrreesssseerr llaa ssééccuurriittéé mmaarriittiimmee eett llaa eennttrree EEttaattss mmeemmbbrreess ppoouurr qquu''iillss mmèè 'iillss eenn aapppplliiqquueenntt ttoouuss lleess rrèègglleess ddee mm ccoonnccuurrrreennccee eennttrree EEttaattss mmeemmbbrreess ;; ee lleess nnaavviirreess ssoouuss nnoorrmmeess ddee ppaayyss ttii ll''OOMMII,, ddaannss ll''eesspprriitt dduu MMéémmoorreenndduumm mmmmuunneess ppoouurr lleess ddoommaaiinneess nnoonn ccoouu ddoottééee dd''uunnee ppoolliittiiqquuee ccoommmmuunnee eenn mm eess «« mmootteeuurrss »» jjuurriiddiiqquueess iinnssccrriittss dd ee llaa ddiimmeennssiioonn eennvviirroonnnneemmeennttaallee ddaann aapppplliiccaabbllee aauu ttrraannssppoorrtt aaffffiicchhéé ddaannss oommmmiissssiioonn aa rraappiiddeemmeenntt ééttéé mmiissee eenn ssoonntt ssuuiivviiss.. aapppprrééhheennddééss qquu''àà qquuee llee ttiittrree VV dduu eett vvooiieess dd''eeaauuxx eerr ddeess ddiissppoossiittiioonnss pprrééooccccuuppééee ppaarr lleess cchheess ddeess oobbjjeeccttiiffss ddeeppuuiiss ppeeuu ddaannss llee jjeeuu CCAADDIIZZ eenn 11997788,, llaa ssuurr llee ffaaiitt qquuee lleess aarriittiimmee àà ttrraavveerrss ll''OOMMII uucchheess ppoonnccttuueelllleess èèrree ddee ssééccuurriittéé EEuurrooppééeennnnee uunnee iittuullééee «« PPoouurr uunnee ee cceettttee ppoolliittiiqquuee pprréévveennttiioonn ddee llaa èènneenntt uunn aaccttiioonn mmaanniièèrree hhaarrmmoonniissééee ;; iieerrss qquuii nn''aapppplliiqquueenntt mm ddee PPaarriiss ;; uuvveerrttss ppaarr ll''OOMMII mmaattiièèrree ddee ssééccuurriittéé ddaannss llee ttrraaiittéé nnss ll''eennsseemmbbllee ddeess ss llee ttrraaiittéé MMaaaassttrriicchhtt nn ooeeuuvvrree :: 1122
  • CCeess tteexxtteess vviisseenntt àà aassssuurreerr ddaann aannttiicciippééee,, ddeess rrèègglleess iissssuueess ddeess ssééccuurriittéé ddeess nnaavviirreess,, ddee llaa pprréévv ffoorrmmaattiioonn ddeess mmaarriinnss eett ddeess ccoo ((((((((1111111188888888)))))))) :::::::: CCOOMM((9933)) 6666 ffiinnaall CCeettttee aannttiicciippaattiioonn eesstt ttoouutteeffooiiss ccoommmmuunnaauuttéé eeuurrooppééeennnnee ccoommmm cchhaappiittrree.. SSuuiittee àà pplluussiieeuurrss aauuttrreess aacccciiddeenn ppaarrttiiccuulliièèrree aa ééttéé ppoorrttééee aauuxx nnaa vvrraacc.. CCeettttee llééggiissllaattiioonn vviissee ppoouurr ll''eessss ppllaaiissaannccee eett lleess bbaatteeaauuxx ddee ppêêcc ssppéécciiffiiqquueess.. MMaaiiss ppoouurr llee ggrraanndd ppuubblliicc llee ppooii ssééccuurriittéé aa ééttéé llee nnaauuffrraaggee ddee ll''EE ooccttoobbrree 22000000 qquuii oonntt rreemmiiss llaa ss iinnttéérrêêttss ééccoonnoommiiqquueess ééttaaiieenntt een oonntt mmiiss eenn éévviiddeennccee ll''eexxiisstteennccee rréégglleemmeennttaattiioonn eenn mmaattiièèrree ddee ss mmaarriittiimmee.. LLeess pprrooccéédduurreess aaccttuuee ll''EEttaatt dduu ppoorrtt,, ssooiitt ddeess ssoocciiééttééss ddoonnnneenntt aauuccuunnee ggaarraannttiiee ssuurr llaa LL''EErriikkaa aa ééggaalleemmeenntt pprroovvooqquuéé uu ccoonndduuiitt llee ggoouuvveerrnneemmeenntt ffrraannççaa rreennffoorrcceemmeenntt ddeess mmeessuurreess ddee ss DDaannss uunn pprreemmiieerr tteemmppss llaa CCoomm CCoommmmuunniiccaattiioonn pprréésseennttaanntt uunnee ppoorrttaaiitt ssuurr ddeeuuxx aaxxeess dd''aaccttiioonnss ((((((((1111111199999999)))))))) :::::::: CCOOMM((22000000)) 114422 ffiinnaall DDeess mmeessuurreess ppoouuvvaanntt rraappiiddeemm -- llee rreennffoorrcceemmeenntt ddeess ccoonnttrrôôlleess -- llee rreennffoorrcceemmeenntt dduu ccoonnttrrôôllee dd -- llaa ggéénnéérraalliissaattiioonn ddee ll''iinntteerrddiicctt ccaalleennddrriieerr iiddeennttiiqquuee àà cceelluuii ddeess DDeess mmeessuurreess àà pprreennddrree àà mmooyy nnss llaa CCoommmmuunnaauuttéé uunnee aapppplliiccaattiioonn pp ss ccoonnvveennttiioonnss iinntteerrnnaattiioonnaalleess ddaannss llee vveennttiioonn ddeess ppoolllluuttiioonnss,, ddeess ccrriittèèrreess dd oonnddiittiioonnss ddee ttrraavvaaiill àà bboorrdd.. mmaaiinntteennaanntt ssoouurrccee ddee tteennssiioonn eennttrree mmee nnoouuss ppoouurrrroonnss llee ccoonnssttaatteerr pplluuss e nnttss,, nnoottaammmmeenntt cceelluuii ddee ll''EEssttoonniiaa eenn aavviirreess ttrraannssppoorrttaanntt ddeess ppaassssaaggeerrss eett sseennttiieell lleess nnaavviirreess ddee ccoommmmeerrccee mmaaiiss cchhee ffoonntt ééggaalleemmeenntt ll''oobbjjeett ddee mmeessuurr iinntt ddee ddééppaarrtt ddee llaa ppoolliittiiqquuee ccoommmmuunn EERRIIKKAA eenn ddéécceemmbbrree 11999999 eett cceelluuii dduu ssééccuurriittéé mmaarriittiimmee ssoouuss lleess ffeeuuxx ddee ll''aa enn jjeeuuxx,, eesssseennttiieelllleemmeenntt llee ttoouurriissmmee.. ee ddee pprroobbllèèmmeess sséérriieeuuxx ddaannss llaa mmiissee ssééccuurriittéé mmaarriittiimmee eett aauu sseeiinn mmêêmmee dd eelllleess ddee ccoonnttrrôôllee,, qquuii ssoonntt ssoouuss llaa rree s ddee ccllaassssiiffiiccaattiioonn,, oonntt ééttéé ttrrèèss llaarrggeemm aa bboonnnnee nnaavviiggaabbiilliittéé ddeess nnaavviirreess.. uunnee ccoonnssiiddéérraabbllee éémmoottiioonn ddaannss ll''ooppiinn aaiiss,, llee PPaarrlleemmeenntt EEuurrooppééeenn eett llee CCoonn ssééccuurriittéé mmaarriittiimmee ddaannss lleess eeaauuxx eeuurro mmmmiissssiioonn aa ddoonncc aaddooppttéé llee 2211 mmaarrss 22 ee sséérriiee dd''aaccttiioonnss ccoonnccrrèètteess.. LLee ppaaqquuee :: mmeenntt êêttrree mmiisseess eenn ooeeuuvvrree :: ss ddaannss lleess ppoorrttss ;; ddeess ssoocciiééttééss ddee ccllaassssiiffiiccaattiioonn ;; ttiioonn ddeess ppééttrroolliieerrss àà ssiimmppllee ccooqquuee ssuu ss UUSSAA.. yyeenn tteerrmmee ccaarr nnéécceessssiittaanntt uunnee llaarrggee pplluuss ssttrriiccttee,, vvooiirree eess ddoommaaiinneess ddee llaa ddee qquuaalliiffiiccaattiioonn eett ddee ee ll''OOMMII eett llaa eenn aavvaanntt ddaannss ccee nn 11999944,, uunnee aatttteennttiioonn tt ddeess mmaarrcchhaannddiisseess eenn ss lleess bbaatteeaauuxx ddee rreess ccoommmmuunnaauuttaaiirreess nnee eenn mmaattiièèrree ddee uu IIEEVVOOLLII SSUUNN eenn aaccttuuaalliittéé ccaarr ddeess .. CCeess ddeeuuxx aacccciiddeennttss ee eenn ooeeuuvvrree ddee llaa ddee ll''iinndduussttrriiee eessppoonnssaabbiilliittéé ssooiitt ddee mmeenntt iinneeffffiiccaacceess eett nnee nniioonn ppuubblliiqquuee qquuii aa nnsseeiill aa rrééccllaamméé uunn ooppééeennnneess.. 22000000 uunnee eett EERRIIKKAA ((((((((1111111199999999))))))))pprrooppoosséé uurr llaa bbaassee dd''uunn ee ccoonncceerrttaattiioonn ::
  • -- llaa ssyyssttéémmaattiissaattiioonn ddeess éécchhaanngg mmaarriittiimmee eenn ss''aappppuuyyaanntt nnoottaammmm -- ll''aamméélliioorraattiioonn ddee llaa ssuurrvveeiillllaann ffrrééqquueennttééeess ;; -- llaa rreessppoonnssaabbiilliissaattiioonn ddeess ddiifffféé SSuurr ccee ppooiinntt,, iill ffaauutt nnootteerr qquuee llee ddeess ccoonnvveennttiioonnss iinntteerrnnaattiioonnaalleess ii)) ooeeuuvvrreerr ppoouurr ll''aauuggmmeennttaattiioonn FFIIPPOOLL ;; iiii)) ppoosseerr lleess pprriinncciippeess dd''uunnee rreess pprroopprriiééttaaiirree ddee llaa ccaarrggaaiissoonn,, ccoo ttoottaalleemmeenntt eexxcclluu lleess aaffffrréétteeuurrss -- ll''éévveennttuueellllee ccrrééaattiioonn dd''uunnee ssttrr sseerraaiitt ddee ccoonnttrrôôlleerr ll''oorrggaanniissaattiioo dd''aassssuurreerr uunnee pplluuss ggrraannddee uunniiffoo EEnnffiinn ddeerrnniièèrreemmeenntt ll''aaffffaaiirree dduu lleenntteeuurr ddee ll''EEuurrooppee àà mmeettttrree eenn mmeemmbbrreess ss''ééttaaiieenntt eennggaaggééss àà mm ddee NNIICCEE.. ((((((((2222222200000000)))))))) ((((((((2222222200000000)))))))) :::::::: CCoonnsseeiill EEuurrooppééeenn ddee NNiiccee PPoouurr MMrr FFrraannççooiiss LLaammoouurreeuuxx ,, dd ccllaaiirr qquuee llaa vvooiixx dduu rrèègglleemmeenntt ss ttrraannssppoossiittiioonn ppaarr lleess PPaarrlleemmeenntt CC''eesstt cceettttee vvoolloonnttéé ccllaaiirreemmeenntt éé ddéécceemmbbrree 22000022 dd''aavvaanncceerr llaa ddaa rreeffuuggeess aauu 11 jjuuiilllleett 22000033,, aalloorrss vviigguueeuurr aauu 55 FFéévvrriieerr 22000044.. DDoonncc ddeeppuuiiss 11999933,, ll''UUnniioonn EEuurroo rreellaaiiss ddee ll''OOMMII eenn mmaattiièèrree ddee sséé mmaarriittiimmee eeuurrooppééeennnnee ccoonnttrriibbuuee iinnssttaanncceess iinntteerrnnaattiioonnaalleess cchhaarrgg dd''aapprrèèss MMrr JJoosssseelliinn ddee RRoohhaann,, pp sséémmiinnaaiirree ssuurr llaa ssééccuurriittéé mmaarriittii CCeeppeennddaanntt MMrr JJoosssseelliinn ddee rroohhaann ccoonnffrroonntteerr ll''UUnniioonn EEuurrooppééeennnnee ll''oorrggaanniissaattiioonn mmaarriittiimmee iinntteerrnnaatt EEnn eeffffeett aauu sseeiinn ddee ll''OOMMII sseeuulleess rreepprréésseennttaattiioonnss nn''ééttaanntt qquu''oobbssee ggeess dd''iinnffoorrmmaattiioonn eennttrree ttoouuss lleess aaccttee mmeenntt ssuurr llaa bbaassee ddee ddoonnnnééeess EEQQUUAASS nnccee ddee llaa nnaavviiggaattiioonn mmaarriittiimmee ddaannss llee éérreennttss aacctteeuurrss dduu ttrraannssppoorrtt ddee ppééttrrooll ee rrééggiimmee ddee rreessppoonnssaabbiilliittéé eesstt aaccttuuee ss.. DDaannss ccee ddoommaaiinnee,, llaa CCoommmmiissssiioonn ddeess rrééggiimmeess ccoolllleeccttiiffss dd''iinnddeemmnniissaattii ssppoonnssaabbiilliittéé ppoouurr nnéégglliiggeennccee ggrraavvee dd oonnttrraaiirreemmeenntt aauuxx EEttaattss--UUnniiss qquuii ddaannss ddee ttoouuttee rreessppoonnssaabbiilliittéé.. rruuccttuurree eeuurrooppééeennnnee ddee llaa ssééccuurriittéé mm oonn eett ll''eeffffiiccaacciittéé ddeess ccoonnttrrôôlleess nnaattiioonn oorrmmiissaattiioonn ddeess ccoonnttrrôôlleess aauu nniivveeaauu ee PPrreessttiiggee,, eenn ddéécceemmbbrree 22000022,, aa mmiiss nn ooeeuuvvrree lleess mmeessuurreess ééttaabblliieess eett ppoouu mmeettttrree rraappiiddeemmeenntt eenn ooeeuuvvrree ppeennddaan ee dduu 77,,88 eett 99 ddéécceemmbbrree 22000000 ddiirreecctteeuurr GGéénnéérraall ppoouurr llaa DDGG EEnneerrggiie ss''iimmppoossee aauujjoouurrdd''hhuuii aaffiinn ddee ccoonnttoouurr ttss NNaattiioonnaauuxx.. ééttaabblliiee qquuii aa ppeerrmmiiss aauu CCoonnsseeiill «« ttrraa aattee dd''eennttrrééee eenn vviigguueeuurr ddee llaa ddiissppoossii mmêêmmee qquuee llaa ddiirreeccttiivvee iimmppoossééee uunn ooppééeennnnee aa ddoonncc pprriiss llaa pplleeiinnee aammpplleeuu ééccuurriittéé mmaarriittiimmee,, aaiinnssii ll''éévveeiill ddee cceetttt eerraa àà mmeettttrree eenn vvaalleeuurr llaa ppllaaccee ddee ll''UU ggééeess dd''oorrggaanniisseerr llee ttrraannssppoorrtt mmaarriittiimm pprrééssiiddeenntt dduu ccoonnsseeiill rrééggiioonnaall ddee BBrreett iimmee ddee BBrreesstt dduu 22//33 nnoovveemmbbrree 22000000 nn ssoouullèèvvee ppeeuutt êêttrree llee ddeerrnniieerr vvrraaii pp :: ttrroouuvveerr llaa ppllaaccee ddee ll''UUnniioonn EEuurrooppéé ttiioonnaallee.. ss lleess EEttaattss ppoossssèèddee llee ddrrooiitt ddee vvoottee,, eerrvvaatteeuurrss.. LLee pprroobbllèèmmee eesstt ddoonncc ttoouu eeuurrss dduu mmoonnddee SSIISS ;; eess zzoonneess lleess pplluuss llee ppaarr vvooiiee mmaarriittiimmee.. eelllleemmeenntt ddoommiinnéé ppaarr eenntteenndd :: iioonn nnoottaammmmeenntt dduu dduu ttrraannssppoorrtteeuurr eett dduu ss llee ccaaddrree ddee ll''OOPPAA aa mmaarriittiimmee ddoonntt llaa ttââcchhee nnaauuxx ddaannss llee bbuutt eeuurrooppééeenn.. eenn éévviiddeennccee llaa uurr lleessqquueelllleess lleess ééttaattss nntt llee CCoonnsseeiill EEuurrooppééeenn iee eett TTrraannssppoorrtt,, iill eesstt rrnneerr cceett oobbssttaaccllee ddee llaa aannssppoorrtt »» ddeess 55--66 iittiioonn ssuurr lleess ppoorrttss ddaattee dd''eennttrrééee eenn uurr ddee ssoonn rrôôllee ddee ttee ccoonnsscciieennccee UUnniioonn ddaannss lleess mmee ddaannss llee mmoonnddee,, ttaaggnnee ppeennddaanntt llee 00.. pprroobbllèèmmee aauuqquueell eesstt ééeennnnee aauu sseeiinn ddee lleess oorrggaanniissmmeess oouu uutt dd''aabboorrdd dd''oobbtteenniirr uunn
  • ccoonnsseennttiiuuss aauu sseeiinn ddee ll''EEuurrooppee nnoonn sseeuulleemmeenntt uunn rrôôllee dd''oobbsseerrvv CCee ccoonnsseenncciiuuss eesstt ssaannss ddoouuttee llaa PPoouurr eexxeemmppllee lloorrss ddeess ddiissccuussssiioo CCoommmmuunniiccaattiioonn ddee mmaarrss 22000000,, sseeuullee ccoonnttrree lleess 1144 aauuttrreess EEttaattss EEnn eeffffeett ll''iinnttéérrêêtt ddee cchhaaqquuee ééttaa nnéécceessssaaiirreemmeenntt aavveecc cceelluuii ddee ss PPoouurr ss''eenn ppeerrssuuaaddeerr ccoonnssttaattoonnss ll''UUnniioonn EEuurrooppééeennnnee :: AA ll''hheeuurree ddee ll''UUnniioonn EEuurrooppééeennnnee eett ssoouuss rreessppoonnssaabbiilliittééss eenn mmaattiièèrree ddee ss FFéévvrriieerr 22000000,, uunn mméémmoorreenndduumm ssééccuurriittéé mmaarriittiimmee,, llaa CCoommmmiissssii ppaaqquueett EERRIIKKAA II.. AAuujjoouurrdd''hhuuii llaa GGrrèèccee eeffffeeccttuuee llaa FFrraannccee,, mmaanniiffeessttee ssoonn ooppppoossiittiioo rréégglleemmeennttaattiioonn eenn mmaattiièèrree ddee ss LLeess ppaayyss EEuurrooppééeennss ddeevvrraaiieenntt,, eennttiièèrreemmeenntt aauu bboonn vvoouullooiirr ddee mmaarrcchhaannddee,, GGeeoorrggeess AAnnoomméérriittii mmiinniissttèèrree ddee llaa mmaarriinnee ggrreecc eesstt pprriisseess ddaannss llee ccaaddrree ddee ll''OOMMII..((((((((22222222 pplluuss dd''aarrmmaatteeuurrss bbaattttaanntt ppaavviilllloo CC''eesstt ppoouurr cceess rraaiissoonnss qquuee llaa FFrr MMaallaaggaa)) éétteenndduuee àà ll''eennsseemmbbllee dd ssoommmmeett ddee CCooppeennhhaagguuee,, lleess 1122 llaa GGrrèèccee nnee ssooiitt uunnee eennttrraavvee.. LLee 2277 MMaarrss 22000033,, lleess mmiinniissttrreess ccoommppaarraabbllee àà llaa llooii aamméérriiccaaiinnee bbââttiimmeennttss àà ssiimmppllee ccooqquuee ddee ffaa ffuueellss lloouurrddss,, llaa ggéénnéérraalliissaattiioonn dd HHoorrss ddee llaa pprrééssiiddeennccee ddee ll''UUnniioo aapppplliiqquueerr lleess ddiirreeccttiivveess EEuurrooppééee nnoommbbrreeuuxx ééttaattss ss''ééttaaiieenntt eennggaagg lleess ddiirreeccttiivveess EEuurrooppééeennnneess dduu pp ééttaaiitt llaa ddaattee bbuuttooiirr ppoouurr llaa ttrraann ((((((((2222222211111111)))))))) :::::::: DDééppêêcchhee AAFFPP dduu 1122 jjaannvv ddiirreeccttiivveess eett llaa ccoommmmiissssiioonn ss''aapp eenn oouuvvrraanntt uunnee pprrooccéédduurree dd''iinnff eett eennssuuiittee dd''oobbtteenniirr ddaannss llee ffuuttuurr uunn vvaatteeuurr aauu sseeiinn ddee ll''OOMMII.. aa pprriinncciippaallee ddiiffffiiccuullttéé qquuee vvaa ddeevvooiirr ss oonnss ssuurr lleess pprrooppoossiittiioonnss ffaaiitteess ppaarr llaa lloorrss ddee llaa pprreemmiièèrree rrééuunniioonn,, llaa FFrraann ss mmeemmbbrreess àà ssoouutteenniirr cceess pprrooppoossiittiioo aatt mmeemmbbrree ddee ll''UUnniioonn EEuurrooppééeennnnee nnee sseess vvooiissiinnss.. ss ttoouutt dd''aabboorrdd llee rrôôllee iimmppoorrttaanntt ddee llaa ddee ll''EErriikkaa ,, llaa FFrraannccee ooccccuuppaaiitt llaa ffoonn ssaa pprrééssiiddeennccee llaa FFrraannccee aa ppoouusssséé ll''EE ssééccuurriittéé mmaarriittiimmee eett aa aaddrreesssséé àà ll''UUnn mm pprrooppoossaanntt pplluussiieeuurrss mmeessuurreess ppoouurr iioonn EEuurrooppééeennnnee pprrooppoossaanntt eenn rrééppoonnss aa pprrééssiiddeennccee ddee ll''UUnniioonn EEuurrooppééeennnnee oonn ttoottaallee àà ttoouutt dduurrcciisssseemmeenntt uunniillaattéé ssééccuurriittéé mmaarriittiimmee.. sseelloonn llaa pprrééssiiddeennccee eeuurrooppééeennnnee,, ss''ee ll''OOMMII,, ppoossiittiioonn ddééffeenndduuee ppaarr llee mmiinnii iiss eett llee sseeccrrééttaaiirree ggéénnéérraall ddee ll''OOMMII,, WW ttiimmaanntt qquuee dd''éévveennttuueelllleess nnoouuvveelllleess mm 2222222211111111)))))))) RRaappppeelloonnss qquuee llaa GGrrèèccee eesstt uunn dd oonnss ddee ccoommppllaaiissaannccee.. rraannccee eett ll''EEssppaaggnnee vvoouullaaiitt vvooiirr lleeuurr ii ddeess EEttaattss mmeemmbbrreess ddee ll''UUnniioonn EEuurroopp 22 eett 1133 ddéécceemmbbrree 22000022,, rreeddoouuttaanntt qq ddeess TTrraannssppoorrttss ddeess QQuuiinnzzee oonntt aaddoopp ssuurr lleess ppoolllluuttiioonnss ppééttrroolliièèrreess ((OOPPAA)) aaiirree eessccaallee ddaannss lleeuurrss ppoorrttss lloorrssqquu''iillss ddee cceettttee mmeessuurree eesstt ppoouussssééee nnoottaammmm onn EEuurrooppééeennnnee,, rreessttee llaa vvoolloonnttéé ddeess eennnneess :: aaiinnssii lloorrss dduu ssoommmmeett EEuurrooppéé ggééss àà ttrraannssppoosseerr llee pplluuss rraappiiddeemmeenntt ppaaqquueett EERRIIKKAA II.. CCeeppeennddaanntt llaa ddaattee dd nnssppoossiittiioonn ddee cceess vviieerr 22000033,, AAtthhèènneess pppprrêêttee aauujjoouurrdd''hhuuii àà ppoouurrssuuiivvrree cceerrtt ffrraaccttiioonn ((llaa BBeellggiiqquuee,, llaa FFiinnllaannddee,, llaa G nnee rreepprréésseennttaattiivviittéé eett ssuurrmmoonntteerr ll''UUEE :: aa CCoommmmiissssiioonn ddaannss ssaa nnccee ss''eesstt rreettrroouuvvééee oonnss !! ee ccoorrrreessppoonndd ppaass aa pprrééssiiddeennccee ddee nnccttiioonn ddee llaa pprrééssiiddeennccee EEuurrooppee aa pprreennddrree sseess nniioonn EEuurrooppééeennnnee eenn uunn rreennffoorrcceemmeenntt ddee llaa ssee àà cceettttee aaccttiioonn,, llaa eett ccoonnttrraaiirreemmeenntt àà llaa éérraall eenn EEuurrooppee ddee llaa eenn rreemmeettttrree iissttrree ggrreecc ddee llaa mmaarriinnee WWiilllliiaamm OO''NNeeiill.. LLee mmeessuurreess ddooiivveenntt êêttrree ddeess ééttaattss ppoossssééddaanntt llee iinniittiiaattiivvee (( aaccccoorrdd ppééeennnnee lloorrss dduu qquuee llaa pprrééssiiddeennccee ddee ppttéé uunn rrèègglleemmeenntt qquuii iinntteerrddiitt aauuxx ggrrooss ss ttrraannssppoorrtteenntt ddeess mmeenntt ppaarr llaa FFrraannccee.. EEttaattss mmeemmbbrreess aa ééeenn ddee NNIICCEE,, ddee t ddaannss lleeuurr llééggiissllaattiioonn dduu 2222 jjuuiilllleett 22000033 ttaaiinnss EEttaattss mmeemmbbrreess GGrrèèccee,, ll''IIrrllaannddee,,
  • ll''IIttaalliiee,, lleess PPaayyss BBaass,, llee PPoorrttuuggaa nnaattiioonnaalleess ddee ttrraannssppoossiittiioonn,, cceecc ddee ll''EERRIIKKAA aa ssuuccccééddéé eennccoorree uunn DDee mmêêmmee iill eexxiissttee ccllaaiirreemmeenntt uu GGrrèèccee,, lleess PPaayyss BBaass eett lleess ppaayyss mmeerrss,, eett uunn bblloocc ffoorrmméé ppaarr llaa FF aavvaanntt ttoouutt ssoouucciieeuuxx ddee llaa ssééccuurr ll''OOMMII,, lleess sseeccoonnddss bbiieenn ddéécciiddééss mmêêmmee ddee mmaanniièèrree aannttiicciippééee ppaa LL''eennttrrééee pprroocchhaaiinnee ddaannss ll''UUnniioonn rreessppeeccttiivveemmeenntt ddee llaa 55èèmmee eett 66èè lliibbeerrttéé ddeess mmeerrss aauu ddééttrriimmeenntt dd EEuurrooppééeennnnee.. EEnn eeffffeett ddaannss uunn pp ddee rreennoouuvveelleerr llaa fflloottttee ddee cceess éé aapppplliiqquueerr lleess aaccqquuiiss ccoommmmuunnaauu rraappppoorrtt ddee ffoorrccee tteellllee qquuee ddééffiinn IIll rreessttee ddoonncc bbeeaauuccoouupp àà ffaaiirree aa sseeiinn ddee llaa sseeuullee iinnssttaannccee qquuii rréé LL''eennttrrééee pprroocchhaaiinnee ddee MMaallttee eett ll''aamméélliioorraattiioonn ddee llaa ppoolliittiiqquuee ddee ddeevvaanntt êêttrree rrééaalliisséé ppoouurr ccoorrrreessp ll''UUnniioonn EEuurrooppééeennnnee ppoossssèèddeerraa lleess aarrmmeemmeennttss ccoommmmuunnaauuttaaiirree ppoouuvvaanntt ccoonnssttiittuueerr uunn ccoonnttrree ppo rreeddoouutteerr qquuee cceett ééllaarrggiisssseemmeenntt ddee ssééccuurriittéé mmaarriittiimmee.. ((((((((2222222222222222)))))))) :::::::: SSee rrééfféérreerr aauu ccoommppttee rreenn EEuurrooppééeennnnee aauu sséénnaatt llee 1100 ddéécc CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEE NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUU NNNNNNNNAAAAAAAATTTTTTTTIIIIIIII §§22..11 :: LLEE NNIIVVEEAAUU NNAATTIIOONNAALL AA ll''éécchheelloonn nnaattiioonnaall llaa llééggiittiimmiittéé iinnddiissccuuttaabbllee :: ll''ééttaatt eesstt ssoouuvveerraa ddaannss sseess eeaauuxx tteerrrriittoorriiaalleess,, ccoomm mmeerr ddee 11998822 ddaannss ssoonn aarrttiiccllee 22 ssoonn tteerrrriittooiirree eett ddeess sseess eeaauuxx iinn nnoomm ddee mmeerr tteerrrriittoorriiaallee »» .. LLaa ssééccuurriittéé dduu ttrraannssppoorrtt mmaarriittiimm ss''eexxeerrcceerr pplleeiinneemmeenntt qquuee ddaannss ccoonnttiinneennttaallee oouu mmoonnddiiaallee eenn ttee pprréévveennttiioonn.. AAiinnssii ccoonncceerrnnaanntt llaa FFrraannccee lleess aa nnaavviirreess ééttrraannggeerrss eennttrraanntt ddaannss eett cceeuuxx--ccii nnee ppeeuuvveenntt ssaannss ddiisspp aall,, llaa SSuuèèddee)) ppoouurr nnoonn ccoommmmuunniiccaattiioo ccii ppoouurr ddéémmoonnttrreerr qquu'' àà ll''éémmoottiioonn ssuu nnee ffooiiss uunnee ppoolliittiiqquuee aatttteennttiissttee.. uunnee ooppppoossiittiioonn eennttrree uunn bblloocc ffoorrmméé pp ss dduu nnoorrdd,, qquuii ffoonntt pprréévvaallooiirr llaa lliibbeerrttéé FFrraannccee,, llaa BBeellggiiqquuee,, eett lleess ppaayyss mmééddii rriittéé mmaarriittiimmee ((((((((2222222222222222)))))))) :: lleess pprreemmiieerrss pprrôô ss àà pprreennddrree ddeess mmeessuurreess ppaarr ll''iinntteerrmm aarr rraappppoorrtt àà ll''OOMMII.. nn EEuurrooppééeennnnee ddee MMaallttee eett ddee CChhyypprree èèmmee fflloottttee mmoonnddiiaallee,, rriissqquuee ddee rreennffoorrcc ddee cceelluuii ddee llaa ssééccuurriittéé mmaarriittiimmee aauu ss pprreemmiieerr tteemmppss cceettttee aaddhhééssiioonn aauurraa ss ééttaattss ccaarr iillss ddeevvrroonntt ddèèss lleeuurr eennttrrééee aa uuttaaiirree mmaaiiss uunnee ffooiiss cceettttee ééttaappee ffrraann nnii pprrééccééddeemmmmeenntt ppoouurrrraa ss''iinnssttaalllleerr.. aavvaanntt qquuee ll''EEuurrooppee nnee ppuuiissssee ppaarrlleerr éggiitt llee ssyyssttèèmmee mmoonnddiiaall :: ll''OOMMII.. ddee CChhyypprree aauurraa ssaannss ddoouuttee uunn eeffffeett ee ssééccuurriittéé mmaarriittiimmee aauu sseeiinn mmêêmmee ddee sppoonnddrree aauuxx ccrriittèèrreess mmiinniimmuumm ddee ll''EEu aaiinnssii llaa pprreemmiièèrree fflloottttee mmoonnddiiaallee ((llee eess ppaasssseerraa ddee 1155,,9988%% àà 2266,,1166%% dduu pooiiddss àà ll''OOMMII,, cceeppeennddaanntt aauu sseeiinn mmêêmm tt ddee ll''EEuurrooppee nnee rraalleennttiissssee lleess ffuuttuurrss nndduu ddee llaa rrééuunniioonn ddee llaa ddééllééggaattiioonn pp cceemmbbrree 22000022.. IIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL :::::::: LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE EEEEEEEETTTTTTTT IIIIIIIISSSSSSSSOOOOOOOOLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT éé dd''uunnee ppoolliittiiqquuee eenn mmaattiièèrree ddee ssééccuu aaiinn eett ppeeuutt ddoonncc éémmeettttrree ddeess rréégglleemm mmppéétteennccee rraappppeellééee ppaarr llaa CCoonnvveennttiioonn 22 :: «« LLaa ssoouuvveerraaiinneettéé ddee ll''EEttaatt ccôôttiieerr nnttéérriieeuurreess,, àà uunnee zzoonnee ddee mmeerr aaddjjaacc mmee eesstt ppaarr nnaattuurree uunnee ccoommppéétteennccee éé llee ccaaddrree dd''uunnee ccooooppéérraattiioonn iinntteerrnnaattii eerrmmee ddee nnoorrmmeess,, ddee pprrooccéédduurreess eett ddee aarrrrêêttééss pprrééffeeccttoorraauuxx ddooiivveenntt êêttrree aapp s lleess eeaauuxx tteerrrriittoorriiaalleess eett àà ddeessttiinnaattiioo ppeennsseerr :: ll''oonn ppeeuutt cciitteerr lleess aarrrrêêttééss ppr oonn ddeess ddiissppoossiittiioonnss uusscciittééee ppaarr llee nnaauuffrraaggee ppaarr ll''AAnngglleetteerrrree,, llaa éé ddee cciirrccuullaattiioonn ssuurr lleess iitteerrrraannééeennss,, qquuii ssoonntt ôônnaanntt ll''hhééggéémmoonniiee ddee mmééddiiaaiirree ddee ll''EEuurrooppee ee,, qquuii ddiissppoossee cceerr llee ccaammpp ddee llaa sseeiinn mmêêmmee ddee ll''UUnniioonn ssaannss ddoouuttee ppoouurr eeffffeett aauu sseeiinn ddee ll''EEuurrooppee nncchhiiee,, llaa ssiittuuaattiioonn ddee dd''uunnee sseeuullee vvooiixx aauu t bbéénnééffiiqquuee ppoouurr ee sseess EEttaattss,, uunn eeffffoorrtt Euurrooppee eett ddee pplluuss ee ttoonnnnaaggee eexxppllooiittéé ppaarr ttoonnnnaaggee mmoonnddiiaall)) mmee ddee ll''EEuurrooppee iill ffaauutt ss pprrooggrrèèss eenn mmaattiièèrree ppoouurr ll''UUnniioonn TTTTTTTT uurriittéé nnaattiioonnaallee eesstt mmeennttaattiioonnss pprroopprreess nn ssuurr llee ddrrooiitt ddee llaa rr ss''éétteenndd aauu--ddeellàà ddee cceennttee ddééssiiggnnééee ssoouuss llee ééttaattiiqquuee qquuii nnee ppeeuutt iioonnaallee àà ll''éécchheellllee ee mmooyyeennss ddee pppplliiqquuééss ppaarr ttoouuss lleess oonn dd''uunn ppoorrtt ddee FFrraannccee rrééffeeccttoorraauuxx eenn
  • mmaattiièèrree ddee rréégglleemmeennttaattiioonn ddee ll zzoonneess ppoorrttuuaaiirreess ddee FFrraannccee,, lleess oobblliiggaattooiirreess ddeess nnaavviirreess ppééttrroolliiee ssyyssttèèmmee ddee ccoommppttee rreenndduu aa ééttéé LL''oonn ppeeuutt cciitteerr ééggaalleemmeenntt llee ssyys ffrraannççaaiissee àà ddeess nnaavviirreess,, ppééttrroolliiee ssuurr llee ffoonnddeemmeenntt ddee llaa llooii dduu 1166 llee ddrrooiitt dd''iinntteerrvveennttiioonn eenn hhaauuttee SSuurr llee ppllaann ddee llaa ppeerrttiinneennccee iill nn ffoonnddééee ppoouurr llaa ssaauuvveeggaarrddee ddeess nnaattiioonnaallee eett nnee vvaa ppaass àà ll''eennccoonn LLee pprroobbllèèmmee qquuii ssee ppoossee ppoouurr lle tteexxttee oouu uunnee rréégglleemmeennttaattiioonn qquu LL''ééttaatt ccoonncceerrnnéé ddooiitt ssoorrttiirr ddee ssoo iissoolleemmeenntt eett ll''aaffffaaiirree ddooiitt êêttrree tt pplluussiieeuurrss ééttaattss ssee rreennccoonnttrreenntt aa mmaattiièèrree ddee pprrootteeccttiioonn ddee ll''eennvviirr lleess ffrroonnttiièèrreess.. CCeeppeennddaanntt ccoommmmee nnoouuss ll''aavvoonnss ddiissppoossiittiioonnss ppeeuuvveenntt êêttrree pprriisseess llee rraappppeellllee nnoonn ddee ppeerrttiinneennccee cca pprroobbllèèmmee.. SSoouuss llaa pprreessssiioonn mmééddiiaattiiqquuee ddee ccoonncceerrttaattiioonn aavveecc lleess iinnssttiittuuttiioonn ddééllaaii iinnssoouutteennaabbllee ppoouurr lleess aauuttoo pprreessssiioonn ppooppuullaaiirree.. RRaappppeelloonnss lleess mmeessuurreess uunniillaattéérr ccoonnssttrruuccttiioonn ddee ppééttrroolliieerrss ddoouubb lloorrssqquuee lleess ééttaattss uunniiss lliimmiitteenntt ll'' nnaattiioonnaallee,, llee ppooiiddss ddeess éécchhaannggee àà llaa gglloobbaalliittéé dduu mmoonnddee mmaarriittiimm ddee ppééttrroolliieerr EEEEEE dd''êêttrree ggéénnéérraallii ccoonnssttrruuccttiioonn ddee ppééttrroolliieerr ddoouubbllee tteerrmmee.. RRaappppeelloonnss ééggaalleemmeenntt lleess mmeessuu ccaauussééee ppaarr llee nnaauuffrraaggee dduu PPrreess CCoonnvveennttiioonn ddeess EEttaattss--UUnniiss ssuurr l ddeess 220000 mmiilllleess ppoouurr lleess ppééttrroolliiee lloouurrdd.. CCeettttee mmeessuurree ttrroouuvvee ddoonn vvooiixx dd''EEuurrooppééaanniissaattiioonn,, llee ccoonnss ll''aatttteennttee dd''uunnee rréégglleemmeennttaattiioonn ,, ccoommmmee llaa FFrraannccee eett ll''EEssppaaggnnee llaa cciirrccuullaattiioonn mmaarriittiimmee qquuii eexxiissttee ppoouu ss aarrrrêêttééss rréégglleemmeennttaanntt ééggaalleemmeenntt llee eerrss eennttrraanntt lleess eeaauuxx nnaattiioonnaalleess.. SSiiggnn éé pprrééccuurrsseeuurr ddee cceelluuii ddee ll''OOMMII.. yssttèèmmee ddee ll''aassssiissttaannccee iimmppoossééee ppaarr ll'' eerrss oouu aauuttrreess,, eenn ddiiffffiiccuullttéé aauu llaarrggee 66 JJuuiilllleett 11997766 qquuii ss''aappppuuii ssuurr llaa CCoonnv ee mmeerr.. nnee ffaaiitt aauuccuunn ddoouuttee qquu''aauu nniivveeaauu nnaatt iinnttéérrêêttss nnaattiioonnaauuxx lloorrssqquuee llaa rrééppeerrcc nnttrree dduu ddrrooiitt ddee llaa mmeerr.. ee nniivveeaauu nnaattiioonnaall cc''eesstt lloorrssqquuee cceelluuii uu''iill cchheerrcchhee àà ffaaiirree aapppplliiqquueerr ssuurr llee pp oonn ttrraaiittéé ddee mmaanniièèrree ddiipplloommaattiiqquuee :: lloorrss aalloorrss llee ppooiiddss eesstt pplluuss iimmppoorrttaanntt.. CC''ee rroonnnneemmeenntt,, lleess ppoolllluuttiioonnss mmaarriittiimmeess ss vvuu pprrééccééddeemmmmeenntt ssoouuss llee ccoouupp ddee ss,, ddiissppoossiittiioonnss qquuii ssoouuffffrreenntt dd''uunn ddoouu caarr cc''eesstt bbiieenn ssoouuvveenntt llaa ffoorrmmee eett nnoo eess mmeessuurreess ssoonntt pprriisseess aavveecc pprréécciippiittaa nnss iinntteerrnnaattiioonnaalleess,, ccee qquuii iimmpplliiqquueerraa oorriittééss nnaattiioonnaalleess ccoonnffrroonnttééeess ddee mmaa rraalleess ccoommmmee ll''OOPPAA 9900 ddeess EEttaattss--UUnniiss bblleess ccooqquueess,, mmeessuurreess iimmppoossééss ssii rraappi ''aaccccèèss àà lleeuurrss eeaauuxx eenn ffoonnccttiioonn dd''uunne eess ééccoonnoommiiqquueess eesstt tteell qquuee cceettttee rréégg mmee)) qquu''eelllleess nn''oonntt ppaass ppeerrmmiiss aauu ssyyss iisséé.. AAuujjoouurrdd''hhuuii llaa qquueessttiioonn ssee ppoossee ee ccooqquuee eesstt llaa ssoolluuttiioonn tteecchhnniiqquuee llaa uurreess bbiillaattéérraalleess ddeess aaccccoorrddss ddee MMaallaagg ssttiiggee.. CCeess mmeessuurreess ss''aappppuuiieenntt ssuurr ll''AA llee ddrrooiitt ddee llaa mmeerr ddee 11998822 aaffiinn ddee lliimm eerrss ssiimmpplleess ccooqquuee ddee pplluuss ddee 1155 aannss nncc ssaa llééggiittiimmiittéé aauu sseeiinn dd''uunn tteexxttee iinn seeiill ttrraannssppoorrtt dduu 66 ddéécceemmbbrree 22000022 aayy eeuurrooppééeennnnee,, lleess EEttaattss mmeemmbbrreess qquuii ee,, ppoouuvvooiirr pprreennddrree ddee tteelllleess mmeessuurreess uurr ttoouuss lleess ggoollffss eett eess ccoommpptteess rreenndduuss nnaalloonnss iiccii qquuee ccee ''aaddmmiinniissttrraattiioonn ddeess ccôôtteess ffrraannççaaiisseess,, vveennttiioonn ddee 11996699 ssuurr ttiioonnaall ll''aaccttiioonn eesstt ccuussssiioonn rreessttee i--ccii ooeeuuvvrree ppoouurr uunn ppllaann iinntteerrnnaattiioonnaall.. ssqquuee lleess iinnttéérrêêttss ddee eesstt ssoouuvveenntt llee ccaass eenn ss nnee ccoonnnnaaiissssaanntt ppaass ee ll''éémmoottiioonn ddeess uuttee ddee llééggiittiimmiittéé eett jjee oonn llee ffoonndd qquuii ppoossee aattiioonn ssaannss aaiitt aassssuurréémmeenntt uunn aanniièèrree pplluuss pprroocchhee àà llaa ss qquuii aa pprréécciippiittéé llaa piiddeemmeenntt ((iimmppoosséé ccaarr nee rréégglleemmeennttaattiioonn gglleemmeennttaattiioonn ss''iimmppoossee ssttèèmmee ddee ccoonnssttrruuccttiioonn ddee ssaavvooiirr ssii llaa pplluuss vvaallaabbllee àà lloonngg ggaa,, ssuuiittee àà llaa ppoolllluuttiioonn AArrtt 5566 ddee llaa mmiitteerr ll''aaccccèèss àà llaa zzoonnee s ttrraannssppoorrttaanntt ddeess ffuueell nntteerrnnaattiioonnaallee eett eesstt eenn yyaanntt ddéécciiddéé qquuee ddaannss llee ssoouuhhaaiitteenntt ddooiivveenntt ss..
  • PPoouurr oobbtteenniirr uunnee llééggiittiimmiittéé iinnccoo ddooiivveenntt ddoonncc êêttrree vvaalliiddéé ddee mmaa eesstt dd''hhaarrmmoonniisseerr lleess ddiifffféérreenntteess LLeess ddééllaaiiss bbiieenn ttrroopp lloonnggss ééttaanntt rreejjooiinntt llee ffaaiitt qquuee llaa ssoolluuttiioonn ssee eennssuuiittee ddeess oorrggaanniissmmeess iinntteerrnnaa DDeeppuuiiss ll''EERRIIKKAA llaa FFrraannccee aa pprriiss ll''EEuurrooppee ppoouurr pprrooppoosseerr ddeess pplluuss aauu ttrraavveerrss ddee ttrrooiiss mmeemmoorraannddaa 22000000 àà ll''OOMMII,, àà ll''UUnniioonn EEuurrooppééee aapppprroocchhee gglloobbaallee ppoouurr llee rreennffoorr -- eenn mmaattiièèrree ddee pprréévveennttiioonn,, aamm ll''iiddeennttiiffiiccaattiioonn ddeess nnaavviirreess ttrraannss ttrraannssmmiissssiioonn,, aauu pprrééaallaabbllee,, dd''uun -- hhaarrmmoonniisseerr lleess ccoonnddiittiioonnss ddee -- rreennffoorrcceerr llee ccoonnttrrôôllee ddee llaa ssttrruu -- aassssuurreerr uunn mmeeiilllleeuurr ccoonnttrrôôllee dd EEttaattss dduu ppoorrtt eett dduu ppaavviilllloonn,, ssoo -- aaccccrrooîîttrree llaa ttrraannssppaarreennccee ggrrââcc ppaarrttiirr ddee llaa bbaassee ddee ddoonnnnééeess EEQQ -- ffaaiirree éévvoolluueerr llee ddiissppoossiittiiff dduu FF iinntteerrnnaattiioonnaalleess.. LLaa ppeerrttiinneennccee àà aaggiirr eenn mmaattiièèrree ggééooggrraapphhiiqquuee,, ll''éécchheellllee nnaattiioonnaa nnuuiissaannccee oouu ddeess ppeerrtteess hhuummaaiinn pprroommoouuvvooiirr eennccoorree llaa ssééccuurriittéé mm rrééggiioonnss mmaarriittiimmeess ggééooggrraapphhiiqquu vviiccttiimmeess ddeess nnuuiissaanncceess àà ll''eennvviirr §§22..22 :: LLEE NNIIVVEEAAUU RREEGGIIOONNAALL LLee nniivveeaauu rrééggiioonnaall eesstt ssaannss ddoouu mmaarriittiimmee.. EEnn eeffffeett lleess rrééggiioonnss mm ééccoollooggiiqquueess ttyyppee AAMMOOCCOO CCAADDIIZZ ddee ll''ééllaabboorraattiioonn ddee nnoorrmmeess ddee rr ppeerrttiinneenntt.. AA pprriioorrii lleess rrééggiioonnss mm nnaattiioonnaall cceeppeennddaanntt eelllleess pprreennnnee pprroovveennaanntt dd''aacccciiddeennttss mmaarriittiimmee ppoolllluuttiioonnss mmaarriittiimmeess mméépprriissaanntt ddiimmeennssiioonn iinntteerrnnaattiioonnaallee aauuxx rréé mmiieeuuxx ddééffeennddrree lleeuurrss iinnttéérrêêttss.. oonntteessttaabbllee,, lleess mmeessuurreess pprriisseess ddee mmaa aanniièèrree iinntteerrnnaattiioonnaallee,, ssoouuvveennoonnss nnoouu ss rréégglleemmeennttaattiioonnss nnaattiioonnaalleess.. tt llee pprroobbllèèmmee pprriinncciippaall àà llaa ssuuiittee dd''uu eerraaiitt uunnee ppoolliittiiqquuee pprréévveennttiivvee ttoouutt dd'' aattiioonnaauuxx.. ccoonnsscciieennccee ddee ccee ffaaiitt eett eesstt ttrrèèss aacctt ssiieeuurrss sséérriieess ddee mmeessuurreess.. CCeettttee vvoolloo aa aaddrreessssééss ppaarr llee GGoouuvveerrnneemmeenntt ffrraann eennnnee eett aauu FFIIPPOOLL,, mmeemmoorraannddaa qquuii dd rrcceemmeenntt ddee llaa ssééccuurriittéé :: mméélliioorreerr llaa ssuurrvveeiillllaannccee ddeess nnaavviirreess ee ssppoorrttaanntt ddeess pprroodduuiittss ddaannggeerreeuuxx eett nn ddoossssiieerr ddee ssééccuurriittéé aavvaanntt ll''aaccccèèss àà ttrraavvaaiill ddeess ééqquuiippaaggeess ;; uuccttuurree ddeess nnaavviirreess ;; ddeess oorrggaanniissmmeess cchhaarrggééss ddee llaa ssééccuurrii occiiééttééss ddee ccllaassssiiffiiccaattiioonn -- ;; ccee àà llaa mmiissee eenn ccoommmmuunn dd''iinnffoorrmmaattiioo QQUUAASSIISS ;; FFIIPPOOLL eett bbaannnniirr lleess nnaavviirreess nnee rreessppeecc ee ddee ssééccuurriittéé mmaarriittiimmee ss''aappppuuii ddoonncc aallee ééttaanntt bbiieenn ssoouuvveenntt ll''eennttiittéé llaa pplluuss nneess ;; mmaaiiss uunnee éécchheellllee eennccoorree pplluuss hh mmaarriittiimmee,, iill ss''aaggiitt ddeess rrééggiioonnss eett pplluu uueemmeenntt qquuii eelllleess ssaannss nnuull ddoouuttee ssoonntt rroonnnneemmeenntt.. uuttee llee pplluuss sseennssiibbllee àà ll''aamméélliioorraattiioonn dd mmaarriittiimmeess ssoonntt lleess vviiccttiimmeess ddiirreecctteess ZZ ,, EERRIIKKAA oouu PPRREESSTTIIGGEE.. SSaannss rrééeellllee rréégguullaattiioonn,, cc''eesstt ssaannss ddoouuttee cceeppeennddaa mmaarriittiimmeess ppaarraaiisssseenntt aaiinnssii bbiieenn iissoollééee eenntt uunnee aauuttrree ddiimmeennssiioonn ddaannss llee ddoomm eess,, ddee ppaarrtt llaa nnaattuurree mmêêmmee ddee cceess pp tt lleess ffrroonnttiièèrreess ggééooggrraapphhiiqquueess,, eelllleess ééggiioonnss mmaarriittiimmeess lloorrssqquuee cceelllleess--ccii ssee aanniièèrree uunniillaattéérraallee uuss dduu rrôôllee ddee ll''OOMMII qquuii unnee ccaattaassttrroopphhee ll''oonn 'aabboorrdd ddeess ééttaattss eett ttiivvee aauu sseeiinn ddee oonnttéé ppeeuutt ssee ccoonnssttaatteerr nnççaaiiss llee 1155 fféévvrriieerr ddéévveellooppppaaiieenntt uunnee eenn éétteennddaanntt eenn eexxiiggeeaanntt llaa àà uunn ppoorrtt eeuurrooppééeenn ;; iittéé -- iinnssppeecctteeuurrss ddeess oonnss ssuurr lleess nnaavviirreess àà ccttaanntt ppaass lleess nnoorrmmeess ssuurr uunn ffaaiitt ss sseennssiibbllee àà uunnee huummaaiinnee ppeeuutt uuss pprréécciisséémmeenntt lleess tt lleess pprreemmiièèrreess ddee llaa ssééccuurriittéé ddeess ccaattaassttrroopphheess ee llééggiittiimmiittéé ssuurr llee ppllaann aanntt llee nniivveeaauu llee pplluuss eess ssuurr uunn ppllaann mmaaiinnee ddeess ppoolllluuttiioonnss ppoolllluuttiioonnss.. EEnn eeffffeett lleess ddoonnnneenntt aaiinnssii uunnee ee rreeggrroouuppeenntt ppoouurr
  • AAiinnssii llaa CCoonnfféérreennccee ddeess RRééggiioonnss cceerrttaaiinnee mmaanniièèrree uunnee vvaalleeuurr ccoo ll''UUnniioonn EEuurrooppééeennnnee.. AAiinnssii ssuuiittee aauu PPRREESSTTIIGGEE,, uunnee dd MMaarriittiimmeess dd''EEuurrooppee aa ééttéé rreeççuuee CCoommmmiissssiioonn EEuurrooppééeennnnee eenn cchhaa dd''aabboorrddeerr ccoonnccrrèètteemmeenntt lleess mmee CCoommppoossééee ddee rreepprréésseennttaannttss ddee ddééllééggaattiioonn aa eexxppoosséé ddeess pprrééoocccc ppaarrttaaggééeess ppaarr lleess 115500 rrééggiioonnss mm PPoouurr llaa CCoommmmiissssaaiirree,, llaa pprriissee ee nnéécceessssaaiirree ppoouurr pprrooggrreesssseerr ddaann mmeessuurreess pprrooppoossééeess ppaarr llaa CCoomm ttiieennnneenntt llaarrggeemmeenntt ccoommppttee ddeess ((((((((2222222244444444)))))))),,,,,,,, ppaarrmmii cceelllleess--ccii,, ll''uuttiilliissaattiioo ((((((((2222222233333333)))))))) :::::::: wwwwww..ccrrppmm..oorrgg ((((((((2222222244444444)))))))) :::::::: VVooiirr llaa ddééccllaarraattiioonn ddee BBrree mmeessuurreess nnéécceessssaaiirreess aaffiinn ddee ggaa nnaauuffrraaggee dduu ppééttrroolliieerr «« pprreessttiiggee 22000022 ;; ddiissppoonniibblleess ssuurr llee ssiittee IInntteerrnneett wwwwww..ccrrppmm..oorrgg ll''ééqquuiippeemmeenntt ddee «« ppoorrttss rreeffuuggee lluuttttee ccoonnttrree lleess ppoolllluuttiioonnss.. LLaa ccoommmmiissssaaiirree rreeccoonnnnaaîîtt qquuee ll aauu sseeiinn ddee ll''EEuurrooppee rreessttee llaa ttrraann ddeess ddéécciissiioonnss qquu''iillss oonntt aaddooppttéé ssééccuurriittéé mmaarriittiimmee rrééeelllleemmeenntt eeff CCoonnsseeiill «« ttrraannssppoorrtt »» ddeess 55 eett 66 EEtt cc''eesstt iiccii qquu''aappppaarraaîîtt llee rrôôllee qq aauu sseeiinn mmêêmmee ddee lleeuurr ggoouuvveerrnnee eennccoouurraaggéé lleess RRééggiioonnss ddee llaa CCRR GGoouuvveerrnneemmeennttss rreessppeeccttiiffss aaffiinn CCoommmmee nnoouuss aavvoonnss ppuu llee ccoonnsstt nniivveeaauu qquuii ddooiitt ssttaattuueerr eenn mmaattiiè mmaarriittiimmee,, ttoouuss lleess nniivveeaauuxx ééttaann CCeeccii ppeeuutt êêttrree ccoonnssttaattéé ccoonnccrrèètt mmaattiièèrree eett qquuii nnoouuss sseerrvviirraa ddee t bbaannnniisssseemmeenntt ddeess nnaavviirreess ppééttrroo CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIIIIIIIIIII :::::::: MMMMMMMMIIIIIIIISSSSSSSSEEEEEEEE EEEEEEEENNNNNNNN EEEEEEEEVVVVVVVVIIIIIIIIDDDDDDDDEEEEEEEE IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRVVVVVVVVEEEEEEEENNNNNNNNAAAAAAAANNNNNNNNTTTTTTTTSSSSSSSS PPPPPPPPAAAAAAAARRRRRRRR LLLLLLLL''''''''EEEEEEEEXXXXXXXXEEEEEEEEMMMMMMMMPPPPPPPPLLLLLLLLEEEEEEEE PPPPPPPPEEEEEEEETTTTTTTTRRRRRRRROOOOOOOOLLLLLLLLIIIIIIIIEEEEEEEERRRRRRRRSSSSSSSS SSSSSSSSIIIIIIIIMMMMMMMMPPPPPPPPLLLLLLLLEEEEEEEE CCCCCCCCOOOOOOOOQQQQQQQQUUUUUUUUEEEEEEEE ss PPéérriipphhéérriiqquueess MMaarriittiimmeess dd''EEuurrooppee oonnssuullttaattiivvee eenn mmaattiièèrree ddee ssééccuurriittéé mm ddééllééggaattiioonn ddee llaa CCoonnfféérreennccee ddeess RRééggi ee llee 2211 jjaannvviieerr 22000033 ppaarr llaa VViiccee--pprrééss aarrggee ddeess ttrraannssppoorrttss,, MMmmee LLooyyoollaa DDee eessuurreess àà pprreennddrree eenn mmaattiièèrree ddee ssééccuu ee ll''eennsseemmbbllee ddeess bbaassssiinnss mmaarriittiimmeess ee ccuuppaattiioonnss pprroopprreess àà cceerrttaaiinnss ddee cceess ee mmeemmbbrreess ddee llaa CCRRPPMM.. eenn ccoommppttee ddee llaa ddiivveerrssiittéé ddeess ssiittuuaattiioo nnss llaa ccoonnssttrruuccttiioonn eeuurrooppééeennnnee.. EEllllee aa mmmmiissssiioonn EEuurrooppééeennnnee ddeeppuuiiss ll''aacccciiddeenn ss pprrooppoossiittiioonnss qquu''aavvaaiitt ffoorrmmuullééee llaa CC oonn ddeess ccrrééddiittss ddee llaa ppoolliittiiqquuee ddeess ttrraann rreesstt aaddooppttééee eenn nnoovveemmbbrree 22000000,, eett ll aarraannttiirr llaa ssééccuurriittéé ddeess mmeerrss eeuurrooppééeen ee »» aauu llaarrggee ddeess ccôôtteess ddee GGaalliiccee aaddoo e »» eett ll''ééllaabboorraattiioonn ddee ppllaannss eeuurrooppééeenn llee pprriinncciippaall pprroobbllèèmmee àà ll''éévvoolluuttiioonn ddee nnssppoossiittiioonn eett ll''aapppplliiccaattiioonn ccoonnccrrèèttee pp eett qquuee llaa vvoolloonnttéé ddee mmiissee eenn ppllaaccee dd ffffiiccaaccee,, aaffffiicchhééee uunnaanniimmeemmeenntt ppaarr llee 66 ddéécceemmbbrree 22000022,, ccoommmmeennccee àà ss''éémm quuee ppeeuutt jjoouueerr lleess rrééggiioonnss mmaarriittiimmeess eemmeenntt rreessppeeccttiiff.. LLaa CCoommmmiissssaaiirree aa dd RRPPMM àà ccoonnttiinnuueerr lleeuurr aaccttiioonn aauupprrèèss dd dd''aaccccéélléérreerr ccee pprroocceessssuuss.. ttaatteerr,, iill eesstt ttrrèèss ddiiffffiicciillee dd''aarrrrêêtteerr uunnee ièèrree dd''ééllaabboorraattiioonn ddee nnoorrmmeess eenn mmaatt nntt iimmpplliiqquuééss pplluuss oouu mmooiinnss ddiirreecctteemm tteemmeenntt aauu ttrraavveerrss dd''uunn eexxeemmppllee ttrrèèss ttrraannssiittiioonn vveerrss nnoottrree sseeccoonnddee sseeccttiioo oolliieerrss ssiimmppllee ccooqquuee.. EEEEEEEENNNNNNNNCCCCCCCCEEEEEEEE DDDDDDDDUUUUUUUU RRRRRRRROOOOOOOOLLLLLLLLEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFEEEEEEEERRRRRRRREEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS EEEEEEEE TTTTTTTTRRRRRRRREEEEEEEESSSSSSSS MMMMMMMMEEEEEEEEDDDDDDDDIIIIIIIIAAAAAAAATTTTTTTTIIIIIIIISSSSSSSSEEEEEEEE DDDDDDDDUUUUUUUU BBBBBBBBAAAAAAAANNNNNNNNNNNNNNNNIIIIIIIISSSSSSSSSSSSSSSSEEEEEEEEMMMMMMMMEEEEEEEE ((((((((2222222233333333)))))))) ppoossssèèddee dd''uunnee mmaarriittiimmee aauu sseeiinn ddee giioonnss PPéérriipphhéérriiqquueess ssiiddeennttee ddee llaa ee PPaallaacciioo,, aaffiinn uurriittéé mmaarriittiimmee.. eeuurrooppééeennss,, cceettttee eessppaacceess eett cceelllleess oonnss eesstt uunnee ccoonnddiittiioonn aa pprréésseennttéé lleess nntt dduu PPrreessttiiggee,, qquuii CCRRPPMM pprrééccééddeemmmmeenntt nnssppoorrttss ppoouurr llaa ddééccllaarraattiioonn ssuurr lleess eennnneess ssuuiittee aauu ooppttééee llee 33 ddéécceemmbbrree nnss ddee ccoooorrddiinnaattiioonn ddee ee llaa ssééccuurriittéé mmaarriittiimmee ppaarr lleess EEttaattss mmeemmbbrreess dd''uunnee ppoolliittiiqquuee ddee eess EEttaattss lloorrss dduu mmoouusssseerr.. ss,, uunn rrôôllee ddee pprreessssiioonn ddoonncc vviivveemmeenntt ddee lleeuurrss ee ppoossiittiioonn ssuurr llee ttiièèrree ddee ssééccuurriittéé mmeenntt ddaannss ccee ddoommaaiinnee.. ss ssiiggnniiffiiccaattiiff eenn llaa onn,, llee ccaass dduu EEEEEEEENNNNNNNNTTTTTTTT DDDDDDDDEEEEEEEESSSSSSSS NNNNNNNNAAAAAAAAVVVVVVVVIIIIIIIIRRRRRRRREEEEEEEESSSSSSSS
  • AAffiinn dd''aapppprrééhheennddeerr llaa ccoommpplleexxii rreellaattiioonnss ppaarrffooiiss hhoouulleeuusseess eennttrr rréégglleemmeennttaattiioonn eenn mmaattiièèrree ddee pp ééttaanntt ppaarrffaaiitteemmeenntt rreepprréésseennttaatt qquuii oonntt ssuuiivvii llaa ccaattaassttrroopphhee dduu LL''ééttuuddee ddee ccee ccaass ppeerrmmeettttrraa éégg rréégglleemmeennttaattiioonn eett ll''ééttuuddee dduu rree IIll eesstt ppoossssiibbllee ddee ddiissttiinngguueerr ddeeuu ppoolllluuttiioonn ppaarr hhyyddrrooccaarrbbuurree,, llaa pp ccoonnssiissttaaiitt àà lluutttteerr eesssseennttiieelllleemmee iinnttéérreessssaannttee ppoouurr nnoottrree ééttuuddee,, ll''OOMMII eenn mmaattiièèrree dd''ééllaabboorraattiioonn §§33..11 :: LL''OOMMII ,, LLEEAADDEERR DDEE LLAA RR CCoonnssiiddéérroonnss llaa pprreemmiièèrree ppéérriioodd LLeess ppééttrroolliieerrss ddee pplluuss eenn pplluuss gg nn''ééttaaiieenntt ccoonnssttiittuuééss,, ppoouurr llaa ppaa qquu''uunn nnaavviirree,, eett ssuurrttoouutt uunn ppééttrr eeffffeeccttuueerr ddee ttrraavveerrssééee ccoommppllèèttee cceettttee rraaiissoonn,, lleess ppééttrroolliieerrss bbaallllaa pprrééaallaabblleemmeenntt cchhaarrggééeess ddee ppéétt ééttaaiitt ddiirreecctteemmeenntt rreejjeettééee eenn mmee SSoouuss ll''ééggiiddee ddee ll''OOMMII ll''ééllaabboorraatt bbaallllaassttss pprroopprreess,, cc''eesstt--àà--ddiirree ddee eett ddoonntt llaa rrééppaarrttiittiioonn aavvaaiitt ffaaiitt l nnaavviirree.. DDaannss cceess ccoonnddiittiioonnss lleess eeaauuxx ddee ooppéérraattiioonnnneellllee ssuupppprriimmééee.. LL''aauut ééttaaiitt llee rreejjeett ddeess eeaauuxx ddee llaavvaagg cciitteerrnneess aapprrèèss ddéécchhaarrggeemmeenntt ssoo ssooiitt ppoouurr ssuupppprriimmeerr uunnee ppaarrttiiee hhyyddrrooccaarrbbuurreess ééttaaiitt rreejjeettééee ddiirree TToouujjoouurrss ppaarr llaa ccoonnvveennttiioonn MMAARR éélliimmiinneerr cceettttee ppoolllluuttiioonn :: uunn ccaall ddeeppuuiiss oobblliiggaattooiirree ssuurr llee cciirrccuuiitt ll''aappppaarriittiioonn ddee cciitteerrnneess ddee rréétteenn ddéécchhaarrggeemmeenntt ppaarr aaccttiioonn ssuurr llaa ll''eeaauu ddee mmeerr rreejjeettééee eesstt ssuuppéérriiee dd''aauuttrreess ccrriittèèrreess ssoonntt aassssoocciiééss à ssppéécciiaalleess ddaannss lleessqquueelllleess iill eesstt nnaavviirree ddooiitt ffaaiirree rroouuttee,, êêttrree àà uu ddeevvaanntt ddééppaasssseerr 11//1155000000 ddee llaa nnaavviirreess eexxiissttaannttss,, ppuuiiss 11//3300000000 iittéé llééggiissllaattiivvee eenn mmaattiièèrree ddee ssééccuurriittéé rree lleess ddiifffféérreennttss oorrggaanneess rréégguullaatteeuurrss ppééttrroolliieerrss ddoouubbllee ccooqquuee ss''aavvèèrree nnééccee ttiiff eett qquuii pplluuss eesstt dd''aaccttuuaalliittéé aavveecc lleess PPrreessttiiggee.. ggaalleemmeenntt llaa ttrraannssiittiioonn eennttrree ll''ééttuuddee dd eessppeecctt ddee cceettttee rréégglleemmeennttaattiioonn.. uuxx ppéérriiooddeess bbiieenn ddiissttiinncctteess eenn mmaattiièè pprreemmiièèrree ééttaanntt iinnttééggrraalleemmeenntt ddoommiinn eenntt ccoonnttrree llaa ppoolllluuttiioonn ooppéérraattiioonnnneellllee aa vvuu ll''éémmeerrggeennccee ddee llaa rreemmiissee eenn ccaa ddee rréégglleemmeennttaattiioonn eenn mmaattiièèrree ddee sséé RREEGGLLEEMMEENNTTIIOONN ddee qquuii ss''éétteenndd jjuussqquu''àà ll''aacccciiddeenntt ddee ll'' ggrrooss mmaaiiss ttrrèèss ssiimmpplleess dduu ppooiinntt ddee vvuu aarrttiiee ccaarrggaaiissoonn,, qquuee ddee cciitteerrnneess àà ccaarr rroolliieerr,, ppeeuutt êêttrree aassssiimmiilléé àà uunnee ppoouutt eemmeenntt vviiddee ppoouurr ddeess rraaiissoonnss dd''eeffffoorrtt aassttaaiieenntt àà ll''eeaauu ddee mmeerr,, uunnee ppaarrttiiee dd ttrroollee.. CCeettttee qquuaannttiittéé ééttaanntt iimmppoorrttaanntt eerr aavvaanntt ll''aarrrriivvééee aauu ppoorrtt ddee cchhaarrggeemm ttiioonn ddee llaa ccoonnvveennttiioonn MMAARRPPOOLL 7733//7788 eess cciitteerrnneess dduu nnaavviirree ddeessttiinnééeess uunniiqq ll''oobbjjeett ddee ccaallccuullss dd''eeffffoorrttss lloorrss ddee llaa ee bbaallllaassttss nn''ééttaaiieenntt pplluuss ssoouuiillllééss eett llaa ttrree ooppéérraattiioonn qquuii rreepprréésseennttaaiitt uunnee pp ggee ddeess cciitteerrnneess.. EEnn eeffffeett iill eesstt iinnddiissppee ooiitt ppoouurr pprrééppaarreerr lleess cciitteerrnneess aauu pprroo ddeess rrééssiidduuss.. CCeettttee eeaauu ddee llaavvaaggee ssoo eecctteemmeenntt eenn mmeerr.. RRPPOOLL,, ll''OOMMII aa iinnssttaauurréé ddeess mmeessuurreess llccuullaatteeuurr ddee ppaarrttiiccuulleess ccoonntteennuueess ddaa ddee rreejjeett àà llaa mmeerr aapprrèèss ddééccaannttaattiioonn nnttiioonn,, aappppeellééeess ssllooppss ;; ccee ccaallccuullaatteeuu aa vvaannnnee ddee rreejjeett àà llaa mmeerr ssii llaa tteenneeuu eeuurree,, aauujjoouurrdd''hhuuii,, àà 1155 ppppmm ((ppaarrttiieess àà cceettttee mmeessuurree ccoommmmee ll''ééllaabboorraattiioonn ffoorrmmeelllleemmeenntt iinntteerrddîîtt ddee rreejjeetteerr lleess uunnee cceerrttaaiinnee ddiissttaannccee ddee llaa ccôôttee,, llaa qq aa ccaarrggaaiissoonn ttoottaallee cchhaarrggéé ddaannss uunn pprr 00 ppaarr llaa ssuuiittee ppoouurr lleess nnaavviirreess ppoosstt MM éé mmaarriittiimmee eett lleess ss,, ll''ééttuuddee ddee llaa eessssaaiirree,, cceett eexxeemmppllee ss ddeerrnniieerrss éévvèènneemmeennttss ddee ll''iinniittiiaattiivvee ddee llaa èèrree ddee lluuttttee ccoonnttrree llaa nnééee ppaarr ll''OOMMII eett ee,, llaa sseeccoonnddee,, llaa pplluuss aauussee dduu mmoonnooppoollee ddee ééccuurriittéé mmaarriittiimmee.. ''EEXXXXOONN VVAALLDDEEZZ :: uuee ddee llaa ccoonncceeppttiioonn rrggaaiissoonn.. CCoonnssiiddéérraanntt ttrree,, llee nnaavviirree nnee ppeeuutt ttss ssttrruuccttuurreelllleess.. PPoouurr ddeess cciitteerrnneess ttee,, uunnee ggrraannddee ppaarrttiiee mmeenntt.. 88 iimmppoossaa lleess nnaavviirreess àà qquueemmeenntt aauu bbaallllaassttaaggee ccoonnssttrruuccttiioonn dduu aa ppoolllluuttiioonn ppoolllluuttiioonn ooppéérraattiioonnnneellllee eennssaabbllee ddee llaavveerr lleess oocchhaaiinn cchhaarrggeemmeenntt oouuiillllééee ppaarr lleess tteecchhnniiqquueess ppoouurr aannss lleess rreejjeettss eesstt nn oobblliiggaattooiirree dd''ooùù uurr ddooiitt iinntteerrddiirree llee uurr dd''hhyyddrrooccaarrbbuurree ddaannss ss ppaarr mmiilllliioonn)).. DDee pplluuss nn ddee zzoonneess ddîîtteess eeaauuxx ddee llaavvaaggee,, llee qquuaannttiittéé rreejjeettéé nnee rreemmiieerr tteemmppss ppoouurr lleess MMAARRPPOOLL..
  • CCoonncceerrnnaanntt llee rriissqquuee ddee vvooiirr llee cchhaarrggeemmeenntt qquuii ddooiitt êêttrree aaggrréééé qquuii ddooiitt ppeerrmmeettttrree aavvaanntt cchhaaqquu dduu nnaavviirree ssooiieenntt iinnfféérriieeuurrss àà ddee ll''ééllaabboorraattiioonn dduu nnaavviirree.. LLeess nnaavv ddee ll''EEttaatt dduu ppaavviilllloonn llee cceerrttiiffiiccaatt CCeess mmeessuurreess ééttaabblliieess lloorrss ddee ccoo ppoouurr bbuutt ddee rréédduuiirree lleess ppoolllluuttiioon pprreessssiioonn ddeess ééttaattss ccôôttiieerrss vviiccttiimm EEnn 11998899,, ll''aacccciiddeenntt ddee ll''EEXXXXOONN dd''ééllaabboorraattiioonn ddeess tteexxtteess eenn mmaat pplluuss llaarrggee,, eenn mmaattiièèrree ddee ssééccuurr ddaannss uunnee rrééggiioonn pprroottééggééee ssuurr llee ééttaattss uunniiss,, aauurraa ccoommmmee eeffffeett nno rreemmeettttrree eenn ccaauussee ssoonn mmoonnooppoo mmaarriittiimmee.. §§33..22 :: AAPPPPAARRIITTIIOONN DDEESS EETTAATTSS DDEE LL''EELLAABBOORRAATTIIOONN DDEESS TTEEXXTTEE AA ppeeiinnee qquueellqquueess mmooiiss aapprrèèss llaa mmaanniièèrree uunniillaattéérraallee iimmppoossaaiieenntt aappppeelléé OOPPAA9900 (( OOiill PPoolllluuttiioonn AAcc PPaarrmmii ccee ttrraaiinn ddee mmeessuurreess,, ssaann ll''oobblliiggaattiioonn ppoouurr ttoouutt ppééttrroolliieerr nn aamméérriiccaaiinn dd''êêttrree ddee ccoonncceeppttiioonn éécchhééaanncciieerr ss''ééttaalloonnnnaanntt jjuussqquu''ee lleess EEttaattss--UUnniiss eesstt tteellllee qquuee cceetttt mmiilliieeuu mmaarriittiimmee eett eenn 11999933 ééttaa MMaarrppooll mmaaiiss aavveecc uunn rreettrraaiitt pprréé LLeess aauuttrreess mmeessuurreess,, iimmppoorrttaannttee mmooiinnss mmééddiiaattiiqquueess,, ssoonntt ll''iinnssttaa oorrggaanniissmmee pprriivvéé ffaaiissaanntt llaa lliiaaiissoo lleess aauuttoorriittééss ffééddéérraalleess,, aappppeelléé QQ mmeessuurreess oonntt uunn ccooûûtt ééccoonnoommiiqqu CC''eesstt aauujjoouurrdd''hhuuii llaa pprreemmiièèrree dd pplluussiieeuurrss rraaiissoonnss :: llaa pprreemmiièèrree eenn pplluuss rreemmiissee eenn qquueessttiioonn,, llaa dd ppoolliittiiqquuee ccoommmmuunnee mmaarriittiimmee,, aa ppééttrroolliieerrss ssiimmpplleess ccooqquueess aallllaanntt ddeess tteennssiioonnss eennttrree ll''OOMMII eett ll''UUEE RReevveennoonnss ssuurr llee pprreemmiieerr ppooiinntt,,l ddéécciissiioonn aa ccoonnttrriibbuuéé àà rréédduuiirree lle ddoouubbllee ccooqquuee sseerrtt ddee bbaallllaasstt ppee ccoonnttaacctt aavveecc llaa ccaarrggaaiissoonn,, mmêêmm ééggaalleemmeenntt cceettttee mmeessuurree eesstt bbéé ppaarr lleess EEttaattss UUnniiss.. EEnn eeffffeett,, llaa ff nnaavviirree ssee rroommpprree,, ll''OOMMII aa iimmppoosséé uu éé ppaarr ddeess sseerrvviicceess tteecchhnniiqquueess (( ssoocciiéé uuee cchhaarrggeemmeenntt ddee vvéérriiffiieerr qquuee lleess eeffff eess lliimmiitteess pprrééaallaabblleemmeenntt ééttaabblliieess ppaarr vviirreess qquuii ssoonntt ccoonnffoorrmmeenntt àà MMAARRPPOOLL tt IIOOPPPP,, iinnddiissppeennssaabbllee àà ttoouuttee nnaavviiggaa oonnvveennttiioonnss iinntteerrnnaattiioonnaalleess ssoouuss ll''ééggii onnss ppaarr hhyyddrrooccaarrbbuurree eett sseeuullee ll''OOMMII,, mmeess ddee ppoolllluuttiioonn,, ééttaaiitt ggéénnéérraattrriiccee dd NN VVAALLDDEEZZ aa mmaarrqquuéé uunn ttoouurrnnaanntt ddaann attiièèrree ddee ppoolllluuttiioonn ppaarr hhyyddrrooccaarrbbuurree rriittéé mmaarriittiimmee.. LLee ccoonntteexxttee,, llaa ppoolllluuttiioo ee ppllaann ddee ll''eennvviirroonnnneemmeenntt,, ssoouuss llaa rr oonn ppaass dd''éébbrraannlleerr ll''ééddiiffiiccee ddee ll''OOMMII mm oollee eenn mmaattiièèrree dd''ééllaabboorraattiioonn ddee rrèèggllee SS--UUNNIISS EETT DDEE LL''UUNNIIOONN EEUURROOPPEEEENNNNEE EESS:: aa ppoolllluuttiioonn ccaauussééee ppaarr ll''EEXXXXOONN VVAALLDD tt,, eenn 11999900,, uunn ttrraaiinn ddee mmeessuurreess iinnttéé cctt )).. nnss ddoouuttee llaa pplluuss iimmppoorrttaannttee ssuurr llee ppllaa nneeuuff ((ss''eenntteenndd aavvaanntt 11999955 )) àà ddeessttiinn ddoouubbllee ccooqquuee,, cceettttee mmeessuurree ééttaanntt aa eenn 22001155.. LL''iimmppoorrttaannccee ddeess éécchhaannggeess ttee mmeessuurree uunniillaattéérraallee ss''eesstt rraappiiddeemmee aaiitt rreepprriissee ppaarr ll''OOMMII aavveecc uunnee mmooddiiffiicc éévvuu jjuussqquu''eenn 22002266.. ee dduu ppooiinntt ddee vvuuee ééccoonnoommiiqquuee ppoouurr aauurraattiioonn dd''uunn ccoonnttrraatt aannnnuueell oobblliiggaattoo oonn aavveecc lleess UUSS CCooaasstt GGuuaarrdd,, lleess mmooyy QQuuaalliiffyy IInnddiivviidduuaall eett uunnee ssoocciiééttéé ddee quuee aannnnuueell iimmppoorrttaanntt.. deess mmeessuurreess cciittééss qquuii eesstt ssoouuss lleess ffeeuu ééttaanntt qquuee cceettttee ssoolluuttiioonn tteecchhnniiqquuee ee ddeeuuxxiièèmmee ppaarrccee qquuee ll''UUnniioonn EEuurrooppééee aa pprriiss ddeess mmeessuurreess ppoouurr aaccccéélléérreerr ll''ee tt aauu--ddeellàà dduu ccaalleennddrriieerr ééllaabboorréé ppaarr ll EE.. llaa ssoolluuttiioonn tteecchhnniiqquuee :: IIll nnee ffaaiitt aauuccu leess ppoolllluuttiioonnss ooppéérraattiioonnnneelllleess ccaarr ll''eess eerrmmaanneenntt aaiinnssii lleess eeaauuxx ddee bbaallllaasstt nnee mmee lleess cciirrccuuiittss ééttaanntt ssééppaarrééss.. SSuurr llee pp éénnééffiiqquuee mmaaiiss ppaass ppoouurr lleess rraaiissoonnss aau fflloottttee eexxiissttaannttee ddee ppééttrroolliieerrss ssiimmpplleess uunn ccaallccuullaatteeuurr ddee ééttéé ddee ccllaassssiiffiiccaattiioonn)) eett ffoorrttss ssuurr llaa ssttrruuccttuurree rr ccaallccuullss lloorrss ddee LL rreeççooiivveenntt ddee llaa ppaarrtt aattiioonn.. iiddee ddee ll''OOMMII aavvaaiitt bbiieenn ssûûrr ssoouuss llaa ddee cceess mmeessuurreess.. nnss llee pprroocceessssuuss eett ddaannss uunn ccoonntteexxttee oonn ééttaanntt ssuurrvveennuuee rreessppoonnssaabbiilliittéé ddeess mmaaiiss ttoouutt aauu mmooiinnss ddee eemmeenntt ddee ssééccuurriittéé EE DDAANNSS LLEE DDOOMMAAIINNEE DDEEZZ,, lleess EEttaattss--UUnniiss ddee ééggrrééeess ddaannss uunn tteexxttee aann ddee llaa ssééccuurriittéé,, eesstt nnaattiioonn dd''uunn ppoorrtt aassssoorrttiiee dd''uunn ss ééccoonnoommiiqquueess aavveecc eenntt iimmppoossééee ddaannss llee ccaattiioonn ddee ll''AAnnnneexx II llee pprrooffeessssiioonnnneell mmaaiiss ooiirree aavveecc uunn yyeennss aannttiippoolllluuttiioonn eett rreemmoorrqquuaaggee.. CCeess uuxx ddee ll''aaccttuuaalliittéé,, ppoouurr eesstt aauujjoouurrdd''hhuuii ddee pplluuss eennnnee,, ddee ppaarrtt ssaa eexxcclluussiioonn ddeess ll''OOMMII,, ccee qquuii aa ccrréééé uunn ddoouuttee qquuee cceettttee ssppaaccee ccrréééé ppaarr llaa ee ssoonntt jjaammaaiiss eenn ppllaann ddeess aacccciiddeennttss uu pprrééaallaabbllee éévvooqquuééeess ss ccooqquueess aavvaanntt cceettttee
  • mmeessuurree ééttaaiitt qquuaassiimmeenntt iinneexxiisstt llaa fflloottttee mmoonnddiiaallee ;; ccee qquuii eesstt rre ccooqquuee eenn ccaass dd''éécchhoouueemmeenntt eett cceerrttaaiinn qquuee llaa ddoouubbllee ccooqquuee nnee vviitteessssee dd''eennvviirroonn 44--55 nnooeeuuddss,, ppoouuvvaanntt mmêêmmee rreennddrree uunn mmééllaannggee ggaazz dd''hhyyddrrooccaarrbbuurree DDee pplluuss ll''aattmmoosspphhèèrree ddee ll''eessppaacc eett ddoonncc ddéébbaallllaassttéé,, ccoommppoosséé dd'' ccoorrrroossiivvee ppoouurr lleess mmaattéérriiaauuxx,, llaa eesstt ll''eeffffiiccaacciittéé ddee ccee ssyyssttèèmmee ddaa eexxppllooiitteenntt mmêêmmee eennccoorree aauujjoouurr mmaaiinntteennaannccee aaddééqquuaattee ppeerrmmeetttt AA ll''ééppooqquuee ddee ll''aappppaarriittiioonn ddee ll''OO ccoonnssttrruuiissaaiitt uunn ppééttrroolliieerr qquuii ddee dd''éécchhoouueemmeenntt oouu ddee ccoolllliissiioonn àà ppoouurr EEnnvviirroonnnneemmeenntt EEccoonnoommiiqquu ssttaattiiqquueess.. MMaallhheeuurreeuusseemmeenntt ccee ttaannkkeerrss aa ééttéé ccoonnssttrruuiitt eett nnaavviigg TTaanntt eett ssii bbiieenn qquuee sseeuull llee ssyyssttèè ddeess EEttaattss UUnniiss eett iinnéévviittaabblleemmeenn pprrootteessttéé ppoouurr ddéénnoonncceerr ll''iinnggéérree mmeessuurreess iimmppoossééeess ppaarr ll''UUnniioonn EE ((IIll eesstt bboonn ddee nnootteerr qquuee ssii ddaannss rreetteennuuee,, llaa ccoonnvveennttiioonn MMAARRPPOOLL ééqquuiivvaalleenntt eenn mmaattiièèrree ddee rréétteenn EEnn eeffffeett jjuussqquu''àà llaa ccaattaassttrroopphhee éécchhééaanncciieerr ddee rreettrraaiitt ddeess nnaavviirree pprrooppoossiittiioonnss ddeess EEttaattss UUnniiss eenn l SSuuiittee aauu nnaauuffrraaggee ddee ll''EERRIIKKAA,, lla ddoonntt ll''uunnee eesstt uunn rrèègglleemmeenntt pprréé ppééttrroolliieerrss ssiimmppllee ccooqquuee((((((((2222222255555555)))))))) eett d ccllaassssiiffiiccaattiioonn ((((((((2222222266666666)))))))) eett llee ccoonnttrrôôllee ((((((((2222222255555555)))))))) :::::::: RRèègglleemmeenntt ((CCEE)) nn°°441177//22 ((((((((2222222266666666)))))))) :::::::: DDiirreeccttiivvee 22000011//110055//CCEE dd 22000011 mmooddiiffiiaanntt llaa ddiirreeccttiivvee 9944// ((((((((2222222277777777)))))))) :::::::: DDiirreeccttiivvee 22000011//110066//CCEE dd 22000011 mmooddiiffiiaanntt llaa ddiirreeccttiivvee 9955// LLee rrèègglleemmeenntt aa ffaaiitt ll''oobbjjeett dd''uunnee ll''OOMMII eenn aavvrriill 22000011 ooùù llaa ppoossiittiioo ttaannttee,, cceettttee mmeessuurree aa ddoonncc ppeerrmmiiss uu reemmiiss eenn qquueessttiioonn aauujjoouurrdd''hhuuii eesstt ll''ee ssaa qquuaalliittéé ssttrruuccttuurreellllee ddaannss llee tteemmpps ppuuiissssee rrééssiisstteerr àà uunnee ccoolllliissiioonn oouu uunn e eexxpplloossiiff ll''aattmmoosspphhèèrree dduu bbaallllaasstt qquui ee // aaiirr.. ccee qquuii sseerrtt ddoonncc ddee bbaallllaasstt eesstt,, uunnee f ''aaiirr ssuurr uunn eennvviirroonnnneemmeenntt ssaalliinn ccee qqu aa qquueessttiioonn aaiinnssii ppoossééee aauujjoouurrdd''hhuuii pp aannss llee tteemmppss ssii lleess mmêêmmeess aarrmmaatteeuurr rrdd''hhuuii ddeess ssiimmpplleess ccooqquueess,, nn''eeffffeeccttuuee ttaanntt ddee mmaaiinntteenniirr llaa ccooqquuee eenn bboonn éét OOPPAA,, uunn cchhaannttiieerr eeuurrooppééeenn ((lleess cchhaann ppaarrtt ssaa ccoonncceeppttiioonn lliimmiittaaiitt lleess ppoolllluutt vviitteessssee iimmppoorrttaannttee.. LL'' EEEEEE ((tteell ééttaaiitt uuee EEuurrooppééeenn)) ééttaaiitt bbaasséé ssuurr llee pprriinncc ee ssyyssttèèmmee nn''ééttaanntt ppaass rreetteennuu ppaarr lleess gguuee eennccoorree.. èèmmee ddoouubbllee ccooqquuee aa ééttéé iinnssttaauurréé ttoouu nntt ppaarr ll''OOMMII,, OOMMII qquuii àà ll''ééppooqquuee nn''aa eennccee ddeess EE..UU qquu''eellllee nnee llee ffaaiitt aauujjoouurr EEuurrooppééeennnnee.. ss llee ccaaddrree ddee ll''OOPPAA sseeuullee ll''ooppttiioonn ddoouu LL aa rreetteennuuee llaa ddoouubbllee ccooqquuee oouu ttoouutt nnttiioonn ddee ppoolllluuttiioonn..)) ddee ll''EERRIIKKAA lleess cchhoosseess ééttaaiieenntt aaiinnssii ii eess ssiimmpplleess ccooqquueess aavvaaiitt ééttéé ééttaabbllii ppaa llaa qquueessttiioonn.. laa CCoommmmiissssiioonn EEuurrooppééeennnnee aa pprriiss uunn éévvooyyaanntt uunnee aaccccéélléérraattiioonn dduu ccaalleennddrr ddeeuuxx ddiirreeccttiivveess ccoonncceerrnnaanntt llee ccoonnttrrôô ee ppaarr ll''EEttaatt dduu ppoorrtt ((((((((2222222277777777)))))))).. 22000022 dduu PPaarrlleemmeenntt eeuurrooppééeenn eett dduu CCoonnsseeii //5577//CCEE dduu CCoonnsseeiill.. dduu PPaarrlleemmeenntt eeuurrooppééeenn eett dduu CCoonnsseeii //2211//CCEE dduu CCoonnsseeiill.. ee aapppprroocchhee eeuurrooppééeennnnee ccoommmmuunnee qq oonn ccoommmmuunnaauuttaaiirree aa ééttéé llaarrggeemmeenntt uunn rraajjeeuunniisssseemmeenntt ddee eeffffiiccaacciittéé ddee llaa ddoouubbllee ss ;; eenn eeffffeett iill eesstt nn éécchhoouueemmeenntt àà uunnee ii ddeevviieenntt ddaannss ccee ccaass ffooiiss llee nnaavviirree cchhaarrggéé uuii llaa rreenndd ttrrèèss ppaarr lleess pprrooffeessssiioonnnneellss rrss ddoouutteeuuxx,, qquuii eenntt ppaass llaa éttaatt.. nnttiieerrss ddee ll''AAttllaannttiiqquuee)) ttiioonnss mmêêmmee eenn ccaass tt llee nnoomm dduu pprroojjeett cciippee ddeess ééqquuiilliibbrreess ss EE..UU,, uunn sseeuull ddee cceess uutt dd''aabboorrdd ppaarr llee bbiiaaiiss ppaass ssii oouuvveerrtteemmeenntt rrdd''hhuuii ppoouurr lleess uubbllee ccooqquuee aa ééttéé aauuttrree ssyyssttèèmmee iinnssttaauurrééeess :: uunn aarr ll''OOMMII rreepprreennaanntt lleess nnee sséérriiee ddee mmeessuurreess rriieerr dd''éélliimmiinnaattiioonn ddeess ôôllee ddeess ssoocciiééttééss ddee iill dduu 1199 ddéécceemmbbrree iill dduu 1199 ddéécceemmbbrree qquuii aa aabboouuttii aauu sseeiinn ddee rreetteennuuee..
  • CCee rrèègglleemmeenntt eesstt eennttrréé eenn vviigguu ssiimmpplleess ccooqquueess ppoouurr 22001155 aauu llii MMaallhheeuurreeuusseemmeenntt,, ssaannss rreevveenniirr ddee llaa CCoommmmuunnaauuttéé EEuurrooppééeennnnee ssuuffffiissaammmmeenntt lloonngg ppoouurr qquuee llaa ccaattaassttrroopphhee,, MMmmee LLooyyoollaa ddee PPaa ddééccllaarréé qquuee ssii lleess mmeessuurreess eennvvii ddiissccuussssiioonnss ddee llaa ppoossiittiioonn ccoommmm PPRREESSTTIIGGEE nn''aauurraaiitt ppaass nnaavviigguuéé vviieeuuxx bbaatteeaauuxx ((2266 aannss,, ssiimmppllee éélliimmiinneerr ssii llaa pplluuppaarrtt ddeess EEttaattss iimmmmééddiiaatteemmeenntt cceess mmeessuurreess aavv ppeennddaanntt llee ssoommmmeett ddee NNIICCEE ((((((((22222222 AA nnoouuvveeaauu llee 2277 MMaarrss 22000033 lleess BBrruuxxeellllee eett oonntt ddééggaaggéé uunn aaccccoo ddaattee bbuuttooiirr ddee 22001155 àà 22001100 )) dd aapppplliiccaabbllee ddèèss jjuuiilllleett 22000033 ;; ll''oonn eeuurrooppééeenn.. CCeess nnoouuvveelllleess rrèègglleess ss''aapppplliiqquuee aauussssii aauuxx ppaavviilllloonnss ééttrraannggeerrss àà jjuurriiddiiccttiioonn dd''uunn EEttaatt mmeemmbbrree.. BB eessttiimméé qquuee cceettttee ddiissppoossiittiioonn nn''éé ppeerrmmeett aauuxx EEttaattss dd''iimmppoosseerr ddeess iinntteerrnnaattiioonnaall ppoouurr ddeess rraaiissoonnss dd ccoonnttrraaiirree aauu ddrrooiitt iinntteerrnnaattiioonnaall PPaarrlleemmeenntt EEuurrooppééeenn ssuurr llaa ccaattaa LL''OOMMII nnee vvooiitt ppaass dd''uunn ooeeiill ffaavvoo llaa ssoorrttee ,, mmêêmmee ssii ssaa llééggiittiimmiittéé ll''EEuurrooppee,, eett ss''aappppuuii ((((((((2222222288888888)))))))) :::::::: pprrooppooss ddee JJ..CC.. GGaayyssssoott :: mmaaiinntteennaanntt ssuurr llaa pprrééssiiddeennccee EE mmaaiinnttiieenn ddeess pprréérrooggaattiivveess ddee ll''O LLee ccaass ddeess EEttaattss--UUnniiss aavveecc ll''OOPP ss''aaggiissssaaiitt aalloorrss mmêêmmee ppaass dd''uunnee ssoouuvveerraaiinnss mmaaiiss bbeell eett bbiieenn dd''uu LLeess EEttaattss mmeemmbbrreess eett llaa ccoommmm ccaalleennddrriieerr aauu nniivveeaauu ddee ll''OOrrggaann mmoonnddiiaallee.. DDaannss cceett eexxeemmppllee nnoouuss aavvoonnss vv dduu rreettrraaiitt ddeess nnaavviirreess ppééttrroolliieerrss EEttaattss--UUnniiss,, ssuuiivvii ppaarr llee nniivveeaauu ii MMAARRPPOOLL lleess ddiissppoossiittiioonnss ddee ll''OOPP ccooqquuee,, ppuuiiss llee nniivveeaauu EEuurrooppééeenn ddeess ddiissppoossiittiioonnss qquuii lluuii ssoonntt pprroo uueeuurr llee 2277 MMaarrss 22000022 eett pprréévvooiitt uunn rree iieeuu ddee 22002266 ppoouurr llee ccaalleennddrriieerr ddee ll''OO rr ssuurr ll''ééttuuddee rrééaalliissééee ddaannss llee cchhaappiittrr ee,, eennttrree llaa vvoolloonnttéé eett llaa rrééaalliissaattiioonn ,, ccaattaassttrroopphhee dduu PPRREESSTTIIGGEE ssuurrvviieennnnee aallllaacccciioo,, llaa ccoommmmiissssaaiirree aauuxx TTrraannssppoo iissaaggééeess ppaarr llaa ccoommmmiissssiioonn eeuurrooppééeenn mmuunnee ééttaaiieenntt aapppplliiccaabblleess aauu jjoouurr ddee éé eett ll''aacccciiddeenntt nn''aauurraaiitt ppuu ssuurrvveenniirr.. DD ccooqquuee)),, llee PPrreessttiiggee eennttrraaiitt ddaannss llee cch aavvaaiieenntt tteennuu lleeuurr eennggaaggeemmeenntt dd''aapppp vvaanntt llaa ttrraannssppoossiittiioonn ddeess ddiirreeccttiivveess,, 2222222288888888)))))))).. s mmiinniissttrreess ddeess TTrraannssppoorrttss ddee ll''UUEE ssee oorrdd ppoolliittiiqquuee ssuurr uunn ccaalleennddrriieerr aaccccéélléé ddee rreettrraaiitt ddeess ppééttrroolliieerrss àà ssiimmppllee ccooqq nn vvooiitt iiccii llee ssoouucciiss dd''iinntteerrvveenniirr ttrrèèss rr eerroonntt nnoonn sseeuulleemmeenntt àà ttoouuss lleess ppaavviillll àà ddeessttiinnaattiioonn dd''uunn ppoorrtt oouu mmoouuiillllaaggee BBiieenn qquuee lleess sseerrvviicceess jjuurriiddiiqquueess dduu CC ééttaaiitt ppaass ccoonnttrraaiirree aauu ddrrooiitt iinntteerrnnaattiioo ss nnoorrmmeess pplluuss ssttrriicctteess qquuee cceelllleess eenn ddee ssééccuurriittéé mmaarriittiimmee,, uunn eexxppeerrtt ddee ll eenn mmeerr cceettttee mmeessuurree,, lloorrss ddee llaa ddeerr aassttrroopphhee dduu PPrreessttiiggee.. oorraabbllee qquuee ll''UUnniioonn EEuurrooppééeennnnee pprreennnn éé nnee ffaaiitt pplluuss aauuccuunn ddoouuttee ppoouurr llaa zzoo :: LL''HHuummaanniittéé dduu 2211 NNoovv 22000022 .. EEuurrooppééeennnnee ddee llaa GGrrèèccee qquuii eesstt pplluuttôô 'OOMMII .. PPAA ééttaaiitt aalloorrss eennccoorree pplluuss oouuttrraaggeeaanntt ee ppoossiittiioonn ccoommmmuunnee dd''uunn rreeggrroouuppeemm uunnee ddéécciissiioonn uunniillaattéérraallee.. mmiissssiioonn tteenntteenntt mmaaiinntteennaanntt ddee ffaaiirree aa nniissaattiioonn MMaarriittiimmee IInntteerrnnaattiioonnaallee ppoouurr vvuu qquuee ttrrooiiss nniivveeaauuxx ssoonntt ddééjjàà iinntteerrvv ss ssiimmppllee ccooqquuee,, ttoouutt dd''aabboorrdd llee nniivveeaa iinntteerrnnaattiioonnaall mmoonnddiiaall aavveecc ll''OOMMII qquuii PPAA9900 eenn mmaattiièèrree ddee ccaalleennddrriieerr ddee rree nn qquuii lluuii tteennttee dd''aaccccéélléérreerr ccee rreettrraaiitt ee oopprreess.. eettrraaiitt ddeess ppééttrroolliieerrss OOMMII.. rree ccoonnssaaccrréé àà ll''aaccttiioonn llee ddééllaaii eesstt ee.. AA llaa ssuuiittee ddee cceettttee oorrttss eett àà ll''EEnneerrggiiee,, aa nnnnee aavvaanntt lleess ll''aacccciiddeenntt,, llee DDee pplluuss eenn ttaanntt qquuee chhaammpp ddeess nnaavviirreess àà pplliiqquueerr eennggaaggeemmeenntt oobbtteennuu ee ssoonntt rrééuunniiss àà éérréé ((aavvaanncceemmeenntt ddee llaa qquuee qquuii ddeevvrraaiitt êêttrree rraappiiddeemmeenntt aauu nniivveeaauu lloonnss EEuurrooppééeennss mmaaiiss rreelleevvaanntt ddee llaa CCoonnsseeiill EEuurrooppééeenn aa oonnaall ddee llaa mmeerr,, qquuii vviigguueeuurr aauu nniivveeaauu ll''OOMMII aa eessttiimméé rrnniièèrree aauuddiittiioonn dduu nneenntt ddeess iinniittiiaattiivveess ddee onnee ggééooggrraapphhiiqquuee ddee ôôtt ffaavvoorraabbllee aauu tt ppoouurr ll''OOMMII ccaarr iill nnee mmeenntt dd''ééttaattss aaddoopptteerr ccee nnoouuvveeaauu rr uunnee aapppplliiccaattiioonn vveennuu ddaannss llee ddoossssiieerr aauu nnaattiioonnaall aavveecc lleess ii aa rreepprriiss ddaannss eettrraaiitt ddeess ssiimmppllee eenn eessssaayyaanntt dd''iimmppoosseerr
  • DDaannss cceettttee pprreemmiièèrree sseeccttiioonn nnoo rréégglleemmeennttaattiioonn ddee llaa ssééccuurriittéé mm eenn llaa mmaattiièèrree ccoonncceerrnnee llee rreessppee ddééffiicciieenncceess ppoouurrrroonntt êêttrree ddéénnoonn SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: DDDDDDDDOOOOOOOOMMMMMMMMAAAAAAAAIIIIIIII RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN AAvvaanntt dd''ééttuuddiieerr qquueellss ssoonntt lleess dd rreessppeecctt ddee llaa rréégglleemmeennttaattiioonn,, iill ffaacctteeuurrss qquuii ccoommppoosseenntt llaa ssééccuu SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS--------SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS TTTTTTTTEEEEEEEEXXXXXXXX DDee ll''aannttiiqquuiittéé jjuussqquu''aauu XXXXèèmmee s ssaauuvveeggaarrddee ddee llaa mmaarrcchhaannddiissee ffaavvoorriissaanntt llee ssuurrttoouutt eenn mmaattiièèrree ddee ffrraanncc bboorr aaiinnssii qquuee dduu ssyyssttèèmmee dd''aassssuurraann mmaattiièèrree ddee ssééccuurriittéé mmaarriittiimmee aa ll''aassppeecctt eennvviirroonnnneemmeennttaall nnee ddee CCoommmmee nnoouuss ll''aavvoonnss vvuu pprrééccéédd iimmppoorrttaanntt ddaannss ll''aamméélliioorraattiioonn dd qquueellss oonntt ééttéé lleess ffaacctteeuurrss aaccccaabb ppoouuvvoonnss éénnuumméérreerr :: LLee ffaacctteeuurr ddee ssééccuurriittéé mmaarriittiimmee ssaannss aabboorr NNoouuss aalllloonnss ddoonncc ééttuuddiieerr rraappiiddee hhuummaaiinn,, llee ffaacctteeuurr tteecchhnniiqquuee aaii aappppoorrtteenntt uunnee rrééeellllee aamméélliioorraattii aapppplliiqquuééss ddee mmaanniièèrree ccoorrrreeccttee.. CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRR :::::::: LLLLLLLLEEEEEEEE FFFFFFFFAAAAAAAACCCCCCCCTTTTTTTTEEEEEEEE LL''eerrrreeuurr hhuummaaiinnee,, «« llaa mmaauuvvaaiiss mmaarriittiimmeess,, ccee ffûûtt llee ccaass ppaarr eexxee dduu SSCCAANNDDIINNAAVVIIAANN SSTTAARR,, dduu BB hhuummaaiinn aa uunn rrôôllee ddéétteerrmmiinnaanntt dd mmeenneerr..((((((((2222222299999999)))))))) CC''eesstt ddoonncc uunn ddoommaaiinnee iimmppoorrttaa aannnnééeess 11996600 aavveecc lleess ttrraavvaauuxx cc ssuurr llaa CCoonnvveennttiioonn iinntteerrnnaattiioonnaallee ppoouurr ccoommbblleerr llaa ddéérriivvee ddeess mmaarr nnaavviirreess,, ppeeuutt êêttrree ssuuiittee àà llaa ccoouu ppaavviilllloonnss ddee ccoommppllaaiissaannccee ppoouuvv mmaallhheeuurreeuusseemmeenntt ééggaalleemmeenntt àà oouuss aavvoonnss ééttuuddiiéé ccee qquuii ssee ppaassssee eenn mmaarriittiimmee,, mmaaiiss uunn aauuttrree aassppeecctt qquuii jjo eecctt ddee cceettttee rréégglleemmeennttaattiioonn eett llàà eenncc nnccééss.. IIIIIIIINNNNNNNNEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS TTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEESSSSSSSS EEEEEEEETTTTTTTT RRRRRRRREEEEEEEESSSSSSSS ddiifffféérreennttss aacctteeuurrss qquuii ddooiivveenntt jjoouueerr uu ll eesstt iimmppoorrttaanntt ttoouutt dd''aabboorrdd dd''aannaallyyss uurriittéé mmaarriittiimmee.. XXXXXXXXTTTTTTTTEEEEEEEESSSSSSSS EEEEEEEEXXXXXXXXIIIIIIIISSSSSSSSTTTTTTTTAAAAAAAANNNNNNNNTTTTTTTTSSSSSSSS EEEEEEEETTTTTTTT LLLLLLLLEEEEEEEEUUUUUUUURRRRRRRR DDDDDDDDOOOOOOOOMMMMMMMMAAAAAAAA ssiièèccllee,, llaa pprreemmiièèrree ddeess pprrééooccccuuppaattiioo ee ddéévveellooppppeemmeenntt ddee cceerrttaaiinneess rréégglleemm rrdd eett ll''aappppaarriittiioonn ddeess pprreemmiièèrreess ssooccii nnccee mmaaiiss llee pprreemmiieerr vvéérriittaabbllee eennjjeeuuxx a ééttéé llaa ssaauuvveeggaarrddee ddee llaa vviiee hhuummaaiinn eevviieennnnee llaa pprrééooccccuuppaattiioonn pprreemmiièèrree dd ddeemmmmeenntt lleess eennqquuêêtteess aacccciiddeennttss oonntt ddee llaa ssééccuurriittéé mmaarriittiimmee eett nnoottaammmmeenn bbllaannttss ddeess aacccciiddeennttss mmaarriittiimmeess,, ffaaccttee rr tteecchhnniiqquuee eett llee ffaacctteeuurr hhuummaaiinn.. NNoou rrddeerr lleess ccaauusseess ddee ll''iinnssééccuurriittéé mmaarriittiimm eemmeenntt cceess ddiifffféérreennttss ddoommaaiinneess qquuee ss iinnssii qquuee lleess rrèègglleemmeennttss qquuii ss''yy rraappppoo iioonn ddee llaa ssiittuuaattiioonn àà ppaarrttiirr dduu mmoommeen .. EEEEEEEEUUUUUUUURRRRRRRR HHHHHHHHUUUUUUUUMMMMMMMMAAAAAAAAIIIIIIIINNNNNNNN ssee mmaannooeeuuvvrree »» eesstt llaa ccaauussee ddee 7755%% eemmppllee ddee ll''HHeerraalldd ooff FFrreeee EEnntteerrpprriissee, BBRRAAEERR eennttrree aauuttrreess,, eett ddaannss bbiieenn dd''aa ddaannss llaa ggeessttiioonn ddee llaa ccrriissee eett ddaannss llee aanntt qquuii nn''aa ééttéé pprriiss eenn ccoommppttee qquuee ttaa ccoommmmuunnss àà ll''OOIITT eett àà ll''OOMMII qquuii oonntt dd ee SSTTCCWW((((((((3333333300000000)))))))) .. CCeettttee ccoonnvveennttiioonn aa éétt rriinnss ssoouuss qquuaalliiffiiééss ddee pplluuss eenn pplluuss nnoo uurrssee àà ll''ééccoonnoommiiee eeffffrréénnééee ddeess aarrmmaa vvaaiieenntt aarrmmeerr lleeuurr nnaavviirree ddee mmaarriinnss àà àà ccoommppéétteennccee lliimmiittééee vvooiirree nnuullllee.. aammoonntt ddee llaa joouuee uunn rrôôllee iimmppoorrttaanntt ccoorree ddee nnoommbbrreeuusseess SSSSSSSSPPPPPPPPEEEEEEEECCCCCCCCTTTTTTTT DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA uunn rrôôllee ddaannss llee sseerr qquueellss ssoonntt lleess AAAAAAAAIIIIIIIINNNNNNNNEEEEEEEE oonnss aa ééttéé cceellllee ddee llaa mmeennttaattiioonnss llooccaalleess iiééttééss ddee ccllaassssiiffiiccaattiioonn xx dduu ccaaddrree nnoorrmmaattiiff eenn nnee eenn mmeerr aavvaanntt qquuee ddeess ddeerrnniièèrreess aannnnééeess.. tt jjoouuéé uunn rrôôllee nntt eenn ddéétteerrmmiinnaanntt eeuurrss qquuee nnoouuss ouuss nnee ppoouuvvoonnss ppaarrlleerr mmee.. ssoonntt llee ffaacctteeuurr oorrtteenntt eett qquuii enntt ooùù iillss ssoonntt %% ddeess aacccciiddeennttss e,, ddee ll''EEXXXXOONN VVAALLDDEEZZ,, aauuttrreess ccaass llee ffaacctteeuurr eess aaccttiioonnss àà aarrddiivveemmeenntt,, ddaannss lleess ddéébboouucchhéé,, eenn 11997788,, téé rreenndduuee nnéécceessssaaiirree oommbbrreeuuxx àà bboorrdd ddeess aatteeuurrss qquuii ggrrââccee aauuxx àà ffaaiibbllee ccooûûtt mmaaiiss
  • ((((((((2222222299999999)))))))) :::::::: VVooiirr eenn ccee sseennss llee mméémmoo IISSMM ccooddee ppaarr lleess ccoommppaaggnniieess mm ((((((((3333333300000000)))))))) :::::::: SSttaannddaarrddss ooff TTrraaiinniinngg,, CC CCeerrttaaiinnss mmaarriinnss iinnddiieennss nn''aavvaaiiee ffooiiss,, iill ppoouuvvaaiitt êêttrree bbeerrggeerr oouu mm mmooyyeenn dd''eessssaayyeerr ddee ssoorrttiirr dd''uunn LLeess ééttuuddeess dd''ooffffiicciieerrss ddaannss lleess pp ddaannss cceerrttaaiinnss ppaayyss llee bbrreevveett ss''aa ssaannss ccoonnnnaaiissssaannccee ppaarrttiiccuulliièèrree.. CCeettttee pprreemmiièèrree ccoonnvveennttiioonn aa ddoo bbrreevveettss ddéélliivvrrééss ddaannss lleess ddiifffféérree ccoonnddiittiioonnss ddee ddéélliivvrraannccee ddeess bbrr ll''oobbjjeeccttiiff ddee SSTTCCWW 7788 nnee ffûûtt qquu IIll yy eeuu ddoonncc lliieeuu eenn 11999955,, uunnee rr lleess mmoodduulleess qquuee ddeevvaaiieenntt ccoonnttee rreeccoonnnnuu ssuurr llee ppllaann iinntteerrnnaattiioonnaa pprrooggrrèèss tteecchhnnoollooggiiqquueess eennrreeggiiss LL''iinnfflluueennccee dduu ffaacctteeuurr hhuummaaiinn pp lluuii--mmêêmmee mmaaiiss ééggaalleemmeenntt ddaannss llee mmaannaaggeemmeenntt qquu''iill ssooiitt tteecchhnni CCee ddoommaaiinnee eesstt ddééssoorrmmaaiiss ccoouuvv 11999933.. UUnn aauuttrree ffaacctteeuurr hhuummaaiinn cclleeff ppaa ccoommppoossiittiioonn ddee ll''ééqquuiippaaggee eett ddee ccoonnttrrôôlléé ppaarr ll''EEttaatt dduu ppaavviilllloonn :: iinntteerrnnaattiioonnaalleess.. IIllss oonntt ééttéé aalllléégg nnoouuvveeaauuxx mmooyyeennss ddee nnaavviiggaattiioo LL''eennqquuêêttee qquuii aa ssuuiivvii ll''aacccciiddeenntt MMoollèènnee,, aa ddéémmoonnttrréé qquuee ll''ooffffiicciie hheeuurreess eenn 2244 hheeuurreess ppaarr mmaannqqu mmeemmbbrreess dd''ééqquuiippaaggeess,, oonn ppeeuutt ((((((((3333333311111111)))))))) :::::::: IInntteerrnnaattiioonnaall SSaaffeettyy MMaann UUnnee ccoonnvveennttiioonn rrééggiitt ccee ddoommaaiinn ll''oorrggaanniissaattiioonn dduu tteemmppss ddee ttrraavv lliimmiitteess ddee ttrraavvaaiill eett ddee rreeppooss,, cc ll''iinnttééggrreerr eenn ddrrooiitt ccoommmmuunnaauuttaa LLee ccooddee IISSMM eett llaa ccoonnvveennttiioonn SS ccoonnvveennttiioonnss qquuii oonntt ffaaiitt éévvoolluueerr llaa qquuaalliittéé ddeess ééqquuiippaaggeess eett ddeess ooiirree ddee MMrr SSAALLEEAA OOUUAADDJJ iinnttiittuulléé ::»»LLaa mmaarriittiimmeess»» CCDDMMTT,,11999999 pp2288 CCeerrttiiffiiccaattiioonn aanndd WWaattcchhkkeeeeppiinngg ffoorr ssee eenntt jjaammaaiiss vvuu llaa mmeerr aavvaanntt dd''eemmbbaarrqq mmeennddiiaanntt,, llaa nnaavviiggaattiioonn mmaarriittiimmee ééttaa nee ssiittuuaattiioonn ééccoonnoommiiqquuee ssaannss lleennddeemm ppaayyss iinndduussttrriiaalliissééss pprreennnneenntt aauu mmiinnii aacchhèèttee eett oouuvvrree ddoonncc llaa ppoorrttee ddee llaa pp .. oonncc ééttéé uuttiillee ppoouurr ééttaabblliirr uunnee hhaarrmmoo eennttss ééttaattss dduu ppaavviilllloonn .. CCeeppeennddaanntt ss rreevveettss eett ssaannss ééqquuiivvaalleennccee ccoommmmuunnee uuee ttrrèèss ppeeuu aatttteeiinntt.. rréévviissiioonn ddee SSTTCCWW qquuii aa ééttaabbllii ccllaaiirreemm eenniirr cchhaaqquuee bbrreevveett oouu ccoommpplléémmeenntt dd aall.. CCeettttee ccoonnvveennttiioonn aa ééggaalleemmeenntt pprr ssttrrééss ddaannss llee ddoommaaiinnee ddee llaa nnaavviiggaattiioo ppeeuutt ssee ttrraadduuiirree nnoonn sseeuulleemmeenntt ddaannss ss ll''iinntteerrffaaccee eennttrree llaa tteerrrree eett llee nnaavviirr iiqquuee oouu hhuummaaiinn.. vveerrtt ppaarr llee ccooddee IISSMM (((((((( 3333333311111111)))))))) aaddooppttéé ppaa aarrttiicciippaanntt àà llaa ssééccuurriittéé mmaarriittiimmee eesstt ee sseess ccoonnddiittiioonnss ddee ttrraavvaaiill,, ddoommaaiinnee :: LLeess eeffffeeccttiiffss ssoonntt lliiééss àà ddeess rrèègglleess pp ggééss,, ccoommppttee tteennuu ddeess pprrooggrrèèss tteecchhnn oonn ddoonntt ddiissppoosseenntt ddééssoorrmmaaiiss lleess bbaattee dduu MMeellbbrriiddggee BBiillbbaaoo,, nnaavviirree éécchhoouuéé eerr ééttaaiitt sseeuull àà llaa ppaasssseerreellllee aapprrèèss aavv uuee dd''eeffffeeccttiiff.. AAiinnssii àà rréédduuiirree eexxcceessssiivv tt ssee rreettrroouuvveerr ddeevvaanntt ddeess pprroobbllèèmmeess nnaaggeemmeenntt nnee,, iill ss''aaggiitt ddee llaa ccoonnvveennttiioonn ddee ll''OOIITT vvaaiill ddeess ggeennss ddee mmeerr ((((((((3333333333333333)))))))) qquuii iinnssttiittuu ccoonnvveennttiioonn rreepprriissee ppaarr llaa ddiirreeccttiivvee eeuu aaiirree.. SSTTCCWW 9955 ssoonntt ddoonncc aaccttuueelllleemmeenntt lleess rr llee sseecctteeuurr ddee llaa ssééccuurriittéé mmaarriittiimmee ss ggeessttiioonnnnaaiirreess ddeess aarrmmeemmeennttss mmaarriitt aa mmiissee eenn ooeeuuvvrree dduu eeaaffeerreerrss.. qquueerr ppoouurr llaa pprreemmiièèrree aanntt uunn ffoorrmmiiddaabbllee mmaaiinn.. iimmuumm 33 aannss aalloorrss qquuee pprrooffeessssiioonn ddee mmaarriinn oonniissaattiioonn ddeess ddiifffféérreennttss ssaannss ccoonnttrrôôllee ddeess ee ddeess bbrreevveettss,, mmeenntt lleess ccoonnddiittiioonnss eett ddee ffoorrmmaattiioonn ppoouurr êêttrree rriiss eenn ccoommppttee lleess oonn mmaarriittiimmee.. ss llaa ccoonndduuiittee dduu nnaavviirree rree ,, ccee qquu''oonn aappppeelllleerraa aarr ll''OOMMII eenn nnoovveemmbbrree cceelluuii ddee llaa ee eesssseennttiieelllleemmeenntt ppoouurr ppaarrttiiee nniiqquueess eett ddeess eeaauuxx.. ssuurr lleess ccôôtteess ddee vvooiirr ddoorrmmii qquuee 22 vveemmeenntt llee nnoommbbrree ddee ss mmaajjeeuurrss ddee ssééccuurriittéé.. TT (((((((( 3333333322222222)))))))) ssuurr uee,, eennttrree aauuttrreess,, ddeess uurrooppééeennnnee 9999//6633 ppoouurr 22 ggrraannddeess eenn ffaaiissaanntt aaccttiioonn ssuurr ttiimmeess..
  • LLee pprrooggrrèèss aappppoorrttéé ppaarr cceess rrèèggl ss''iimmppoosseenntt àà ttoouuss,, iillss vviisseenntt àà cc ss''ooppèèrree ppaass aauu ddééttrriimmeenntt ddee llaa AAffiinn ddee ss''aassssuurreerr qquuee ccee jjeeuu ddee lliissttee »» ddeess EEttaattss ddéélliivvrraanntt ddeess bb 110033 ddeess 118822 ééttaattss ssiiggnnaattaaiirreess ff LL''UUnniioonn eeuurrooppééeennnnee aa rréécceemmmmee nnoouuss aavvoonnss bbeessooiinn ddee rreessssoouurrccee qquuii ppeeuuvveenntt ccoonnttrriibbuueerr àà llaa sséécc pprroottééggeerr ll''eennvviirroonnnneemmeenntt »» aa dd AAnnoommeerriittiiss ,, ddoonntt llee ppaayyss pprrééssiidd LLee ddeeuuxxiièèmmee ffaacctteeuurr ddééggaaggéé qquu eesstt llee ffaacctteeuurr tteecchhnniiqquuee,, ffaacctteeuu ((((((((3333333322222222)))))))) :::::::: LL''OOIITT (( OOrrggaanniissaattiioonn IInnttee aauuxx ccoonnddiittiioonnss ddee vviiee ddeess ggeennss ééllaabboorréé 3366 ccoonnvveennttiioonnss eett 2277 rree ((((((((3333333333333333)))))))) :::::::: CC118800 CCoonnvveennttiioonn ssuurr llaa dd nnaavviirreess,, 11999966 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCOOOOOOOONNNNNNNNDDDDDDDD :::::::: LLLLLLLLEEEEEEEE FFFFFFFFAAAAAAAACCCCCCCCTTTTTTTTEEEEEEEE IIll ss''aaggiitt bbiieenn ssûûrr dduu ffaacctteeuurr qquuii vvéérriiffiiéé,, iill ss''aaggiitt dd''aaiilllleeuurrss dduu sseecc rréégglleemmeennttaattiioonnss ss''yy rreeppoorrttaanntt àà aauuxx ssoolluuttiioonnss tteecchhnniiqquueess qquuii oonn ppeeuuvveenntt aavvooiirr llaa qquuaalliittéé ddeess cclloo cciirrccuuiittss vveennttiillaattiioonnss eett eennccoorree bb LLaa ppaarrttiiee tteecchhnniiqquuee ddee llaa ccoonnvvee ssppéécciiffiiccaattiioonnss tteecchhnniiqquueess ddee ssuui ccllaassssiiffiiccaattiioonn eett ééggaalleemmeenntt rreepprr qquuii ppeerrmmeetttteenntt lleess iinnssppeeccttiioonnss d mmaarriittiimmeess.. LLaa ddeeuuxxiièèmmee ccoonnvveennttiioonn qquuii ttoouu ppoolllluuttiioonn ppaarr lleess hhyyddrrooccaarrbbuurreess ssuurr lleess cchhaappiittrreess pprrééccééddeennttss,, ccee nnoommbbrreeuuxx rreemmaanniieemmeennttss ssuuiittee UUnn ccooddee uunn ppeeuu ssiimmiillaaiirree àà llaa ccoo nnaavviirreess cchhiimmiiqquuiieerrss,, llee ccooddee IIBBCC SSUUNN.. LLeess rréégglleemmeennttaattiioonnss nnoommmmééeess mmaarriittiimmee ccaarr lleess ccoonnssééqquueenncceess ccoonntteennuueess ddaannss cceess tteexxtteess oonntt ddoommaaiinneess ddee llaa ssaauuvveeggaarrddee ddee dd''aauuttrreess ccoonnvveennttiioonnss oouu tteexxtteess glleemmeennttss eesstt iinnddéénniiaabbllee ccaarr eenn ééddiiccttaa ccee qquuee llee jjeeuu ddee llaa ccoonnccuurrrreennccee eennttrree ssééccuurriittéé.. e llaa ccoonnccuurrrreennccee eesstt rreessppeeccttéé,, ll''OOMMII aa bbrreevveettss eett ddiippllôômmeess ccoonnffoorrmmeess àà llaa SS ffiigguurraaiieenntt ssuurr llaa WWhhiittee lliisstt.. eenntt ffaaiitt ssaavvooiirr qquu''eellllee ééttaaiitt pprrééooccccuuppé eess hhuummaaiinneess qquuaalliiffiiééeess,, ccaarr ccee ssoonntt ccuurriittéé dduu nnaavviirree eett ccee ssoonntt lleess mmaarriinnss ddééccllaarréé llee mmiinniissttrree ggrreecc ddee llaa mmaarriinnee ddee ll''UUnniioonn EEuurrooppééeennnnee.. uuaassiimmeenntt ssyyssttéémmaattiiqquueemmeenntt ppaarr lleess uurr llee pplluuss ffaacciillee àà aapppprrééhheennddeerr qquuee llee eerrnnaattiioonnaall dduu TTrraavvaaiill )) ss''iinnttéérreessssee aauu ddee mmeerr.. FFoonnddééee eenn 11991199 eellllee rreeggrroouu eeccoommmmaannddaattiioonnss dduurrééee dduu ttrraavvaaiill ddeess ggeennss ddee mmeerr eett EEEEEEEEUUUUUUUURRRRRRRR TTTTTTTTEEEEEEEECCCCCCCCHHHHHHHHNNNNNNNNIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE ppaarraaîîtt llee pplluuss éévviiddeenntt eett llee pplluuss ffaaccii cctteeuurr qquuii ccoommppoorrttee llee pplluuss ddee ccoonnvveenn àà ccoommmmeenncceerr ppaarr llaa ccoonnvveennttiioonn SSOOLL nntt ddeess ccoonnssééqquueenncceess ddiirreecctteess ssuurr llaa ooiissoonnss,, llee ccoommppaarrttiimmeennttaaggee,, lleess ssyysstt bbiieenn dd''aauuttrreess ééqquuiippeemmeennttss ccoommmmee llee eennttiioonn SSOOLLAASS aa ééttéé iinnttééggrrééee iinnttééggrraall uiivvii ddeess ccoonnssttrruuccttiioonnss ddee nnaavviirree ddeess ss rriissee ddaannss lleess ssppéécciiffiiccaattiioonnss tteecchhnniiqquuee ddee nnaavviirreess ssoouuss ppaavviilllloonnss ffrraannççaaiiss ppaa uucchhee aauu ddoommaaiinnee tteecchhnniiqquuee ttrraaiittee ddee ss,, iill ss''aaggiitt bbiieenn ssûûrr ddee llaa ccoonnvveennttiioonn MM eettttee ccoonnvveennttiioonn ssuubbiitt ddeeppuuiiss qquueellqquuee aauuxx ddeerrnniièèrreess ccaattaassttrroopphheess ddee ll''EERRII oonnvveennttiioonn MMAARRPPOOLL ttrraaiittee ddee ll''aassppeecctt CC ((aanncciieenn ccooddee BBCCHH)),, ccooddee ddoonntt ddéépp ccii--ddeessssuuss ssoonntt lleess pplluuss ccoonnnnuueess eenn dd''uunn mmaannqquueemmeenntt àà ll''uunnee ddeess ssppééccii ddeess rrééppeerrccuuttiioonnss ttrrèèss mmééddiiaattiiqquueess pp llaa vviiee hhuummaaiinnee eenn mmeerr oouu ddee ll''eennvviirr mmooiinnss ccoonnnnuuss rrééggiisssseenntt llee mmoonnddee dd aanntt ddeess oobblliiggaattiioonnss qquuii ee aarrmmaatteeuurrss nnee aa ééttaabbllii uunnee «« WWhhiittee SSTTCCWW 9955.. EEnn 22000011,, péé ppaarr ccee ssuujjeett :: «« lleess mmaarriinnss qquuaalliiffiiééss ss ffoorrmmééss qquuii ppeeuuvveenntt ee mmaarrcchhaannddee,, YYiioorrggooss eennqquuêêtteess aacccciiddeennttss ee ffaacctteeuurr hhuummaaiinn.. uuxx nnoorrmmeess ssoocciiaalleess eett uuppee 117700 ééttaattss eett aa tt lleess eeffffeeccttiiffss ddeess iillee àà êêttrree mmooddiiffiiéé eett nnttiioonnss eett ddee LLAASS qquuii ttoouucchhee ssuurrttoouutt ssééccuurriittéé ccoommmmee ttèèmmeess iinncceennddiiee,, lleess ee ssyyssttèèmmee rraaddiioo eettcc........ lleemmeenntt ddaannss lleess ssoocciiééttééss ddee eess ((ddiivviissiioonn 222211))((((((((3333333344444444)))))))) aarr lleess aaffffaaiirreess ee llaa pprréévveennttiioonn ddee llaa MMAARRPPOOLL.. SSaannss rreevveenniirr eess aannnnééeess ddee IIKKAA eett dduu PPRREESSTTIIGGEE.. tt tteecchhnniiqquuee ddeess ppeennddaaiitt llee IIEEVVOOLLII ddeehhoorrss dduu mmiilliieeuu iiffiiccaattiioonnss tteecchhnniiqquueess ppuuiissqquu''iillss ttoouucchheenntt aauuxx rroonnnneemmeenntt mmaaiiss dduu ttrraannssppoorrtt mmaarriittiimmee..
  • ((((((((3333333344444444)))))))) :::::::: JJOO 2299 ddéécceemmbbrree 11999988 CC''eesstt llee ccaass ppoouurr llaa rréégglleemmeennttaa mmoonnddee mmaarriittiimmee «« lleess bbêêtteess ddee mmoonnddiiaallee.. LLee pprreemmiieerr tteexxttee eenn llaa mmaattiièèrree CCaarrrriieerr)) eett aa ééttéé rréévviisséé eenn 11999911 rrèègglleess oobblliiggaattooiirreess,, llee RReeccuueeiill iinn ggrraaiinn eenn vvrraacc (( RReeccuueeiill iinntteerrnnaatt IIll ccoonnvviieenntt dd''éévvooqquueerr iiccii qquuee llee 11999900,, ddeess aacccciiddeennttss qquuee jjee nn''aaii aacccciiddeennttss hhiissttoorriiqquueess ccaarr ppaasssséé ppéérriiooddee ccoommpprriissee eennttrree 11999900 eett ppeerrdduuss eenn mmeerr,, eennttrraaîînnaanntt llaa mm cceettttee rréégglleemmeennttaattiioonn rriissqquuee eenncc qquueessttiioonn rreellaattiivvee àà llaa ssééccuurriittéé iinn rraappppoorrtt dd''eennqquuêêttee ssuurr llee nnaauuffrraa TToouuss cceess tteexxtteess oonntt uunnee iimmppoorrtt FFrruuiittss ddee ll''aannaallyyssee ddeess ddiifffféérreenntt llaaiissssee gguuèèrree aauujjoouurrdd''hhuuii ddee zzoonn ccaattaassttrroopphheess ssuurrvviieennnneenntt eennccoorr rréégglleemmeennttaattiioonnss eenn vviigguueeuurrss ppaa aalllloonnss mmaaiinntteennaanntt ééttuuddiieerr.. ((((((((3333333355555555)))))))) :::::::: CCee ddeerrnniieerr aavvaaiitt ccoouulléé eenn qquuee pplluuss ddee ddiixx aannnnééeess pplluuss ttaarr iinnssppeeccttiioonn ssoouuss mmaarriinnee ddééttaaiilllléée rraappppoorrtt ssuurr ll''aacccciiddeenntt aa ééttéé pprréé ddééllééggaattiioonn dduu RRooyyaauummee UUnnii.. SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS AAAAAAAACCCCCCCCTTTT «« CChhaaîînnee ddee ssééccuurriittéé mmaarriittiimmee :: ttrroouuvveerraaiitt uunnee ssuucccceessssiioonn ddee mm PPoouurrttaanntt cchhaaccuunn àà ssaa pprroopprree rree ddooiitt aassssuummeerr ssaa ppaarrtt ddee rreessppoonn VVaallllaatt ((((((((3333333366666666)))))))) nnoouuss ppeerrmmeett dd''eennttaamm mmaarriittiimmee qquu''iillss ssooiieenntt ééttaattiiqquueess CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRR :::::::: LLLLLLLLEEEEEEEESSSSSSSS EEEEEEEETTTTTTTTAAAAAAAATTTTTTTT §§11..11 LL''EETTAATT DDUU PPAAVVIILLLLOONN :: EENN LLee ccoonnttrrôôllee ddeess nnoorrmmeess eett rrèèggllee eesssseennttiieelllleemmeenntt eenn uunn ccoonnttrrôôllee mmaannaaggeemmeenntt dd''uunn nnaavviirree eett ddee ll''aarrmmaatteeuurr,, eesstt ééggaalleemmeenntt ccoonnss aattiioonn qquuii ccoonncceerrnnee lleess vvrraaqquuiieerrss,, ssuurrnn ee ssoommmmeess »» eett qquuii rreepprréésseenntteenntt pprrèèss aa ééttéé aaddooppttéé eenn 11996655 :: iill ss''aaggiitt dduu rr 11 eett eennffiinn ccoommppllééttéé eenn 11999988 ppaarr uunn nntteerrnnaattiioonnaall ddee rrèègglleess ddee ssééccuurriittéé ppoo ttiioonnaall ddee rrèègglleess ssuurr lleess ggrraaiinnss )).. sseecctteeuurr dduu vvrraacc aa ppaayyéé uunn lloouurrdd ttrriibb ii ppaass éévvooqquuéé ddaannss llee pprreemmiieerr cchhaappiittrr ééss iinnaappeerrççuu aauupprrèèss dduu ggrraanndd ppuubblliiqquue tt llaa mmii--mmaaii ddee 11999977,, oonn aa ddéénnoommbbrréé mmoorrtt ddee 665544 ppeerrssoonnnneess,, ddeess mmaarriinnss pp ccoorree dd''éévvoolluueerr,, ll''OOMMII ssee ppeenncchhaanntt ddee nnttrriinnssèèqquuee ddeess vvrraaqquuiieerrss àà ll''iissssuuee ddee aaggee dduu vvrraaqquuiieerr DDEERRBBYYSSHHIIRREE((((((((3333333355555555)))))))).. ttaannccee pprriimmoorrddiiaallee ddaannss llee sseecctteeuurr ddee tteess ccaattaassttrroopphheess mmaarriittiimmeess,, ll''eennsseemm nneess dd''oommbbrree,, ddee ddoommaaiinneess nnoonn ccoouuvvee rree,, rréévvééllaanntt bbiieenn ssoouuvveenntt llee nnoonn rreesspp aarr lleess ddiifffféérreennttss aacctteeuurrss ddee llaa cchhaaîînnee nn 11998800,, aavveecc ttoouutteess lleess ppeerrssoonnnneess àà rrdd qquuee ll''oonn aa llooccaalliisséé ll''ééppaavvee eett qquuee éee ppoouurr tteenntteerr ddee ddéétteerrmmiinneerr llaa ccaauusse ésseennttéé aauu CCoommiittéé ddee llaa ssééccuurriittéé mmaarrii CCCCTTTTTTTTEEEEEEEEUUUUUUUURRRRRRRRSSSSSSSS DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA CCCCCCCCHHHHHHHHAAAAAAAAÎÎÎÎÎÎÎÎNNNNNNNNEEEEEEEE DDDDDDDDEEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRR :: iiddééee qquuii tteenndd àà ffaaiirree ccrrooiirree qquu''eenn llaa mmaaiilllloonnss aayyaanntt ttoouuss llaa mmêêmmee ffoorrccee eett eessppoonnssaabbiilliittéé eett ssoonn pprroopprree rrôôllee àà jjoouu nnssaabbiilliittéé »» :: cceettttee ddééffiinniittiioonn ddoonnnnééee pp mmeerr uunnee rrééfflleexxiioonn ssuurr lleess ddiifffféérreennttss ss oouu pprriivvééss.. TTTTTTTTSSSSSSSS NNTTRREE OOBBLLIIGGAATTIIOONN EETT DDEELLAAIISSSSEEMMEENN eemmeennttss eenn mmaattiièèrree ddee ssééccuurriittéé mmaarriitt ddeess nnaavviirreess.. DDeeppuuiiss qquueellqquueess aannnnééee mmaanniièèrree pplluuss éétteenndduuee llee mmaannaaggeemmee ssiiddéérréé ccoommmmee uunn éélléémmeenntt cclleeff ddee llaa nnoommmméé ddaannss llee ss ddee 3333%% ddee llaa fflloottttee rreeccuueeiill BBCC ((BBuullkk nnoouuvveeaauu rreeccuueeiill ddee oouurr llee ttrraannssppoorrtt ddee bbuu ddaannss lleess aannnnééeess rree ccoonnssaaccrréé aauuxx uee.. AAuu ccoouurrss ddee llaa éé aauu ttoottaall 9999 vvrraaqquuiieerrss pprrooffeessssiioonnnneellss.. EEtt ee nnoouuvveeaauu ssuurr llaa ee llaa pprréésseennttaattiioonn dd''uunn ee llaa ssééccuurriittéé mmaarriittiimmee.. mmbbllee ddee cceess tteexxtteess nnee eerrtt.. CCeeppeennddaanntt ddeess ppeecctt ddeess ee ddee ssééccuurriittéé qquuee nnoouuss àà bboorrdd,, mmaaiiss ccee nn''eesstt ll''oonn aa pprrooccééddéé àà uunnee see dduu nnaauuffrraaggee.. LLee iittiimmee ((MMSSCC)) ppaarr llaa RRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE aa mmaattiièèrree ssee tt llaa mmêêmmee vvaalleeuurr.. uueerr.. CChhaaqquuee aacctteeuurr ppaarr MMoonnssiieeuurr FFrraanncciiss aacctteeuurrss ddee llaa ssééccuurriittéé NNTT ttiimmee ccoonnssiissttee eess mmaaiinntteennaanntt,, llee eenntt ddee llaa ssoocciiééttéé ddee ssééccuurriittéé mmaarriittiimmee..
  • LLee pprreemmiieerr nniivveeaauu ddee ccoonnttrrôôllee ee dduu ppaavviilllloonn ppoouurr ccee qquuii ccoonncceerrnn eexxtteennssiioonn ll''EEttaatt ddaannss lleeqquueell eesstt aa)) LLeess ddeevvooiirrss ddeess EEttaattss dduu ppaavv LLeess rrèègglleess ccoouuttuummiièèrreess dduu ddrrooiitt ppaavviilllloonn,, cceettttee ccoommppéétteennccee rreeppoo rraattttaacchheemmeenntt dduu nnaavviirree àà uunn ((((((((3333333366666666)))))))) :::::::: FF..VVaallllaatt :: PPrrééssiiddeenntt ddee ll''ii ll''AAggeennccee EEuurrooppééeennnnee ddee SSééccuurrii oorrddrree jjuurriiddiiqquuee,, ssuusscceeppttiibbllee ddee lleess aabbuuss aauuxxqquueellss lleess pprriinncciippeess nnaavviiggaattiioonn ppoouurrrraaiieenntt ddoonnnneerr lliie éénnoonnccééee àà ll''AArrtt.. 66 aall 11 ddee llaa ccoonn EExxpprreessssiioonn ddee llaa ssoouuvveerraaiinneettéé dd sseeuulleemmeenntt uunnee ssoouurrccee ddee ddrrooiittss eellllee eesstt ssuurrttoouutt uunnee ssoouurrccee ddee dd pprriinncciippaalleemmeenntt ddééffiinniieess ppaarr lleess pprréécciissééeess ddaannss lleess iinnssttrruummeennttss ((OOMMII)) eett ddee ll''OOrrggaanniissaattiioonn iinntteerr AAiinnssii llaa ccoonnvveennttiioonn ddee 11995588 ssuurr ppaavviilllloonn ll''oobblliiggaattiioonn ddee ss''aassssuurree aapppplliiqquuééeess àà bboorrdd ddeess nnaavviirreess rr eexxeerrcceerr ssaa jjuurriiddiiccttiioonn eett ssoonn ccoonn ssoocciiaall ssuurr lleess nnaavviirreess bbaattttaanntt ssoo LL''AArrtt 9944 eett ll''AArrtt 221177 ddee llaa CCoonnvv pprréécciisseenntt àà nnoouuvveeaauu ll''oobblliiggaattiioonn ddee ll''EEttaatt dduu ppaavviilllloonn ddaannss llee ddoomm mmaarriittiimmee.. LL''oobblliiggaattiioonn dduu ccoonnttrrôôllee ppaarr ll''EEtt ccoonnvveennttiioonnss ddee ll''OOMMII qquuee ssoonntt ccoonnvveennttiioonn iinntteerrnnaattiioonnaallee MMAARRPP ttyyppeess dd''oobblliiggaattiioonnss,, llaa pprreemmiièèrree ddeeuuxxiièèmmee llaa ddéélliivvrraannccee ddeess cceerr LLaa ddeerrnniièèrree ddeess oobblliiggaattiioonnss qquuii ssééccuurriittéé eesstt ll''oobblliiggaattiioonn dd''eennqquuêê 11998822 ssuurr llee ddrrooiitt ddee llaa mmeerr qquuee IIll rreessssoorrtt ddee cceettttee éénnuumméérraattiioonn ppeeuuvveenntt éécchhaappppeerr àà lleeuurr oobblliiggaa mmaarriittiimmeess nnee sseerraaiitt ppaass ssuupppprriimm pplluuppaarrtt àà uunnee eerrrreeuurr hhuummaaiinnee oo ffrruuiitt dd''uunn ddééllaaiisssseemmeenntt lliiééee àà dde eenn mmaattiièèrree ddee ssééccuurriittéé mmaarriittiimmee ssee tt nnee lleess nnaavviirreess bbaattttaanntt ppaavviilllloonnss ddee ccee tt eennrreeggiissttrréé ll''aarrmmaatteeuurr ppoouurr llee ccoonnttrrô vviilllloonn :: tt ddee llaa mmeerr ccoonnffiieenntt llee ccoonnttrrôôllee ddeess nn oossee eenn ffaaiitt ssuurr llee pprriinncciippee ddee llaa tteerrrrii iinnssttiittuutt ffrraannççaaiiss ddee llaa mmeerr eett rreepprrééssee iittéé MMaarriittiimmee.. llee ccoonnttrrôôlleerr,, ppeerrmmeett aaiinnssii ddee pprréévveenn dduu lliibbrree uussaaggee ddee llaa hhaauuttee mmeerr eett dd ieeuu.. CCeettttee ccoommppéétteennccee eexxcclluussiivvee ddee l nnvveennttiioonn iinntteerrnnaattiioonnaallee dduu 2299 aavvrriill 11 ddee ll''EEttaatt ssuurr sseess nnaavviirreess,, llaa llooii dduu ppaa ss ((ddrrooiittss ddee ppaassssaaggee)).. EEnn mmaattiièèrree ddee ddeevvooiirrss.. LLeess oobblliiggaattiioonnss ddee ll''EEttaatt dduu ccoonnvveennttiioonnss ddeess NNaattiioonnss UUnniieess ssuurr ll ssppéécciiaalliissééss ddee ll''OOrrggaanniissaattiioonn mmaarriittiimm rrnnaattiioonnaallee dduu ttrraavvaaiill ((OOIITT)) rreellaattiiffss àà rr llaa hhaauuttee mmeerr eett ssoonn aarrtt 55 aall 11 iimmppoo eerr qquuee lleess rrèègglleess ddee ssééccuurriittéé ssoonntt eeffffe rreelleevvaanntt ddee lleeuurr aauuttoorriittéé :: «« LL''EEttaatt dd nnttrrôôllee ddaannss lleess ddoommaaiinneess tteecchhnniiqquuee,, oonn ppaavviilllloonn »».. vveennttiioonn ddeess NNaattiioonnss UUnniieess ddee 11998822 ssuu nn ddee ccoonnttrrôôllee eeffffeeccttiiff ddee ll''EEttaatt dduu ppaavv mmaaiinnee ddee llaa pprrootteeccttiioonn dduu mmiilliieeuu mmaa ttaatt dduu ppaavviilllloonn eesstt eennccoorree rreepprriiss ddaann llaa ccoonnvveennttiioonn iinntteerrnnaattiioonnaallee SSOOLLAASS PPOOLL dduu 22 NNoovveemmbbrree 11997733,, ccoonnvveennttiioo ee ccoonncceerrnnaanntt lleess vviissiitteess eett iinnssppeeccttiioonn rrttiiffiiccaattss ccoorrrreessppoonnddaannttss.. aa ssaannss ddoouuttee ccoonnttrriibbuuééee àà ll''aamméélliioorra êêttee aapprrèèss aacccciiddeenntt qquuii ddééccoouullee ttaanntt dd ee ddeess ccoonnvveennttiioonnss ddee ll''OOMMII.. nn ddee ccoonnvveennttiioonnss qquuee ttoouuss ppaayyss ssiiggnnaa aattiioonn ddee ccoonnttrrôôllee eett ssii tteell ééttaaiitt llee ccaass mmééss,, llee rriissqquuee zzéérroo nn''eexxiissttee ppaass,, mmaa oouu uunn éévvèènneemmeenntt ffoorrttuuiitt eett nnee sseerraaiitt deess ccrriittèèrreess ééccoonnoommiiqquueess.. ttrroouuvvee ddoonncc êêttrree ll''EEttaatt eett EEttaatt eett ppaarr rôôllee dduu mmaannaaggeemmeenntt.. nnaavviirreess àà ll''EEttaatt dduu iittoorriiaalliittéé.. LLee eennttaanntt ddee llaa FFrraannccee àà nniirr eett ddee ssaannccttiioonnnneerr ddee llaa lliibbeerrttéé ddee ll''EEttaatt dduu ppaavviilllloonn eesstt 11995588 ssuurr llaa hhaauuttee mmeerr.. aavviilllloonn nn''eesstt ppaass ee ssééccuurriittéé mmaarriittiimmee,, ppaavviilllloonn ssoonntt llee ddrrooiitt ddee llaa mmeerr eett mmee iinntteerrnnaattiioonnaallee llaa ssééccuurriittéé mmaarriittiimmee :: oossee aauuxx EEttaattss dduu ffeeccttiivveemmeenntt ddooiitt nnoottaammmmeenntt ,, aaddmmiinniissttrraattiiff eett uurr llee ddrrooiitt ddee llaa mmeerr vviilllloonn eett lleess ppoouuvvooiirrss aarriinn eett ddee llaa ssééccuurriittéé nnss lleess ddeeuuxx dduu 1177 JJuuiinn 11996600 eett llaa oonn qquuii pprréévvooiieenntt ddeeuuxx nnss ddeess nnaavviirreess eett llaa raattiioonn ddeess nnoorrmmeess ddee ddee llaa ccoonnvveennttiioonn ddee aattaaiirreess ddee cceelllleess--ccii nnee lleess aacccciiddeennttss aaiiss sseerraaiitt ddûû ppoouurr llaa tt eenn ttoouutt ccaass ppaass llee
  • bb)) CCee qquu''iill eenn eesstt rrééeelllleemmeenntt :: EEnn eeffffeett llee ddééllaaiisssseemmeenntt ddee lleeuurr aaggggrraavvaanntt ddee «« ll''iinnssééccuurriittéé mmaarr LL''aarrmmaatteeuurr ttoottaalleemmeenntt lliibbrree dduu eesssseennttiieelllleemmeenntt ddeess ccrriittèèrreess éécco iimmmmaattrriiccuullaattiioonn nnee rreeqquuéérraanntt pp ééqquuiippaaggeess eett bbiieenn ssûûrr ccooûûtt dduu aa ssoonntt ddoonncc ccoommpprreessssiibblleess àà ll''iinnvv mmaarrcchhéé.. LL''OOCCDDEE aa ddéémmoonnttrréé qquu''uunn aarrmmaa ssééccuurriittéé ppoouurrrraaiitt ééccoonnoommiisseerr jjuu 1100%% ddeess cchhaarrggeess gglloobbaalleess.. OOnn ddoouutteeuuxx »» dd''iimmmmaattrriiccuulleerr lleeuurrss ppaavviilllloonn ddee ccoommppllaaiissaannccee lloorrssqquu ddee vvoolloonnttéé ddee ccoonnttrrôôllee,, ppeerrmmeett ccoommpptteerr qquuee bbeeaauuccoouupp ddee cceess pp qquuee lleess ccoonnttrrôôlleess,, eenn ppaarrttiiccuulliieerr aassssoouupplliiss.. CC''eesstt aaiinnssii qquu''aapprrèèss llaa ddeeuuxxiièèmm ccoommppllaaiissaanncceess :: ppaayyss bbiieenn ssoouuvv ppuu ddee ppaarrtt lleeuurr ppoolliittiiqquuee mmaarriittiimmee ttrrèèss ppeeuu eett nnaavviirreess qquuii aarrbboorraaiieenntt lleeuurr pp AAuujjoouurrdd''hhuuii ddaannss lleess ddiixx pprreemmiièè MMaallttee,, lleess BBaahhaammaass,, CChhyypprree aalloo ll''oonn nnoottee ll''EEttaatt GGrreecc ((6699%% ssoouuss ééttrraannggeerrss)),, NNoorrvvééggiieenn,, AAmméérriiccaa mmiilliieeuu mmaarriittiimmee ppoouurr ccee qquuii ccoonn ppaarr mmaannqquuee ddee mmooyyeenn,, ssooiitt ppaarr DDeess cchhiiffffrreess ééttaabblliiss eenn 11999988 lloorr aauu pprroocchhaaiinn cchhaappiittrree,, mmoonnttrree qq iimmmmoobbiilliissaattiioonnss eett qquuee 2200%% ddee ppaavviilllloonnss CChhyypprriioottee rreepprréésseennttaaii oobblliiggaattiioonnss ddee ccoonnttrrôôllee.. AA ll''éécchheelloonn EEuurrooppééeenn,, uunnee aamméé CChhyypprree,, MMaallttee aayyaanntt ddééjjàà rreettiirréé pprriinncciippaalleess rrééssiiddeenntteess àà MMaallttee.. cc)) LLeess ssoolluuttiioonnss :: LL''OOMMII eett ll''EEuurrooppee ssoonntt ccoonnsscciieenn ssoouuvveerraaiinn ffaassssee bbiieenn rreessppeecctteerr rr oobblliiggaattiioonn ddee ccoonnttrrôôllee ddee cceerrttaaiinnss éé rriittiimmee »».. cchhooiixx dduu ppaavviilllloonn,, eeffffeeccttuueerraa ccee cchhoo coonnoommiiqquueess,, ss''iill ss''aaggiitt dd''uunn ppaavviilllloonn dd ppaass ddeess ccrriittèèrreess ddee nnaattiioonnaalliittéé :: ttaaxxee aauu rreessppeecctt ddee llaa rréégglleemmeennttaattiioonn tteecchh vveerrssee bbiieenn ssoouuvveenntt dduu pprriixx dduu ffrreett qquu aatteeuurr qquuii ppaarrvviieennddrraaiitt àà nnee ppaass rreessppe uussqquu''àà 3300%% ddee sseess cchhaarrggeess dd''eexxppllooiitt ccoommpprreenndd ddoonncc ttoouutt ll''iinnttéérrêêtt ppoouurr dd nnaavviirreess ssoouuss ppaavviilllloonn ddee lliibbrree iimmmmaa uuee lleess ddééffaauuttss ddee mmooyyeennss,, eett bbiieenn ppll tttteenntt ddee ffaaiirree ddee ssuubbssttaannttiieelllleess ééccoonnoo ppaavviilllloonnss pprrooccuurreenntt ddeess aavvaannttaaggeess ffii rr cceeuuxx ppoorrttaanntt ssuurr llee rreessppeecctt dduu ddrrooii mmee gguueerrrree mmoonnddiiaallee ssoonntt aappppaarruuss lleess vveenntt ppeeuu iinndduussttrriiaalliisséé,, ppaauuvvrree oouu ppaa uu ttaaxxéé eett ttrrèèss ppeeuu rreeggaarrddaannttee ddee llaa qq ppaavviilllloonnss,, ssee ccoonnssttiittuueerr uunnee fflloottttee iimmpp èèrreess ffllootttteess mmoonnddiiaalleess,, ll''oonn rreettrroouuvvee oorrss qquuee ppaarrmmii lleess ddiixx pprreemmiièèrreess ffllootttt ss ppaavviilllloonnss ééttrraannggeerrss)),, JJaappoonnaaiiss ((8811%% aaiinn ..........LLeess pprreemmiieerrss oonntt uunnee mmaauuvvaaii nncceerrnnee llee ccoonnttrrôôllee dduu rreessppeecctt ddeess ccrrii rr vvoolloonnttéé ppoolliittiiqquuee.. rrss ddeess iinnssppeeccttiioonnss dduu MMéémmoorreenndduumm d qquuee 99%% ddeess iinnssppeeccttiioonnss oonntt ddoonnnnéé lliiee ee cceess 99%% ééttaaiieenntt ddeess nnaavviirreess ppaavviilllloonn iitt 1199,,44%%.. IIll eesstt éévviiddeenntt qquuee cceess EEttaatt éélliioorraattiioonn eesstt eenn vvuuee aavveecc llaa ffuuttuurree aa éé llee cceerrttiiffiiccaatt rreellaattiiff aauu ccooddee IISSMM àà ll''uu nnttss ddee ccee pprroobbllèèmmee mmaaiiss ccoommmmeenntt ss'' lleess ccoonnvveennttiioonnss aauuxxqquueelllleess iill aaddhhèèrree ééttaattss eesstt uunn ffaacctteeuurr ooiixx eenn ffoonnccttiioonn ddee lliibbrree eess,, nnaattiioonnaalliittééss ddeess hhnniiqquuee.. CCeess ccrriittèèrreess uuii lluuii eesstt uunn pprriixx ddee eecctteerr lleess rrèègglleess ddee ttaattiioonn eett aauu mmiinniimmuumm ddeess aarrmmaatteeuurrss «« aattrriiccuullaattiioonn qquuii ddeevviieenntt lluuss ssoouuvveenntt ll''aabbsseennccee oommiieess.. EEtt cceeccii ssaannss iissccaauuxx iimmppoorrttaannttss eett iitt dduu ttrraavvaaiill ssoonntt ttrrèèss ppaavviilllloonnss ddee aarraaddiiss ffiissccaauuxx,, qquuii oonntt qquuaalliittéé ddeess aarrmmaatteeuurrss ppoorrttaannttee.. ee llee PPaannaammaa,, llee LLiibbéérriiaa,, tteess ppaarr nnaattiioonnaalliittééss %% ssoouuss ppaavviilllloonnss iissee rrééppuuttaattiioonn ddaannss llee iittèèrreess tteecchhnniiqquueess ssooiitt ddee PPaarriiss,, ssuujjeett ttrraaiittéé eeuu àà ddeess nn MMaallttaaiiss aalloorrss qquuee llee ttss mmaannqquuaaiieenntt àà lleeuurrss aaddhhééssiioonn ddee MMaallttee eett uunnee ddeess ccoommppaaggnniieess ''aassssuurreerr qquu''uunn EEttaatt ee..
  • LL''OOMMII nn''aayyaanntt aauuccuunn oorrggaannee ddee tteecchhnniiqquuee,, llaa ddééffiicciieennccee tteecchhnniiqq dduu ppaavviilllloonn ,, ll''aauuttrree ééttaanntt llaa nnoon EEnn 11999977,, ll''OOMMII rreeccoonnnnaaîîtt ccoommbb iinnssttrruummeennttss qquu''eellllee aaddooppttee.. EEllllee CCoommiittéé ddee ccooooppéérraattiioonn tteecchhnniiqquu aaccaaddéémmiieess ddee ffoorrmmaattiioonn mmaarriittiimm 11999933.. OOnn ccoommmmeennccee àà aappeerrcceevvooiirr ssuurr ppaarr llee bbiiaaiiss ddeess «« oobblliiggaattiioonnss ddee ddeess iinnffoorrmmaattiioonnss ssuurr llaa mmaanniièèrree yy aa ddoonncc ppaarr llàà uunn ddrrooiitt ddee rreeggaa ddeess ccoonnvveennttiioonnss ppaarr ll''EEttaatt dduu pp CCeerrttaaiinneess ccoonnvveennttiioonnss,, nnoottaammmm ppuuiissqquuee ll''oonn ddeemmaannddee àà ll''EEttaatt dd ddiissppoossiittiioonnss ddeess ccoonnvveennttiioonnss qquu ssuurr uunnee «« lliissttee bbllaanncchhee »» qquuii vvaa EEttaattss,, ddeess cceerrttiiffiiccaattss qquu''iill vvaa ddéé AAuujjoouurrdd''hhuuii ll''OOMMII ss''aacchheemmiinnee vv àà ttrraavveerrss ddeess ddiirreeccttiivveess eett ddeess f ddee ssiimmpplleess RRééssoolluuttiioonnss nn''aayyaanntt OOnn ppaarrllee ééggaalleemmeenntt aaccttuueelllleemmee ppaavviilllloonn.. LLee pprroobbllèèmmee ééttaanntt ddee ddee ll''EEttaatt dduu ppaavviilllloonn.. LL''EEuurrooppee qquuaanntt àà eellllee aa rrééaaggiitt ss ddee llaa ccoommppéétteennccee ddeess ééttaattss dduu MMaarriittiimmee((((((((3333333377777777)))))))).. .. MMaaiiss llaa pprreemmiièèrree mmeessuurree qquuii aa ddééffiicciieennccee ddeess EEttaattss dduu ppaavviilllloonn ppaavviilllloonn àà ll''ééttaatt dduu ppoorrtt ooùù uunn nn §§11..22..LL''EETTAATT DDUU PPOORRTT :: SSUUBBSSTTII AA llaa ddiifffféérreennccee ddee ll''EEttaatt dduu ppaavvii vviigguueeuurr ddee ll''EEttaatt aauuxx nnaavviirreess aarr dduu ppoorrtt ccoonncceerrnnee lleess iinnssppeeccttiioonn ss''aassssuurreerr qquuee ccee nnaavviirree rreessppeecctt ((((((((3333333377777777)))))))) :::::::: RRèègglleemmeenntt 11440066//22000022//CC lleess nnoorrmmeess iinntteerrnnaattiioonnaalleess eenn vv eett mmaaiinntteennaanntt ssuurr llee ppllaann dduu mm ee rréépprreessssiioonn aa ooppttéé ppoouurr llaa ssoolluuttiioonn dd qquuee ééttaanntt uunnee ddeess ccoommppoossaanntteess dduu nn nn vvoolloonnttéé.. biieenn iill eesstt iimmppoorrttaanntt ddee ggaarraannttiirr ll''aapppp ee ddeevviinntt llee pprreemmiieerr oorrggaanniissmmee àà iinnsstt uuee.. EEllllee aa aaiinnssii aaiiddéé ddee nnoommbbrreeuuxx ppaa mmee eett ccrréééé ll''UUnniivveerrssiittéé mmaarriittiimmee mmoo rr llaa ssccèènnee iinntteerrnnaattiioonnaallee uunn ddéébbuutt ddee ee nnoottiiffiiccaattiioonn »» lleessqquueelllleess oobblliiggeenntt cchh ee ddoonntt iill ccoommppttee aapppplliiqquueerr lleess ccoonnvvee aarrdd ddee ll''OOMMII àà ttrraavveerrss ssoonn ssoouuss--ccoomm ppaavviilllloonn.. mmeenntt cceellllee ssuurr llaa cceerrttiiffiiccaattiioonn ddeess ééqquu ddee pprroouuvveerr qquu''iill aa eeffffeeccttiivveemmeenntt mmiiss uu''iill aa rraattiiffiiéé .. DDaannss llee ccaass ccoonnttrraaiirree iill aa ccoonnddiittiioonnnneerr llaa rreeccoonnnnaaiissssaannccee,, ppaa éélliivvrreerr.. vveerrss uunnee éévvaalluuaattiioonn ddee llaa ppeerrffoorrmmaanncc ffoorrmmuullaaiirreess dd''aauuttoo éévvaalluuaattiioonn.. MMaaiiss ppaass ddee ccaarraaccttèèrree oobblliiggaattooiirree.. eenntt ddee llaa cceerrttiiffiiccaattiioonn ddeess aaddmmiinniissttrraa ssaavvooiirr qquueellllee aauuttoorriittéé vvaa ppoouuvvooiirr cceer ssuuiittee aauu nnaauuffrraaggee ddee ll''EErriikkaa eett àà cchhooii ppaavviilllloonn ppaarr llee bbiiaaiiss ddee ll''AAggeennccee EEuurr ééttéé pprriissee,, ll''aa ééttéé aauu sseeiinn ddee ll''EEuurrooppee nn,, iill ss''aaggiitt dd''uunn ttrraannssffeerrtt ddeess oobblliiggaattiioo nnaavviirree ffaaiitt eessccaallee.. IITTUUTT DDEE LL''EETTAATT DDUU PPAAVVIILLLLOONN iilllloonn cchhaarrggéé ddee ffaaiirree aapppplliiqquueerr llaa rréégg rrbboorraanntt llee ppaavviilllloonn ddee ccee mmêêmmee ééttaatt,, nnss ddee nnaavviirreess ééttrraannggeerrss ppaarr lleess aauuttoorr ttee CCEE dduu 2277 jjuuiinn 22000022 vviigguueeuurr ttaanntt ssuurr llee ppllaann tteecchhnniiqquuee qquu mmaannaaggeemmeenntt.. dd''aassssiissttaannccee nnoonn ccoonnttrrôôllee ddee ll''EEttaatt pplliiccaattiioonn eeffffiiccaaccee ddeess ttiittuuttiioonnnnaalliisseerr uunn aayyss àà ccrrééeerr ddeess oonnddiiaallee ddee MMaallmmöö eenn ee ccoonnttrrôôllee qquuii ss''eexxeerrccee hhaaqquuee EEttaatt àà ddoonnnneerr eennttiioonnss qquu''iill aa rraattiiffiiéé.. IIll mmiittéé ssuurr ll''aapppplliiccaattiioonn uuiippaaggeess vvoonntt ttrrèèss llooiinn eenn ooeeuuvvrree lleess ll nnee sseerraa ppaass aaddmmiiss aarr ttoouuss lleess aauuttrreess ccee ddee ll''EEttaatt dduu ppaavviilllloonn iill nnee ss''aaggiitt eennccoorree qquuee aattiioonnss ddeess EEttaattss dduu errttiiffiieerr lleess oobblliiggaattiioonnss iissii llaa vvooiixx dduu ccoonnttrrôôllee rrooppééeennnnee ddee SSééccuurriittéé ee ppoouurr ppaalllliieerr àà llaa oonnss ddee ll''EEttaatt dduu gglleemmeennttaattiioonn eenn ,, llee ccoonnttrrôôllee ppaarr ll''EEttaatt rriittééss dd''uunn EEttaatt aaffiinn ddee uuee ssuurr llee ppllaann hhuummaaiinn
  • EEnn ffaaiitt ssoonn iinnttrroodduuccttiioonn ddaannss llee cceerrttaaiinnss EEttaattss dduu ppaavviilllloonn àà rreemm ccoonnttrrôôllee eett dd''iinnssppeeccttiioonn.. CCeess mm pplluuss ppaarrtt ddeess rréégglleemmeennttaattiioonnss ii CCee ccoonnttrrôôllee sseerrtt aauujjoouurrdd''hhuuii ddee ll''EEttaatt dduu ppoorrtt qquuii vvaa ppoouuvvooiirr iinnss ddeemmaannddeerr ll''eexxaammeenn ddeess cceerrttiiffiicc eessttiimmee qquu''iill yy aa uunn rriissqquuee ppoouurr ll''aauuttoorriissaattiioonn dd''aappppaarreeiilllleerr eett ssuu nnaavviirree eesstt ddaannggeerreeuuxx ppoouurr llaa ssaa ll''eennvviirroonnnneemmeenntt,, ddee rreetteenniirr llee nn IIll ss''aaggiitt bbiieenn dd''uunn ddrrooiitt mmaaiiss aauu aa)) AAssppeecctt jjuurriiddiiqquuee :: IIll eexxiissttee àà ccee jjoouurr 77 ggrraannddss ccaadd aaccccoorrdd ddiitt MMeemmoorreenndduumm OOff UUnndd llee «« MMéémmoorraanndduumm ddee PPaarriiss »» oouu LLee MMeemmoorreenndduumm dd''eenntteennttee ddee PP ll''EEttaatt dduu ppoorrtt aa ééttéé ssiiggnnéé llee 2266 LLee ccoonnttrrôôllee ppaarr ll''EEttaatt dduu ppoorrtt eess aauu ccoonnttrrôôllee ppaarr ll''EEttaatt dduu ppoorrtt ((99 mmooddiiffiiccaattiioonn,, pprrooppoossiittiioonn qquuii ffaa nnaauuffrraaggee ddee ll''EERRIIKKAA.. LLeess pprriinncciippaalleess mmeessuurreess ddee cceetttt llee cciibbllaaggee ddeess nnaavviirreess qquuii ddooiivvee pplluuss ddiissccrrééttiioonnnnaaiirreess mmaaiiss rreenndd ttyyppee eett ddee sseess aannttééccééddeennttss.. IIllss pprréévvooiieenntt aauussssii dd''iinntteerrddiirree ll'' àà rriissqquueess.. CCeess mmeessuurreess ssoonntt eennttrrééeess eenn vv PPlluuss ggéénnéérraalleemmeenntt cceess aaccccoorrddss ddiifffféérreennttss EEttaattss dd''uunnee mmêêmmee zzoo eett dd''eexxiiggeerr,, ddee llaa ppaarrtt ddee cceess aauu MMéémmoorraanndduumm ddee PPaarriiss aa ffiixxéé ccee ééttrraannggeerrss qquuii ffrrééqquueenntteenntt lleess pp LLeess EEttaattss EEuurrooppééeennss mmeetttteenntt éégg ddééccrriitteess lleess ddééffiicciieenncceess mmaajjeeuurree nnaavviirree ssooiitt uunnee rreeccttiiffiiccaattiioonn ddee LLeess aauuttrreess pprriinncciippaauuxx mmeemmoorreenn aassiiee//ppaacciiffiicc,,ssiiggnnéé llee 11eerr ddéécceemmbb aamméérriiccaaiinnee,, ssiiggnnéé eenn 11999922,, eett ll ee ssyyssttèèmmee aa ééttéé nnéécceessssaaiirree ppoouurr ppaallii mmpplliirr sseess oobblliiggaattiioonnss nnoottaammmmeenntt sseess mêêmmeess EEttaattss qquuee nnoouuss aavvoonnss vvuu rraattiiffii iinntteerrnnaattiioonnaalleess.. ee rrôôllee ddee «« ggeennddaarrmmee »» ssuurr llaa ssccèènnee ssppeecctteerr lleess nnaavviirreess ééttrraannggeerrss qquuii ffrréé ccaattss eett pprrooccééddeerr àà ddeess iinnssppeeccttiioonnss ppll llaa ssééccuurriittéé.. IIll aa llee ddrrooiitt ddee ffiixxeerr ddeess uurrttoouutt llee ddrrooiitt,, eett ll''oobblliiggaattiioonn,, qquuaanndd aauuvveeggaarrddee ddee llaa vviiee hhuummaaiinnee eenn mmee nnaavviirree aauu ppoorrtt.. uussssii dd''uunnee oobblliiggaattiioonn.. ddrreess dd''aaccccoorrddss rrééggiioonnaauuxx qquuii rrééggiisssseenn ddeerrssttaannddiinngg (( MMOOUU)) eett llee pplluuss ccoonnnnuu uu MMOOUU PPaarriiss.. PPaarriiss ((tteerrmmee FFrraannççaaiiss)) ssuurr llee ccoonnttrrôôll JJaannvviieerr 11998822 ssoouuss lleess aauussppiicceess ddee ll'' sstt ééggaalleemmeenntt iinnssttiittuuéé ppaarr llaa ddiirreeccttiivvee 9955//2211 //CCEE)) eett aa ffaaiitt ll''oobbjjeett dd''uunnee pprroo aaiitt ppaarrttii dduu ttrraaiinn ddee mmeessuurreess pprrooppoosséé ttee pprrooppoossiittiioonn ddee mmooddiiffiiccaattiioonn ddee llaa eenntt ffaaiirree ll''oobbjjeett dd''uunn ccoonnttrrôôllee.. LLee cchhoo dduu oobblliiggaattooiirreess eenn ffoonnccttiioonn ddee ccrriittèèrree ''aaccccèèss aauuxx ppoorrttss ddee ll''UUnniioonn EEuurrooppééeenn vviigguueeuurr llee 2222 JJuuiilllleett 22000033.. dd''eenntteennttee pprréévvooiieenntt uunnee ccooooppéérraattiioon oonnee aaffiinn dd''hhaarrmmoonniisseerr lleess pprrooccéédduurreess uuttoorriittééss,, qquu''eelllleess iinnssppeecctteenntt uunn mmiinniimm ee qquuoottaa dd''iinnssppeeccttiioonnss mmiinniimmaalleess àà 2255 ppoorrttss ddeess EEttaattss eeuurrooppééeennss aauu ccoouurrss dd ggaalleemmeenntt eenn ccoommmmuunn uunnee bbaassee ddee dd eess qquuii nnéécceessssiitteenntt ssooiitt uunnee iimmmmoobbiilliis cceettttee ddééffiicciieennccee ppoouurr llaa pprroocchhaaiinnee ee nndduumm dd''eenntteennttee ssoonntt llee MMOOUU TTookkyyoo pp bbrree 11999933,, llee MMOOUU vviiññaa ddeell mmaarr ((cchhiilliiee llee MMOOUU IInnddiiaann oocceeaann ssiiggnnéé eenn 11999999.. ieerr lleess ddééffiicciieenncceess ddee s oobblliiggaattiioonnss ddee iieerr pprroommpptteemmeenntt llaa mmaarriittiimmee ccaarr cc''eesstt ééqquueenntteenntt sseess ppoorrttss,, lluuss aapppprrooffoonnddiieess ss''iill ccoonnddiittiioonnss qquuaanntt àà dd iill eessttiimmee qquu''uunn err oouu ppoouurr nntt cceess ccoonnttrrôôlleess,, uu ppoouurr nnoottrree ppaarrtt eesstt llee ddeess nnaavviirreess ppaarr ''OOMMII.. ee EEuurrooppééeennnnee rreellaattiivvee ooppoossiittiioonn ddee ééeess àà llaa ssuuiittee dduu ddiirreeccttiivvee ccoonncceerrnneenntt ooiixx ddeess nnaavviirreess nnee ssoonntt eess dd''ââggee dduu nnaavviirree,, dduu nnnnee àà cceerrttaaiinnss nnaavviirreess onn rrééggiioonnaallee eennttrree lleess ss ddee vviissiittee ddeess nnaavviirreess mmuumm ddee nnaavviirreess.. LLee 55%% ddee nnaavviirreess ddee ll''aannnnééee.. ddoonnnnééeess ooùù ssoonntt issaattiioonn iimmmmééddiiaattee dduu eessccaallee ddééccllaarrééee.. ppoouurr llaa rrééggiioonn ee)) ppoouurr llaa rrééggiioonn ssuudd ..
  • AAuu nniivveeaauu nnaattiioonnaall lleess mmooddaalliittéé ddiivviissiioonn 115500,, ppaarruuee aauu JJOO llee 2200 ddee SSééccuurriittéé ddeess nnaavviirreess.. bb)) LLeess pprroobbllèèmmeess ddee mmiissee eenn ooee LLeess ddeeuuxx pprroobbllèèmmeess mmaajjeeuurrss rree llee nnoommbbrree ddee ccoonnttrrôôlleess rrééaalliissééss SSuurr llee pprreemmiieerr ppooiinntt llaa FFrraannccee,, ffaaiissaanntt eessccaallee ddaannss uunn ddeess sseess nnoovveemmbbrree 22000022 eellllee nn''aavvaaiitt eeffffeeccttuuéé qquu''eennvviirroonn 1122%% dd''iinnsspp nn''aavvaaiieenntt ppaass aatttteeiinntt lleess 1100%%.. LL nn''aavvaaiieenntt ppaass aatttteeiinntt llee qquuoottaa dd EEnn aavvrriill 22000033 llaa FFrraannccee aavvaaiitt rréé uunn ppoorrtt FFrraannççaaiiss.. LLeess rreemmoonnttrraa ffaaiitt ggéénnéérraatteeuurr ddee cceettttee iimmppoorrtta EEnn ccee qquuii ccoonncceerrnnee llee ddeeuuxxiièèmmee iinnssppeecctteeuurr ddee ccoonnttrrôôlleerr eenn uunnee ssttrruuccttuurree mmêêmmee dduu nnaavviirree cc''eesstt nnaavviirree.. AAiinnssii ll''iinnssppeeccttiioonn eesstt pplluu aamméélliioorraattiioonn ééttaanntt llaa pprriissee eenn cc uunn ffaacctteeuurr ddee rriissqquuee,, mmaallhheeuurree mmaajjeeuurrss oonntt ééttéé ccaauusséé ppaarr ddeess IIll eesstt vvrraaii qquuee ll''ééttaatt ddee pprroopprreettéé mmaaiinntteennaannccee dduu nnaavviirree mmaaiiss ddee mmaaqquuiillllaaggee eett ddee nnoommbbrreeuuxx nnaavv pprroopprree eett bbiieenn ppeeiinnttee ssaannss ppoossss UUnn ppeerrssoonnnneell ssoouuss qquuaalliiffiiéé eett ssuu IIll eexxiissttee uunn ffaammeeuuxx aaddaaggee àà bboo eexxccuusseezz mmooii ddeess tteerrmmeess eemmppllooy LLee sseeuull mmooyyeenn ppoouurr ss''aassssuurreerr qq ccoonnttrrôôllee ddeess cceerrttiiffiiccaattss ddee ccllaassss ddrryy ddoocckk,, eett llàà nnoouuss eennttrroonnss ddaa aammeennéé ll''UUnniioonn EEuurrooppééeennnnee àà pprr ttrraannssppaarreennccee ddeess ssoocciiééttééss ddee ccll ((((((((3333333388888888)))))))) :::::::: ddiirreeccttiivvee 22000011//110055//CCEE dd PPoouurr lleess ddeeuuxx ppooiinnttss pprrééccééddeemmmm ssooiitt ssuuffffiissaammmmeenntt nnoommbbrreeuuxx eett rrééeell pprroobbllèèmmee ddee ll''aavveeuu mmêêmmee ddee llaa ccoommmmiissssiioonn eeuurrooppééeennnnee.. ééss eett oobblliiggaattiioonnss dduu MMOOUU PPaarriiss oonntt éét 00 NNoovveemmbbrree 11999966.. CCeess oobblliiggaattiioonnss oonn eeuuvvrree :: eennccoonnttrrééss ddeeppuuiiss ll''iinnssttaauurraattiioonn ddee ccee ss eett ll''eeffffiiccaacciittéé ddee cceess ccoonnttrrôôlleess.. bbiieenn qquuee ss''ééttaanntt eennggaaggééee àà iinnssppeeccttee ppoorrttss,, ss''eesstt mmoonnttrréé pplluuttôôtt mmaauuvvaaiiss éé ppeeccttiioonnss ddee nnaavviirreess,, qquuaanntt àà ll''IIrrllaannddee LLee DDaanneemmaarrkk,, lleess PPaayyss BBaass,, llee PPoorrttuu ddee 2255 %%.. ééaalliisséé llee ccoonnttrrôôllee ddee 3300%% ddeess nnaavviirree anncceess ddee llaa ppaarrtt ddee ll''UUnniioonn eeuurrooppééeennnn taannttee aauuggmmeennttaattiioonn.. ee ppooiinntt,, iill eesstt ttrrèèss ddiiffffiicciillee,, vvooiirr iimmppoo eessccaallee qquuii ppeeuutt nnee dduurreerr qquu'' uunnee ddiizz tt--àà--ddiirree lleess ooeeuuvvrreess vviivveess eett lleess vvaarraa uuss aaxxééee ccoossmmééttiiqquuee eett cceerrttiiffiiccaattss dduu ccoommppttee ddee ll''aassppeecctt mmaannaaggeemmeenntt qquuii eeuusseemmeenntt lleess ddeeuuxx ddeerrnniieerrss éévvèènneemmee ddééffaauuttss ddee ssttrruuccttuurree.. éé eett ddee vvééttuussttéé dduu nnaavviirree ppeeuutt ttrraadduu ee nnoommbbrreeuuxx aarrmmaatteeuurrss ssoonntt ppaassssééss mm vviirreess ppoossssèèddeenntt uunn ppoonntt eett uunnee ccooqquu ssééddeerr uunn qquueellccoonnqquuee ppllaann ddee mmaaiinnttee uuffffiissaammmmeenntt nnoommbbrreeuuxx ppeeuutt rrééaalliisseerr oorrdd ddeess nnaavviirreess qquuii ppeeuutt ttrraadduuiirree cceett oyyééss:: «« ppeeiinnttuurree ssuurr mmeerrddee ééggaall mmeer qquuee llee nnaavviirree ppoossssèèddee ddeess ssttrruuccttuurreess ssee qquuii ffoonntt ssuuiittee aauuxx vviissiitteess ddeess nnaavvii aannss llaa ppoolléémmiiqquuee qquuii ssuuiivvii llee nnaauuffrraagg rrooppoosseerr uunnee ddiirreeccttiivvee qquuii ccoonncceerrnnee uu llaassssiiffiiccaattiioonn ((((((((3333333388888888))))))))........ dduu 1199 ddéécceemmbbrree 22000011 mmeenntt éévvooqquuééss,, iill eesstt aauussssii nnéécceessssaaiirr tt qquuaalliiffiiééss,, ccee qquuii eenn FFrraannccee eett eenn EEuu ddeess mmeemmbbrreess dduu ccoorrppss ddeess aaddmmiinniisst EEnn eeffffeett llaa ccoommmmiissssiioonn eessttiimmaaiitt àà 2277 éttééss rreepprriisseess ppaarr llaa nntt éécchhuueess aauuxx CCeennttrreess ee ssyyssttèèmmee ccoonncceerrnneenntt eerr 2255%% ddeess nnaavviirreess ééllèèvvee eenn 22000022 ;; eenn ee eett àà llaa BBeellggiiqquuee iillss uuggaall eett llaa SSuuèèddee eess ffaaiissaanntt eessccaallee ddaannss nnee oonntt ppeeuutt êêttrree ééttéé llee oossssiibbllee ppoouurr uunn zzaaiinnee dd''hheeuurreess llaa aanngguueess eett lliisssseess dduu nnaavviirree,, llaa pprriinncciippaallee ppeeuutt ééggaalleemmeenntt êêttrree eennttss mmaarriittiimmeess uuiirree ll''ééttaatt ddee mmaaîîttrree ddaannss llee uuee eexxttéérriieeuurree ttrrèèss eennaannccee.. rr ddeess mmiirraacclleess.. t ééttaatt ddee ffaaiitt qquuii ddiitt,, rrddee »» .. ss eenn bboonn ééttaatt rreessttee llee iirreess oouu rrééppaarraattiioonn eenn ggee ddee ll''EERRIIKKAA eett qquuii aa uunnee mmeeiilllleeuurr rree qquuee lleess iinnssppeecctteeuurrss uurrooppee ccoonnssttiittuuee uunn sttrraatteeuurrss mmaarriittiimmeess eett 7700 eenn 22000000 llee nnoommbbrree
  • dd''iinnssppeecctteeuurrss cchhaarrggééss dduu ccoonnttrrôô dd''iinnssppeecctteeuurr mmaarriittiimmee ,, 5544 eenn 22 ((cceerrttaaiinnss cceennttrreess ddee ssééccuurriittéé ddee pprrooppooss ddee JJaaccqquueess LLooiisseeaauu,, pprréé ((AAffccaann)))) ssoonntt ttrroopp ffaaiibblleess ppoouurr mméémmoorreenndduumm ddee PPaarriiss ,, eett ddeerrnn ss''aattttaacchheerr lleess sseerrvviicceess ddee vvaaccaatt qquuii ppeerrmmeett dd''aatttteeiinnddrree lleess ddeeuuxx iinnssppeecctteeuurrss ,,eett dduu ffaaiitt llee nnoommbbrr CCoommmmeenntt ppeeuutt oonn ddééffiinniirr uunn iinnss eesstt tteellllee qquu''iill ss''aaggiitt dd''uunnee ppeettiittee ccoommmmeerrcciiaallee,, ccuuiissiinnee,, hhôôppiittaall,, ee bboorrdd eett iill ffaauuddrraaiitt,, jjee cciittee MMoonnssii ccoollllooqquuee IIMMTTMM oorrggaanniisséé ddaannss llee 22000033,, pplluuss ddee cciinnqq aannss ppoouurr ffoorr dd''uunn ccoonnttrrôôllee dd''uunn nnaavviirree.. CCeellaa ddeemmaannddee dduu tteemmppss eett mmaall nn''eenn llaaiissssee ppaass,, uunnee aauuttrree ssoolluutt qquueellqquueess aannnnééeess ddee nnaavviiggaattiioonn ssaallaaiirree ddeess nnaavviiggaannttss ppoossssééddaann dd''uunn ccoommmmaannddaanntt ssaannss ccoommmmuu VVooiiccii ddoonncc lleess ddiiffffiiccuullttééss rreennccoonn ddee llaa FFrraannccee ppoouurr ll''aapppplliiccaattiioonn dd ((((((((3333333399999999)))))))) :::::::: AAddmmiinniissttrraatteeuurr eenn CChheeff dd DDaannss cceettttee ppaarrttiiee nnoouuss aavvoonnss dd ddaannss llee ccoonnttrrôôllee ddee llaa rréégglleemmeenn ccoommppoossééee qquuee ddee cceess aacctteeuurrss,, m ssééccuurriittéé mmaarriittiimmee nnee ppoouurrrroonntt jj tteecchhnniiqquuee ssooiitt dduu ccôôttéé ééccoonnoommii EEtt cc''eesstt ppeeuutt êêttrree ddee ccee ccôôttéé qquu ccoommppoorrtteemmeenntt ddeess aacctteeuurrss pprriivv mmééddiiaattiiqquuee oouu eenn lleeuurr llaaiissssaanntt l ggéénnéérraallee.. LLee pprroocchhaaiinn cchhaappiittrree sseerraa ddoonncc mmaattiièèrree ddee ssééccuurriittéé mmaarriittiimmee.. CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCOOOOOOOONNNNNNNNDDDDDDDD :::::::: LLLLLLLLEEEEEEEESSSSSSSS OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAA NNoouuss aalllloonnss ttoouutt dd''aabboorrdd ééttuuddiiee ddaannss llee sseecctteeuurr ddee llaa ssééccuurriittéé mm ll''aaccttiioonn ddeess ddiifffféérreennttss aauuttrreess aacc mmêêmmeess.. §§22..11 :: LLEESS SSOOCCIIEETTEESS DDEE CCLLAASSS LLee pprreemmiieerr ddeess aacctteeuurrss pprriivvééss qq mmaarriittiimmee eesstt ddoonncc llaa ssoocciiééttéé ddee vviiss--àà--vviiss ddeess sseerrvviicceess ddeess ééttaattss ôôllee ppaarr ll''EEttaatt dduu ppoorrtt.. PPoouurr llaa FFrraannccee 22000022,, aaiinnssii qquuee lleess mmooyyeennss mmiiss àà lleeuu ee nnaavviirree nn''oonntt mmêêmmee ppaass ddee vvooiittuurree ééssiiddeenntt ddee ll''aassssoocciiaattiioonn ffrraannççaaiissee ddeess ppoouuvvooiirr tteenniirr llee qquuoottaa ddeess eennggaaggeemm nniièèrreemmeenntt llaa ddiirreeccttiioonn ddeess aaffffaaiirreess mm ttaaiirreess rreeccrruuttééss ppaarrmmii lleess ccoommmmaannddaan xx ccrriittèèrreess pprrééccééddeemmmmeenntt cciittééss :: aauuggm rree dd''iinnssppeeccttiioonnss,, eett aavvooiirr ddeess iinnssppeecct ssppeecctteeuurr qquuaalliiffiiéé ?? LLaa ccoommpplleexxiittéé dduu ee vviillllee ;; pprroodduuccttiioonn dd''éélleeccttrriicciittéé,, pprroopp eett ssttaabbiilliittéé dduu nnaavviirree,, ttoouuss cceess ffaacctteeuu iieeuurr BBoottttaallaa GGaammbbeettttaa ((((((((3333333399999999)))))))) lloorrss ddee ss eess llooccaauuxx ddee llaa ffaaccuullttéé ddee ddrrooiitt dd''AAiixx rrmmeerr ddeess iinnssppeecctteeuurrss aapptteess àà ffaaiirree ffaa llhheeuurreeuusseemmeenntt lleess éécchhééaanncceess ddee mméé ttiioonn ééttaanntt ddee rreeccrruutteerr ddeess mmaarriinnss pprroo n dd''eexxppéérriieennccee mmaaiiss iiccii llee pprroobbllèèmmee dd nntt cceettttee eexxppéérriieennccee eesstt cceelluuii dd''uunn sseecc uunnee mmeessuurree aavveecc cceelluuii dd''uunn iinnssppeecctteeuu nnttrrééeess aauu sseeiinn ddee ll''EEuurrooppee eett pplluuss ppaa ddeess ccrriittèèrreess dduu MMeemmoorreenndduumm ddee PPaarr ddeess AAffffaaiirreess MMaarriittiimmeess ddoonncc ééttuuddiiéé lleess aacctteeuurrss iinnssttiittuuttiioonnnneell nnttaattiioonn mmaaiiss llaa cchhaaîînnee ddee ssééccuurriittéé mm mmêêmmee lleess EEttaattss lleess pplluuss ccoonnsscciieenncciiee jjaammaaiiss mmaaîîttrriisseerr ddaannss ssaa ttoottaalliittéé llee pp iiqquuee :: ddeess aacctteeuurrss pprriivvééss oonntt ééggaalleemm uuee llee pplluuss ggrraanndd cchhaannggeemmeenntt aa eeuu lliiee vvééss dduu ttrraannssppoorrtt mmaarriittiimmee ssooiitt ppaarr llee llee bbéénnééffiiccee dduu ddoouuttee ppaarr llee ffaaiitt dd''uunne ccoonnssaaccrréé aauuxx aacctteeuurrss pprriivvééss qquuii oonntt AAAAAAAANNNNNNNNIIIIIIIISSSSSSSSMMMMMMMMEEEEEEEESSSSSSSS PPPPPPPPRRRRRRRRIIIIIIIIVVVVVVVVEEEEEEEESSSSSSSS eerr ll''aaccttiioonn ddee ll''oorrggaanniissmmee pprriivvéé qquuii ttii mmaarriittiimmee,, lleess ssoocciiééttééss ddee ccllaassssiiffiiccaattiioo cctteeuurrss qquuee ssoonntt lleess aaffffrréétteeuurrss eett lleess a SSIIFFIICCAATTIIOONN qquuii ppoossssèèddee uunn rrôôllee àà jjoouueerr eenn mmaattiièè ee ccllaassssiiffiiccaattiioonn dduu ffaaiitt dduu rrôôllee ddee ccoonn ss eett ddeess pprrooffeessssiioonnnneellss.. ee llee nnoommbbrree uurr ddiissppoossiittiioonn ddee ffoonnccttiioonn sseelloonn lleess ss ccaappiittaaiinneess ddee nnaavviirreess mmeennttss pprriiss lloorrss dduu mmaarriittiimmeess aa dduu annttss àà llaa rreettrraaiittee,, ccee gmmeenntteerr llee nnoommbbrree ddeess tteeuurrss qquuaalliiffiiééss ;; uu «« ssyyssttèèmmee nnaavviirree »» ppuullssiioonn,, ooppéérraattiioonn uurrss ssee ssuuppeerrppoosseenntt àà ssoonn iinntteerrvveennttiioonn aauu eenn PPrroovveennccee eenn jjuuiinn aaccee àà llaa ccoommpplleexxiittéé éémmoorreenndduumm ddee PPaarriiss ooffeessssiioonnnneellss aavveecc ddeevviieenntt ééccoonnoommiiqquuee,, llee ccoonndd ccaappiittaaiinnee vvooiirree uurr.. aarrttiiccuulliièèrreemmeenntt aauu sseeiinn rriiss.. llss qquuii jjoouueenntt uunn rrôôllee mmaarriittiimmee nnee ppeeuutt êêttrree eeuuxx eenn mmaattiièèrree ddee pprroobbllèèmmee,, ssooiitt dduu ccôôttéé mmeenntt uunn rrôôllee àà jjoouueerr.. eeuu :: ll''éévvoolluuttiioonn dduu ee ffaaiitt ddee llaa pprreessssiioonn nee pprriissee ddee ccoonnsscciieennccee tt uunn rrôôllee àà jjoouueerr eenn iieenntt llee rrôôllee pprriimmoorrddiiaall oonnss,, aavvaanntt dd'' aannaallyysseerr aarrmmaatteeuurrss eeuuxx-- èèrree ddee ssééccuurriittéé nnsseeiill qquu''eellllee ppoossssèèddee
  • SSoonn ssttaattuutt ttrrèèss ppaarrttiiccuulliieerr eenn ffaa aarrmmaatteeuurrss,, eett ddee ccee ssttaattuutt nnaaiiss qquuee ddooiitt jjoouueerr llaa ssoocciiééttéé ddee ccllaass aa)) PPrréésseennttaattiioonn ddeess ssoocciiééttééss ddee AA ll''oorriiggiinnee,, ffiinn XXIIXX èèmmee ssiièèccllee,, ee rreelleevvaaiieenntt llee nnoommbbrree dd''aacccciiddeenntt ppoouuvvaaiieenntt aaiinnssii sseerrvviirr ddee bbaassee dd llaa ffiiaabbiilliittéé ddeess nnaavviirreess qquuee lleess aa AA ssuuiivvii uunnee éévvoolluuttiioonn tteecchhnniiqquuee mmaarriittiimmee ssuuiittee aauu nnaauuffrraaggee dduu oobblliiggaattooiirreess eett ccoommpplleexxeess.. DDee nnooss jjoouurrss eelllleess ppoossssèèddeenntt ddee rréégglleemmeennttaattiioonn tteecchhnniiqquuee eett ll''aa ppoouurr lleessqquueellss eelllleess ppoossssèèddeenntt uu EEnn FFrraannccee sseeuullee ll''ééttaabblliisssseemmeenntt ccllaassssiiffiiccaattiioonn ddoonntt lleess mmooddaalliittééss ssoocciiééttééss ddee ccllaassssiiffiiccaattiioonn rreetteennuu GGeerrmmaanniisshheerr LLllooyydd eett llee LLllooyydd''ss 114400..11..AA--11.. PPoouurr êêttrree aaggrrééééee ppaarr llaa FFrraannccee,, ccoorrrreessppoonnddrree aauuxx ccrriittèèrreess dd''aaggrr 9944.. 5577//CCEE mmooddiiffiiééee eett nnoottaammmme CCoonncceerrnnaanntt ll''aassppeecctt ddee llaa ccoonnffoo nnéécceessssaaiirree ddee pprréécciisseerr qquuee lleess cc ll''eennttrrééee dd''uunn nnaavviirree ssoouuss ppaavviilllloo CCoommmmiissssiioonn CCeennttrraallee ddee SSééccuurrii uunnee ddeess ssoocciiééttééss ddee ccllaassssiiffiiccaattiioo ((((((((4444444400000000)))))))) :::::::: SSééccuurriittéé ddeess nnaavviirreess,, lleess bb)) DDiiffffiiccuullttééss rreennccoonnttrrééss ppaarr lleess DDeevvaanntt llaa mmuullttiittuuddee ddee ssoocciiééttééss ssiièèccllee,, lleess ssoocciiééttééss lleeaaddeerr eett lleess IInntteerrnnaattiioonnaall AAssssoocciiaattiioonn ooff CCllaa tteecchhnniiqquueess eett dd''iinnssttaauurreerr uunnee cc ccoonnttrrôôllee aauujjoouurrdd''hhuuii 9900 %% dduu ttoo ppoossssèèddee uunn rreepprréésseennttaanntt ppeerrmmaa ccoonnssuullttaattiiff.. EEllllee ssoouummeett sseess mmeemmbbrreess àà uunn ééttéé llee ccaass eenn 11999977 aavveecc ll''eexxcclluuss aaiitt llee mmaaiilllloonn qquuii rrééaalliissee llaa lliiaaiissoonn eenn ssssee lleess pprreemmiièèrreess ddiiffffiiccuullttééss dd''aapppprrééhh ssssiiffiiccaattiioonn.. ee ccllaassssiiffiiccaattiioonn :: eelllleess rrééppoonnddaaiieenntt àà uunnee ddeemmaannddee ddee ttss ssuurr tteell oouu tteell nnaavviirree ddee tteellllee oouu ttee ddee ddoonnnnééeess aauupprrèèss ddeess aassssuurreeuurrss ppoo aassssuurraanncceess pprreennaaiieenntt eenn cchhaarrggee.. ee ddee llaa mmaarriinnee eett uunnee pprriissee ddee ccoonnsscci TTIITTAANNIICC ;; ddeess nnoorrmmeess ddee ccoonnssttrruuccttii eeuuxx ffoonnccttiioonnss,, ll''uunnee ddee ccoonnttrrôôllee dduu rr aauuttrree ddee cceerrttiiffiiccaattiioonn ppoouurr lleess ddiifffféérree uunnee aaccccrrééddiittaattiioonn.. tt dduu cceerrttiiffiiccaatt ddee ffrraanncc bboorrdd aa ééttéé ddéé ss dd''aaggrréémmeenntt ssoonntt rrééggiitt ppaarr llaa ddiivviissiioo uueess ppaarr llaa FFrraannccee ssoonntt llee BBuurreeaauu VVeerr ss rreeggiisstteerr ooff SShhiippppiinngg eett ssoonntt nnoommmméé ,, uunnee ssoocciiééttéé ddee ccllaassssiiffiiccaattiioonn ddooiitt aauu rréémmeenntt ddee llaa CCoommmmiissssiioonn EEuurrooppééeennnn meenntt ssoonn aarrttiiccllee 77.. oorrmmiittéé aauuxx nnoorrmmeess tteecchhnniiqquueess eenn vviigg cceerrttiiffiiccaattss ssttaattuuttaaiirreess ddéélliivvrrééss ppaarr llee oonn FFrraannççaaiiss oouu KKeerrgguueelleenn ss''eeffffeeccttuueenn iittéé mmaaiiss ssuurr llaa bbaassee ddee ddooccuummeennttss ee oonn pprrééccééddeemmmmeenntt cciittééeess.. ss oorrggaanneess tteecchhnniiqquueess,, ppaarruuee aauu JJOO llee ss ssoocciiééttééss ddee ccllaassssiiffiiccaattiioonn :: ss ddee ccllaassssiiffiiccaattiioonnss qquuii ssoonntt aappppaarruuee ss pplluuss sséérriieeuusseess ssee ssoonntt rreeggrroouuppééeess aassssiiffiiccaattiioonn SSoocciieettiieess )) aaffiinn dd''hhaarrmmoonn cchhaarrttee ddee qquuaalliittéé.. CCrrééee llee 1111 sseepptteemm oonnnnaaggee mmoonnddiiaall eett ccllaassssee pplluuss ddee 4466 aanneenntt aauu sseeiinn ddee ll''OOMMII ddeeppuuiiss 11997766 aauuddiitt ttrriieennnnaall qquuii ppeeuutt mmeenneerr àà ll''eexx ssiioonn ssuu PPoolliisshh RReeggiisstteerr.. nnttrree lleess EEttaattss eett lleess hheennssiioonn dduu rrôôllee eexxaaccttee eess aassssuurreeuurrss,, eelllleess eellllee ccoommppaaggnniiee eett oouurr ééttaabblliirr llaa qquuaalliittéé eett ciieennccee ddee llaa ssééccuurriittéé iioonnss ssoonntt ddeevveennuueess rreessppeecctt ddee llaa eennttss ééttaattss dduu ppaavviilllloonn éélléégguuéé aauuxx ssoocciiééttééss ddee oonn 114400 ((((((((4444444400000000))))))))........ LLeess rriittaass ,, llee DDNNVV ,, llee ééeess eenn aannnneexxee uu pprrééaallaabbllee nnee ssuuiivvaanntt llaa ddiirreeccttiivvee gguueeuurr,, iill eesstt ee FFrraannccee lloorrss ddee nntt ttoouutt dd''aabboorrdd eenn eett ppllaann aapppprroouuvvééss ppaarr ee 2200 NNoovveemmbbrree 11999966.. eess mmiilliieeuu dduu XXXXèèmmee aauu sseeiinn ddee ll''IIAACCSS (( nniisseerr lleess rrèègglleess mbbrree 11996688,, ll''IIAACCSS 66000000 nnaavviirreess.. EEllllee eett ééggaalleemmeenntt uunn rrôôllee xxcclluussiioonn,, ccoommmmee cceellaa aa
  • EEllllee rreessppeeccttee lleess nnoorrmmeess ddee qquuaa lleess mmooddaalliittééss ddééccrriitteess eenn aannnneexx SSii lleess ssoocciiééttééss ddee ccllaassssiiffiiccaattiioonnss eelllleess aavvaaiieenntt uunn bbeessooiinn ddee rreeccoo mmaajjeeuurree,, lleess ssoocciiééttééss ddee ccllaassssiiff CCeeccii eesstt ddûû àà lleeuurr ddoouubbllee ssttaattuutt DD''uunn ccôôttéé llaa ssoocciiééttéé ddee ccllaassssiiffiicc cceerrttiiffiiccaattiioonn :: LLeess EEttaattss lleess pplluuss ccoonnffoorrmmiittéé ddeess nnaavviirreess aauuxx rrèègg ddoommaaiinnee ddee llaa cceerrttiiffiiccaattiioonn ppoouur ppaavviilllloonnss ddee cceess ppaayyss.. ((AA nnootteerr dduu cceerrttiiffiiccaatt ddee ffrraanncc bboorrdd aauuxx ccllaassssiiffiiccaattiioonn nnee ddeevvrraaiitt ppaass ppooss eett ccee aaffiinn ddee ccoonnsseerrvveerr uunnee eenntt HHoorrss cc''eesstt ll''aarrmmaatteeuurr qquuii cchhooiissii ll''EEttaatt dduu ppaavviilllloonn aarrbboorréé ppaarr llee pprreessttaattiioonnss ddee cceettttee ssoocciiééttéé.. EEtt llàà nnoouuss ppéénnééttrroonnss ddaannss llee ddoo ééqquuiivvaauutt àà pplluuss ddee cchhaannccee dd''oobb pplluuss ccee pprreessttaattaaiirree ddee sseerrvviiccee qq aaiisséémmeenntt llaa pprreessssiioonn àà llaaqquueellllee ccoommppaaggnniiee dd''uunnee vviinnggttaaiinnee ddee nn ccllaassssiiffiiccaattiioonn ppoouurr ttoouuss lleess nnaavvii IIll eesstt ddee nnoottoorriiééttéé mmaarriittiimmee qquuee cc''eesstt bbiieenn ssoouuvveenntt qquu''iill nnee rreesspp dd''aannnnééee ssooiitt eenn tteerrmmee tteecchhnniiqquu ssoonn sséérriieeuuxx ppoouurr uunn ccllaassssee ddiissoo ccoonnttiinnuueerr àà eexxppllooiitteerr ssoonn nnaavviirree mmaarriittiimmee mmooiinnss ssoouummiissee àà llaa rrii CCee cchhaannggeemmeenntt ppeeuutt aauussssii êêttrree ll''aarrmmaatteeuurr aavveecc llaa ssoocciiééttéé ddee ccll RRIINNAA eenn 11999988 ssuuiittee àà llaa ddéécciissiioo bbaasséé eenn IIttaalliiee.. CC''eesstt ddaannss cceett eennvviirroonnnneemmeenntt qq ddeevvaanntt,, àà pprriioorrii,, pplluuss êêttrree vviiccttiimm ddee qquuaalliittéé.. IIll nn''eenn ddeemmeeuurree ppaass tteell qquuee ddééccrriitt pprrééccééddeemmmmeenntt mm aassssuurraanncceess.. CC''eesstt aaiinnssii qquuee ll''IIAACCSS aa ééttéé éébbrr ccllaassssiiffiiccaattiioonn qquuii aavvaaiitt ssuuiivvii qquuee llaa RRIINNAA,, ssoocciiééttéé ffaaiissaanntt ppaarrttii ddee DDeeppuuiiss ll''EErriikkaa lleess ssoocciiééttééss ddee ccll eenn vvuuee dd''uunnee ttrraannssppaarreennccee ttoottaa aalliittéé EENN 4455000044 ((oorrggaanniissmmee ddee ccoonnttrrôô xxee ddee llaa rrééssoolluuttiioonn AA774499//119911.. ss oonntt eeuu llee bbeessooiinn ddee ssee rreeggrroouuppeerr aa oonnnnaaiissssaannccee.. EEnn eeffffeett lloorrss ddee cchhaaqquuee ffiiccaattiioonn ssoonntt mmoonnttrrééeess dduu ddooiiggtt.. tt :: ccaattiioonn eesstt aaccccrrééddiittééee ppaarr lleess EEttaattss ppoo ss llaaxxiisstteess oouu lleess mmooiinnss ééqquuiippééss ppoouurr gglleess ddee ssééccuurriittéé eenn vviigguueeuurr oonntt qquuaassii rr ééttaabblliirr lleess cceerrttiiffiiccaattss ddee nnaavviiggaattiioonn qquuee llaa FFrraannccee nn''aa ddéélléégguuéé àà ccee jjoouurr ssoocciiééttééss ddee ccllaassssiiffiiccaattiioonn..)).. AA ccee ttiittrree ssssééddeerr ddee lliieenn ddiirreeccttee aavveecc lleess aarrmmaa ttiièèrree iinnddééppeennddaannccee.. i ddaannss llaa lliissttee ddeess ssoocciiééttééss ddee ccllaassssiiffii nnaavviirree,, llaa ssoocciiééttéé ddee ccllaassssiiffiiccaattiioonn,, ee oommaaiinnee bbiieenn ccoonnnnuu ddee llaa ccoonnccuurrrreenncc bbtteenniirr llee ccoonnttrraatt mmaaiiss pprreessttaattiioonn ddee mm qquuii iinnssppeeccttee eett nnoottee ssoonn cclliieenntt.. LL''oonn pp ppeeuutt êêttrree ssoouummiiss uunn rreepprréésseennttaanntt dd nnaavviirree ppeeuutt,, àà ttoouutt iinnssttaanntt ,, cchhaannggeerr iirreess ddee llaa fflloottttee.. ee lloorrssqquu''uunn nnaavviirree cchhaannggee ddee ssoocciiééttéé ppeeccttee pplluuss lleess nnoorrmmeess ddee ssééccuurriittéé mmaa uuee,, llee cchhaannggeemmeenntt ddee ccllaassssee dd''uunnee ccll oonnss mmooiinnss ssccrruuppuulleeuussee ppeerrmmeett aalloorrss ee qquueellqquueeffooiiss eenn llee rreeppoossiittiioonnnnaanntt ddaa igguueeuurr ddee ll''EEuurrooppee eett ddeess EEttaattss--UUnniiss.. ee llee rrééssuullttaatt ddeess rreellaattiioonnss eennttrreetteennuu llaassssiiffiiccaattiioonn :: ll''EERRIIKKAA eesstt ppaasssséé dduu BB oonn ddee llaa ssoocciiééttéé ddee ggéérraannccee mmaarriittiimmee qquuee ll''IIAACCSS aa ééttéé ccrrééééee,, lleess mmeemmbbrreess mmeess ddee ssuussppiicciioonn ppuuiissqquuee rrééppoonnddaanntt ss mmooiinnss qquuee cceess ssoocciiééttééss ssoonntt ssoouummii mmaaiiss ppoossssèèddee ttoouutt ddee mmêêmmee pplluuss ddee c rraannlléé ppaarr ll''aaffffaaiirree ddee ll''EERRIIKKAA,, ccaarr llaa ss eellqquueess mmooiiss aauuppaarraavvaanntt eenn aarrrrêêtt tteecc ee ll''IIAACCSS.. llaassssiiffiiccaattiioonn ffoonntt ll''oobbjjeett dd''uunnee ddiirreeccttii aallee ddee llaa qquuaalliittéé ddeess ssoocciiééttééss ddee ccllaass ôôllee)) eett EENN 2299000011 eett aauu sseeiinn ddee ll''IIAACCSS cc''eesstt ccaattaassttrroopphhee mmaarriittiimmee oouurr lleess bbeessooiinnss ddee ffaaiirree vvéérriiffiieerr llaa iimmeenntt ddééllaaiisssséé llee nn ddeess nnaavviirreess bbaattttaanntt rr qquuee ll''ééttaabblliisssseemmeenntt ee lleess ssoocciiééttééss ddee aatteeuurrss ddee cceess nnaavviirreess iiccaattiioonn aaggrrééééeess ppaarr eett qquuii ddee pplluuss ppaayyee lleess ccee :: pprriixx ffaaiibbllee mmooiinnddrree qquuaalliittéé.. DDee ppeeuutt vvooiirr aalloorrss ddee llaa ccllaassssee lloorrssqquu''uunnee rr ddee ssoocciiééttééss ddee éé ddee ccllaassssiiffiiccaattiioonn aarriittiimmee ssooiitt eenn tteerrmmee llaassssee rrééppuuttééee ppoouurr àà ll''aarrmmaatteeuurr ddee aannss uunnee zzoonnee .. ddee lloonngguuee ddaattee ppaarr BBuurreeaauu VVeerriittaass aauu ee PPAANNSSHHIIPP qquuii eesstt ss ddee cceellllee--ccii nnee tt àà ddeess ccrriittèèrreess éélleevvééss iisseess àà ll''eennvviirroonnnneemmeenntt ccrrééddiitt vviiss--àà--vviiss ddeess ssoocciiééttéé ddee cchhnniiqquuee llee nnaavviirree ééttaaiitt iivvee ddee ll''EEuurrooppee ((((((((4444444411111111)))))))) sssiiffiiccaattiioonn..
  • LLeess ssoocciiééttééss ddee ccllaassssiiffiiccaattiioonn,, mm iimmppoorrttaanntt ddaannss llee pprroocceessssuuss ddee aacctteeuurrss,, eennccoorree pplluuss pprroocchheess dduu ((((((((4444444411111111)))))))) :::::::: ddiirreeccttiivvee 22000011//110055//CCEE dd §§22..22 :: LLEESS AAUUTTRREESS AACCTTEEUURRSS :: aa)) LLeess aarrmmaatteeuurrss :: DDee llaa mmeennttaalliittéé ddeess aarrmmaatteeuurrss mmaarriittiimmee eett llee ffaacctteeuurr llee pplluuss iimm llaa qquuaalliittéé ddee ll''aarrmmaatteeuurr eett cceellaa ll''aaffffrréétteeuurr.. IIll yy aa aauujjoouurrdd''hhuuii uunn nnoorrmmeess.. MMaallhheeuurreeuusseemmeenntt ccee ss ffoonntt ccoorrrreecctteemmeenntt lleeuurr ttrraavvaaiill (((((((( LLee mmiilliieeuu dduu ttrraannssppoorrtt mmaarriittiimmee aarrmmaatteeuurrss nn''ééttaanntt ppaass aallttrruuiissttee ggrroossssiièèrreemmeenntt ppeeuutt ssee ttrraadduuiirree lleess cchhaarrggeess ddee ffoonnccttiioonnnneemmeenntt ccoonnssttaattéé ddaannss ll''ééttuuddee dduu ccoonntteexx ccooûûttss ddee ffoonnccttiioonnnneemmeenntt eett bbiiee rrééaalliisseerr cceett oobbjjeeccttiiff.. MMaaiiss iill nnee ffaauutt ppaass nnoonn pplluuss ggéénn ppaavviilllloonn nnaattiioonnaall eett iinnvveerrsseemmeenn ddee bboonnss vvooiirree dd''eexxcceelllleennttss aarrmmaa ffoorrmmuullee aaffiinn ddee bbéénnééffiicciieerr dd''aavvaa ééccoonnoommiieess aaiinnssii rrééaalliissééeess.. EEtt mmoonnssiieeuurr VVaallllaatt ddee ppoouurrssuuiivvrr ssoouuss ppaavviilllloonn ddee ccoommppllaaiissaannccee nn mmaauuvvaaiiss vvoonntt ssoouuss ppaavviilllloonn ddee c CCeeppeennddaanntt llaa ssiittuuaattiioonn aa éévvoolluuéé rrôôllee dd''aaccccéélléérraatteeuurr ttrrèèss iimmppoorrttaa ssééccuurriittéé mmaarriittiimmee,, ppoouusssséé ppaarr ll ssuurr llee mmaarrcchhéé dduu ffrreett qquueellqquuee cc ddeess ttaauuxx ddee ffrreett ((eennvviirroonn uunn ddoo nnoouuvveeaauu aasssseezz ppoouurr aassssuurreerr llaa ((((((((4444444422222222)))))))) :::::::: pprrooppooss ddee MMoonnssiieeuurr VVaallllaa oorrggaanniissééssee àà TToouulloonn ppaarr ll''IInnssttiitt DDee pplluuss llaa mmiissee ffiinnaanncciièèrree eesstt éé mmaarrcchhéé qquuee ll''oonn ttrroouuvvee lleess aarrmm qquuaalliittéé dd''eexxppllooiittaattiioonn.. CC''eesstt ééggaa eennttrreetteenniirr ccoommmmee iill llee ffaauuddrraaiitt mmaallggrréé lleeuurr ssttaattuutt aammbbiigguuëë ppoossssèèddee ee rreessppeecctt ddee llaa rréégglleemmeennttaattiioonn eenn ppllaa uu pprroobbllèèmmee ,, yy jjoouueenntt uunn rrôôllee iimmppoorrt dduu 1199 ddéécceemmbbrree 22000011 :: ddééppeenndd llaa qquuaalliittéé dduu sseecctteeuurr mmaarriittiimm mmppoorrttaanntt aauu rreeggaarrdd ddee llaa ssééccuurriittéé mm ddooiitt dd__vveenniirr llee ffaacctteeuurr eesssseennttiieell ddaann nn mmaaxxiimmuumm ddee 1100 àà 1155%% ddee ppééttrroolliiee ssoonntt eeuuxx qquuii ffoonntt llee mmaarrcchhéé aauu mméépprr ((((((((4444444422222222)))))))).. ee ééttaanntt uunn mmiilliieeuu ssoouummiiss àà llaa ccoonnccuurr eess,, ll''eennsseemmbbllee dduu ssyyssttèèmmee eesstt ffoonnddéé ee ppaarr llaa ssoouussttrraaccttiioonn dduu bbéénnééffiiccee ttiirréé eett dd''eennttrreettiieenn ddeess nnaavviirreess.. CCoommmmee xxttee ééccoonnoommiiqquuee,, lleess aarrmmaatteeuurrss ssoonntt eenn ssoouuvveenntt cchhooiissiisssseenntt llee ppaavviilllloonn qquui nnéérraalliisseerr.. OOnn ttrroouuvvee aauussssii ddee mmaauuvvaa nntt iill yy aa ddeess EEttaattss pplluuss llaaxxiisstteess qquuee dd aatteeuurrss ssoouuss ppaavviilllloonn ddee ccoommppllaaiissaanncce aannttaaggeess ffiissccaauuxx mmaaiiss rrééiinnvveessttiisssseenntt rree :: «« PPoouurr ccaarriiccaattuurreerr jjee ddiirraaiiss qquuee nnee ssoonntt ppaass ddee mmaauuvvaaiiss aarrmmaatteeuurrss mm ccoommppllaaiissaannccee.. »» éé cceess ddeerrnniieerrss tteemmppss,, ll''aacccciiddeenntt ddee ll'' aanntt ddaannss llaa pprriissee ddee ccoonnsscciieennccee ddee llaa llaa pprreessssiioonn ddee ll''ooppiinniioonn ppuubblliiqquuee.. IIll ss cchhoossee ddee nnoouuvveeaauu :: uunn rreenncchhéérriisssseemm oouubblleemmeenntt)) eett ttoouuss lleess aarrmmaatteeuurrss ppéé ssééccuurriittéé.. aatt lloorrss ddeess ddeerrnniièèrreess jjoouurrnnééeess nnaattiioonn ttuutt FFrraannççaaiiss ddee llaa MMeerr lleess 77 eett 88 nnoovvee éélleevvééee ssuurr lleess vviieeuuxx nnaavviirreess,, cc''eesstt ddaa mmaatteeuurrss ssppééccuullaatteeuurrss qquuii ccoonnssiiddèèrreenntt aalleemmeenntt vvrraaii qquuee llaa tteennttaattiioonn eesstt ffoorrt uunn nnaavviirree qquuii aarrrriivvee eenn ffiinn ddee vviiee.. ddoonncc uunn rrôôllee aaccee mmaaiiss dd''aauuttrreess rttaanntt.. mmee eett ddoonncc llaa ssééccuurriittéé mmaarriittiimmee ddeemmeeuurree aaiinnssii nnss llee cchhooiixx ddee eerrss qquuii ssoonntt ssoouuss rriiss ddeess 8855 àà 9900%% qquuii rrrreennccee eett lleess ssuurr llaa rreennttaabbiilliittéé qquuii é dduu ttrraannssppoorrtt mmooiinnss nnoouuss ll''aavvoonnss ddééjjàà tt tteennttééss ddee rréédduuiirree lleess uii lleeuurr ppeerrmmeettttee ddee aaiiss aarrmmaatteeuurrss ssoouuss dd''aauuttrreess eett ll''oonn ttrroouuvvee cee.. IIll cchhooiissiisssseenntt cceettttee llee pplluuss ssoouuvveenntt lleess ttoouuss lleess aarrmmaatteeuurrss mmaaiiss qquuee ttoouuss lleess ''EErriikkaa aayyaanntt jjoouuéé uunn aa nnéécceessssiittéé dd''uunnee ssee ppaassssee aauujjoouurrdd''hhuuii mmeenntt ttrrèèss iimmppoorrttaanntt ééttrroolliieerrss ggaaggnneenntt àà nnaalleess ddee llaa mmeerr eemmbbrree 22000022 aannss ccee sseeggmmeenntt ddee tt ccoommmmee sseeccoonnddaaiirree llaa rttee ddee nnee pplluuss
  • CC''eesstt aaiinnssii qquu''aavveecc llee rreennoouuvveellllee ddoouubbllee ccooqquuee,, lleess aarrmmaatteeuurrss pprr ccoonnvveennaabblleemmeenntt aaffiinn ddee ppoouuvvooii aannnnééeess dd''eexxppllooiittaattiioonnss.. UUnnee ddeess ssoolluuttiioonnss aauu pprroobbllèèmmee rreessppeecctt ddee ttoouuss ddee ll''eennsseemmbbllee dd ll''OOrrggaanniissaattiioonn mmaarriittiimmee iinntteerrnnaa ll''aassssoocciiaattiioonn ddeess aarrmmaatteeuurrss ddee oonntt mmêêmmee aannttiicciippéé llaa mmiissee eenn oo ssiimmppllee ccooqquuee,, llaa mmooiittiiéé ddee llaa fflloo aannss.. LL''ââggee mmooyyeenn aa bbaaiisssséé,, eenn aannss,, ffaaiissaanntt ddee llaa fflloottttee ppééttrroolliièè LLaa ddeeuuxxiièèmmee ssoolluuttiioonn eesstt éénnoonncc «« LLeess aarrmmaatteeuurrss FFrraannççaaiiss ss''eenngg TTRRAANNSSPPOORRTT MMAARRIITTIIMMEE AA SSOONN ffaauutt rreessppoonnssaabbiilliisseerr lleess aaffffrréétteeuu ttrroouuvvaaiieenntt ppeerrssoonnnnee ppoouurr lleess aaff pprriixx eett ppaass cceelluuii ddee ll''iinntteerrvveennaann llee rrôôllee tteennuu ppaarr lleess aaffffrréétteeuurrss.. bb)) LLeess aaffffrréétteeuurrss :: LL''aaffffrrèètteemmeenntt eesstt llee ssyyssttèèmmee llee ttrraannssppoorrtt ddee pprroodduuiittss cchhiimmiiqquueess nnoommbbrreeuusseess «« mmaajjoorrss »» ppoosssséédd ll''ééccoonnoommiiee ddee mmaarrcchhéé jjoouuaaiitt uunn ttrraannssppoorrtteerr lleeuurr pprroopprree pprroodduuiitt mmoommeenntt,, qquuiittttee àà llaaiisssseerr cceerrttaaiinn ((((((((4444444433333333)))))))) :::::::: VVooiirr ll''AAnntteennnnee ééddiittiioonn dduu uunniittééss eenn aatttteennttee aauu mmoouuiillllaaggee aauuggmmeennttee eett àà ccee mmoommeenntt ddee rr DDeeppuuiiss llaa ccaattaassttrroopphhee ddee ll''EEXXXXOO mmaannaaggeemmeenntt ddee nnaavviirree ppoouurr ssee ll''aavvaannttaaggee,, àà pprriioorrii,, ddee pprroottééggee dd''uunnee ccaattaassttrroopphhee mmaarriittiimmee.. IIll ss''eesstt aavvéérréé qquu''iill nn''eenn ééttaaiitt rriiee ddee ll''EERRIIKKAA.. LLee ppoouuvvooiirr ddeess aaffffrréétteeuurrss eesstt iimm ll''OOPPAA9900 ddeess aamméérriiccaaiinnss ssii pprroomm dduu pprreemmiièèrree éécchheelloonn ddee llaa cchhaaîînn mmaaiiss eenn aauuccuunn ccaass ll''aaffffrréétteeuurr.. AA llaa ssuuiittee ddee ll''EEXXXXOONN VVAALLDDEEZZ,, lleessqquueellss eellllee ttrraavvaaiillllaaiitt ddeess ssttaann qquueessttiioonnnnaaiirree àà tteenniirr àà jjoouurr eett dd ppééttrroolliièèrreess oonntt ssuuiivvii eett llee ssyyssttèèmm eemmeenntt qquuaassii iimmppoosséé ddee llaa fflloottttee ppééttrr rroopprriiééttaaiirreess ddee cceess uunniittééss rréécceenntteess llee iirr lleess rreevveennddrree aavveecc uunnee pplluuss vvaalluuee aa ddee «« ll''iinnssééccuurriittéé mmaarriittiimmee »» ccoonnssiisstt ddeess rrèègglleess ddéécciiddééeess ppaarr ll''UUnniioonn eeuurroo aattiioonnaallee,, cc''eesstt uunnee ddeess rreevveennddiiccaattiioonn FFrraannccee ((((((((4444444433333333)))))))) ffaaiissaanntt rreemmaarrqquueerr qquuee ll ooeeuuvvrree ddee ll''éélliimmiinnaattiioonn ddeess nnaavviirreess pp oottttee ppééttrroolliièèrree ffrraannççaaiissee aayyaanntt ééttéé rree ttrrooiiss aannss,, ddee pplluuss ddee cciinnqq aannss,, iill eesstt èèrree ffrraannççaaiissee uunnee ddeess pplluuss jjeeuunneess aauu ccéé ppaarr AArrmmaatteeuurr ddee FFrraannccee ddaannss ssoonn ggaaggeenntt eenn ffaavveeuurr ddee llaa ssééccuurriittéé mmaarriitt JJUUSSTTEE PPRRIIXX :: cceelluuii ddee llaa QQUUAALLIITTEE eett uurrss.. LLeess nnaavviirreess ssoouuss nnoorrmmeess nn''eexxiisstt ffffrréétteerr.. LLee ttrraannssppoorrtt mmaarriittiimmee ddooiitt êê nntt llee mmooiinnss ssccrruuppuulleeuuxx.. IIll ss''aaggiitt ddoonncc ee pplluuss rrééppaanndduu ddaannss llee ttrraannssppoorrtt dd''hhyy ss.. PPoouurr llee ccaass dduu ttrraannssppoorrtt dd''hhyyddrroocca ddaaiieenntt lleeuurr pprroopprree fflloottttee ddee ppééttrroolliieerrss nn ggrraanndd rrôôllee ccaarr llee bbuutt ddeess mmaajjoorrss nn'' mmaaiiss ddee ppoossssééddeerr ddeess ppééttrroolliieerrss aauu nneess uu 2211 NNoovveemmbbrree 22000022 ppeennddaanntt ddee lloonngguuee ppéérriiooddee,, llee tteemmpp rreemmeettttrree cceess uunniittééss ssuurr llee mmaarrcchhéé ddee OONN VVAALLDDEEZZ,, lleess mmaajjoorrss ssee ssoonntt ddééssee ee ttoouurrnneerr eexxcclluussiivveemmeenntt vveerrss ll''aaffffrrèètte eerr ssuurr llee ppllaann mmééddiiaattiiqquuee llaa ccoommppaaggnn eenn eett TTOOTTAALL eenn aa ssuubbiitt lleess ccoonnssééqquueenn mmppoorrttaanntt dd''uunn ppooiinntt ddee vvuuee ééccoonnoommiiqq mmpptt aauu pprriinncciippee ddee ppoolllluueeuurr//ppaayyeeuurr,, nn nnee ddee ccoonnttrraatt :: cc''eesstt llee ttrraannssppoorrtteeuurr llaa ccoommppaaggnniiee EEXXXXOONN aa iimmppoosséé àà ttoo nnddaarrddss tteecchhnniiqquueess eett ddee mmaannaaggeemmeenn ddeess iinnssppeeccttiioonnss.. PPaarr llaa ssuuiittee lleess aauuttrr mmee ddee vveettttiinngg ss''eesstt iinnssttaauurréé :: iill ppeerrmm rroolliièèrree ppaarr ddeess nnaavviirreess eess eennttrreettiieennnneenntt aapprrèèss qquueellqquueess ttee ddoonncc bbiieenn eenn uunn ooppééeennnnee eett nss pprreemmiièèrree ddee lleess aarrmmaatteeuurrss ffrraannççaaiiss ppééttrroolliieerrss ffrraannççaaiiss àà eennoouuvveellééee eenn ttrrooiiss aauujjoouurrdd''hhuuii ddee hhuuiitt uu mmoonnddee.. nn ddoossssiieerr ddee pprreessssee ttiimmee »» :: PPAAYYEERR llee tt ddee llaa SSEECCUURRIITTEE.. IIll tteerraaiieenntt ppaass ss''iillss nnee êêttrree ppaayyéé àà ssoonn jjuussttee cc dd''ééttuuddiieerr mmaaiinntteennaanntt yyddrrooccaarrbbuurree eett llee caarrbbuurree,, ddee ss mmaaiiss ddééjjàà ''ééttaaiieenntt ppaass ddee bboonn eennddrrooiitt eett aauu bboonn ppss qquuee llee ttaauuxx ddee ffrreett ee ll''aaffffrrèètteemmeenntt.. eennggaaggééeess dduu teemmeenntt :: ccee ssyyssttèèmmee aa nniiee ppééttrroolliièèrree lloorrss nncceess lloorrss dduu nnaauuffrraaggee qquuee eett llee ssyyssttèèmmee ddee nn''aa ppaass ppaasssséé llee ssttaaddee rr qquuii eesstt rreessppoonnssaabbllee oouuss lleess ffrréétteeuurrss aavveecc nntt ttrrèèss éélleevvééss aavveecc uunn rreess ccoommppaaggnniieess mmeett aauu ccoommppaaggnniiee
  • ppééttrroolliièèrree qquuii vveeuulleenntt aaffffrréétteerr uu tteecchhnniiqquuee dduu nnaavviirree eett llaa qquuaalliitt EEnn ffaaiitt lleess qquueessttiioonnnnaaiirreess vveettttiinn MMOOUU (( ccoonnttrrôôllee ddee llaa vvaalliiddiittéé ddee aappppaarreeiillss eett dduu rreessppeecctt ddee llaa sséé ddiifffféérreenntteess ccoonnvveennttiioonnss OOMMII ssuu ssuuppéérriieeuurrss àà cceess mmiinniimmaa ;; cc''eesstt ccee ssyyssttèèmmee ddee ccoonnttrrôôllee ddeess nnaavv ssttaaddee vveerrss ll''éélliimmiinnaattiioonn ddeess nnaavv ppééttrroolliièèrreess aaiieenntt ffaaiitt pprreessssiioonn aa rreessppoonnssaabbllee eenn ccaass ddee ppoolllluuttiioonn ffaaiitt ppaarrttiiee ddeess pprrééooccccuuppaattiioonnss dd dd''uunnee mmééddiiaattiissaattiioonn mmoonnddiiaallee .. LL''ééttuuddee ddee cceettttee pprreemmiièèrree ppaarrttii ddaannss lleeqquueell llaa vvoolloonnttéé dd''aaggiirr eenn ppaarrttaaggééee ppaarr ttoouuss lleess aacctteeuurrss dd NNoouuss aalllloonnss mmaaiinntteennaanntt ééttuuddiieerr aauu sseeiinn ddeess iinnssttaanncceess iinntteerrggoouuvv mmaarriittiimmee,, ddoommaaiinnee qquuii ddééccoouullee ssééccuurriittéé eexxttéérriieeuurree aauu nnaavviirree qquu DDDDDDDDEEEEEEEEUUUUUUUUXXXXXXXXIIIIIIIIEEEEEEEEMMMMMMMMEEEEEEEE PPPPPPPPAAAAAAAARRRRRRRRTTTTTTTT IIIIIIIIDDDDDDDDEEEEEEEEEEEEEEEE DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA SSSSSSSSEEEEEEEECCCCCCCC SSSSSSSSUUUUUUUURRRRRRRREEEEEEEETTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIII LLaa pprréésseennttee ppaarrttiiee ttrraaiittee ddee llaa nn CCeettttee nnoottiioonn ddee ssûûrreettéé ddaannss llee s eenn eeffffeett jjuussqquu''àà ccee qquuee lleess EEttaatt nnaavviirree ppeeuutt ddeevveenniirr uunnee aarrmmee pp mmaassssiivvee,, cceettttee iiddééee ddee ssûûrreettéé nn ppiirraatteerriieess ffrrééqquueennttss ddaannss cceerrttaaii NNoouuss aalllloonnss ddoonncc ddééccoouuvvrriirr ddaann qquuii ttrraaiittee ddee cceettttee nnoottiioonn ddee ssûûr qquuee ppeeuuvveenntt rreennccoonnttrreerr lleess ddiiffff nnaattiioonnaall qquuee ssuurr llee ppllaann pprriivvéé pp ddiissppoossiittiioonnss.. SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: EEEEEEEEMMMMMMMMEEEEEEEERRRRRRRRGGGGGGGGEEEEEEEE SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: LLLLLLLLEEEEEEEE CCCCCCCCOOOOOOOONNNNNNNNTTTTTTTT LLaa ddaattee dduu 1111 sseepptteemmbbrree 22000011 mmaarriittiimmee,, ll''OOMMII ééttaanntt iinntteerrppeelllléé uunn nnaavviirree ssooiitt àà tteemmppss,, ssooiitt aauu vvooyyaagg ttéé ddee ssoonn ééqquuiippaaggee eett ddee ssoonn mmaannaagg nngg ssoonntt eenn qquueellqquueess ssoorrtteess uunnee rrééppéé eess cceerrttiiffiiccaattss,, ccoonnttrrôôllee ddee ll''ééttaatt ddee ffoo ééccuurriittéé àà bboorrdd )).. IIllss rreepprreennnneenntt ddoonncc uurr llaa ssééccuurriittéé mmaaiiss iimmppoossee ssoouuvveenntt éé tt llee ccaass ddeess ssttaannddaarrddss ppoouurr llaa ttiimmeecchh vviirreess ppaarr lleess aaffffrréétteeuurrss àà ppeerrmmiiss ddee ff vviirreess ssoouuss nnoorrmmeess mmaaiiss llee ffaaiitt qquuee llee aauupprrèèss ddeess sséénnaatteeuurrss aamméérriiccaaiinnss ppoouu nn ddaannss llee ccaaddrree ddee ll''OOPPAA ddéémmoonnttrree bb ddeess aaffffrréétteeuurrss qquuee ccoommmmee ccoonnssééqquuee iiee aa ddoonncc ééttéé ccoonnssaaccrrééee àà llaa ssééccuurriittéé nn ffaavveeuurr dd''uunnee aamméélliioorraattiioonn nn''aa qquuee tt dduu mmiilliieeuu mmaarriittiimmee aauu mmêêmmee iinnssttaanntt. rr uunn ddoommaaiinnee qquuii qquuaanntt àà lluuii ffaaiitt mmaa vveerrnneemmeennttaalleess eett ddeess EEttaattss,, llee sseeccttee ee ddee llaa ssééccuurriittéé mmaarriittiimmee mmaaiiss qquuii ssee uuii ppeeuutt ppaarrffooiiss ddeevveenniirr uunn oouuttiill ddee dd TTTTTTTTIIIIIIIIEEEEEEEE :::::::: VVVVVVVVEEEEEEEERRRRRRRRSSSSSSSS UUUUUUUUNNNNNNNNEEEEEEEE NNNNNNNNOOOO CCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE IIIIIIIIMMMMMMMMEEEEEEEE nnoouuvveellllee nnoottiioonn ddee ssûûrreettéé ddaannss lleess ttrr sseecctteeuurr mmaarriittiimmee eesstt ssuurrttoouutt aaxxééss ssu ttss--UUnniiss aattttiirreenntt ll''aatttteennttiioonn ddee ll''OOMMII ss ppaarr ddeessttiinnaattiioonn,, oouu llee vveecctteeuurr dd''uunnee nn''ééttaaiitt qquuee ttrrèèss ppeeuu eennvviissaaggéé mmaallggrréé iinneess zzoonneess ddee nnaavviiggaattiioonn.. nnss uunn pprreemmiieerr tteemmppss llaa nnoouuvveellllee llééggii ûrreettéé mmaarriittiimmee ppoouurr aannaallyysseerr ppaarr llaa ss fféérreennttss iinntteerrvveennaannttss ttaanntt ssuurr llee ppllaann ppoouurr llaa ttrrèèss pprroocchhaaiinnee mmiissee eenn aapppplliicc EEEEEEEENNNNNNNNCCCCCCCCEEEEEEEE DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA NNNNNNNNOOOOOOOOTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEE TTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEE 1 aa ééttéé uunnee ddaattee cchhaarrnniièèrree ddaannss ll''hhiisstt ééee ssuurr llee ssuujjeett ppaarr lleess EEttaattss--UUnniiss eett cc ggee ddee ccoonnnnaaîîttrree ll''ééttaatt ggeemmeenntt.. ééttiittiioonn dduu ssyyssttèèmmee dduu oonnccttiioonnnneemmeenntt ddeess cc lleess mmiinniimmaa ddeess ééggaalleemmeenntt ddeess ccrriittèèrreess hhaarrttee EEXXXXOONN.. CCeerrtteess ffrraanncchhiirr uunn pprreemmiieerr eess ccoommppaaggnniieess uurr nnee ppaass êêttrree bbiieenn qquuee llaa ssééccuurriittéé nnee eennccee ddee llaa ccrraaiinnttee éé mmaarriittiimmee,, ddoommaaiinnee ttrrèèss rraarreemmeenntt ééttéé t.. aaiinntteennaanntt ll''uunnaanniimmiittéé eeuurr ddee llaa ssûûrreettéé ee pprrééooccccuuppee ddee llaa ddeessttrruuccttiioonn.. NNNNOOOOOOOOUUUUUUUUVVVVVVVVEEEEEEEELLLLLLLLLLLLLLLLEEEEEEEE EEEEEEEE:::::::: LLLLLLLLAAAAAAAA rraannssppoorrttss mmaarriittiimmee.. suurr llee tteerrrroorriissmmee,, ccaarr ssuurr llee ffaaiitt qquuee ttoouutt aarrmmee ddee ddeessttrruuccttiioonn éé lleess aacctteess ddee iissllaattiioonn iinntteerrnnaattiioonnaallee ssuuiittee lleess ddiiffffiiccuullttééss iinntteerrnnaattiioonnaall eett ccaattiioonn ddeess nnoouuvveelllleess EEEEEEEE SSSSSSSSÛÛÛÛÛÛÛÛRRRRRRRREEEEEEEETTTTTTTTEEEEEEEE ttooiirree ddee llaa ssûûrreettéé cc''eesstt aauuttoouurr ddee cceettttee
  • ddaattee qquuee ss''aarrttiiccuulleerraa ll''ééttuuddee ddee ffaaiittss mmaarrqquuaannttss ddaannss ccee ddoommaaiinn ddeess nnoouuvveelllleess ddiissppoossiittiioonnss ddee ll''OO CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRR :::::::: HHHHHHHHIIIIIIIISSSSSSSSTTTTTTTTOOOOOOOORRRRRRRRIIIIIIIIQQQQ LLee mmiilliieeuu mmaarriittiimmee ,, eett iill ffaauutt ss' dd''éévvèènneemmeennttss ssaannggllaannttss qquuee ppee éévvèènneemmeennttss mmaarrqquuaannttss ccoommmmee llaa TTWWAA((((((((4444444444444444)))))))),, lleess aatttteennttaattss ddee LLOO ((((((((4444444444444444)))))))) :::::::: llee 1144 jjuuiinn 11998855 ssuurr BBeeyyrro ((((((((4444444455555555)))))))) :::::::: VVooll ddee llaa PPaannAAMM,, 227700 mmoo ((((((((4444444466666666)))))))) :::::::: 117700 mmoorrttss eenn 11998899 LLee 77 OOccttoobbrree 11998855,, aauu llaarrggee ddee ddééttoouurrnnéé ppaarr uunn ccoommmmaannddoo dduu lleess 445500 ppaassssaaggeerrss.. UUnn ddeess oottaagg sseerraa eexxééccuuttéé ppuuiiss jjeettéé àà llaa mmeerr LL''éélléémmeenntt eesssseennttiieell àà nnoottrree ééttuu tteerrrroorriisstteess oonntt ddééttoouurrnnéé ccee nnaavv EEnn eeffffeett ccee ddééttoouurrnneemmeenntt aavvaaiitt dd''AAsshhddoodd ((((((((4444444477777777)))))))) ssiittuuééee àà ppeeiinnee àà tteerrrroorriisstteess ddeevvaanntt ssee rraavviisseerr aapp aalloorrss qquu''iillss ééttaaiieenntt eenn ttrraaiinn ddee nn vveecctteeuurr ppoouurr aaccccoommpplliirr lleeuurr aacctt LL''iinniittiiaatteeuurr dduu pprroojjeett,, llee tteerrrroorriiss ddeess ffaacciilliittééss dd''eemmbbaarrqquueemmeenntt qq LLaa ddiirreeccttrriiccee ddee bbaalllleettss,, MMaallggoorrzz rraappiiddeess ssaannss ccoonnttrrôôllee ddeess bbaaggaa LLee 1111 JJuuiilllleett 11998888 ,, aauu llaarrggee ddee FFaattaahh CCoonnsseeiill RRéévvoolluuttiioonnnnaaiirree,, ccoonnttrree llee nnaavviirree ggrreecc ddee ppllaaiissaann aauuttrreess bblleessssééss.. AAvvaanntt mmêêmmee ll''aatttteennttaatt ccoonnttrree llee 11999944,, ppeeuu ddee tteemmppss aapprrèèss qquu''uu ppaarrttiirr dduu ttaarrmmaacckk ddee ll''aaéérrooppoorrtt 33 ppaassssaaggeerrss sseerroonntt eexxééccuuttééss (( uu aappppaarraaîîttrree lleess pprreemmiièèrreess mmeessuurr CC''eesstt eenn eeffffeett àà cceettttee ppéérriiooddee ,, ccrrééaa llee ppoossttee dd''ooffffiicciieerr ssûûrreettéé ee ttââttoonnnneemmeenntt ccaarr llee pprroobbllèèmmee dd llee mmiilliieeuu mmaarriittiimmee .. ee cceettttee pprreemmiièèrree ppaarrttiiee aavveecc ttoouutt dd''aab nnee aavvaanntt cceett éévvèènneemmeenntt ttrraaggiiqquuee ssuu OOMMII eenn llaa mmaattiièèrree.. IIIIQQQQQQQQUUUUUUUUEEEEEEEE s''eenn rrééjjoouuiirr,, nnee ddiissppoossee ppaass dd''uunn ppaasss eeuutt ll''êêttrree llee sseecctteeuurr ddee ll''aavviiaattiioonn cciivvii ee oonntt ppuu ll''êêttrree llee ddééttoouurrnneemmeenntt dduu vv OOCCKKEERRBBIIEE ((((((((4444444455555555)))))))) eett dduu DDCC 1100 dd''UUTTAA ((((((((44444444 roouutthh ooùù uunn ppaassssaaggeerr aamméérriiccaaiinn aavvaaii oorrttss eenn 11998888 ee ll''EEggyyppttee ,, llee ppaaqquueebboott IIttaalliieenn ll''AACCHH uu FFrroonntt ddee LLiibbéérraattiioonn ddee llaa PPaalleessttiinnee ggeess,, MMrr LLeeoonn KKlliinngghhooffffeerr,, jjuuiiff ddee nnaattii rr.. uddee qquu''iill ffaauutt rreetteenniirr ddee cceett éévvèènneemmee vviirree ppoouurr ll''uuttiilliisseerr ccoommmmee mmooyyeenn ddee tt ppoouurr oobbjjeeccttiiff pprreemmiieerr ddee ddééttrruuiirree llaa 220000mm dd''uunn ffuuttuurr mmoouuiillllaaggee ddee ll''AACCHH pprrèèss aavvooiirr ééttéé ddééccoouuvveerrtt ppaarr uunn ddeess nneettttooyyeerr lleeuurrss aarrmmeess.. LLee nnaavviirree nn''éétta ttee mmaallvveeiillllaanntt.. ssttee AAbboouu AAll AAbbbbaass,, aavvaaiitt cchhooiissii cceettttee qquu''ooffffrraaiitt llee ppoorrtt ddee GGêênneess eett ééggaalleemm zzaattee PPoottoocckkaa,, ssee ssoouuvviieenntt ddee «« ffoorrmm aaggeess »»..((((((((4444444488888888)))))))) eess ccôôtteess dd''AAtthhèènneess,, uunn ccoommmmaannddoo ddee mmèènnee uunnee aattttaaqquuee aauu ppiissttoolleett mmiittrraai nnccee CCiittyy ooff PPoorrooss ffaaiissaanntt nneeuuff mmoorrttss ee UUSSSS CCOOLLEE eett llee ppééttrroolliieerr FFrraannççaaiiss uunn aaiirrbbuuss ddee llaa ccoommppaaggnniiee AAiirr FFrraannccee t dd''AAllggeerr ppaarr uunn ccoommmmaannddoo,, ddééttoouurrnn uunn ffrraannççaaiiss,, uunn vviieettnnaammiieenn eett uunn aallgg rreess eenn mmaattiièèrree ddee ssûûrreettéé mmaarriittiimmee .. ssuuiittee aauuxx éévvèènneemmeennttss ssaannggllaannttss eenn eett ééggaalleemmeenntt ddeess ppllaannss ddee ssûûrreettéé ééllaa ddee llaa ssûûrreettéé nn''aavvaaiitt eennccoorree qquuee ttrrèèss pp bboorrdd uunn rraappppeell ddeess uuiivvii ddee llaa ddeessccrriippttiioonn ssséé aauussssii ppaarrsseemméé iillee aavveecc ddeess vvooll RRoommee--AAtthhèènneess ddee 4444444466666666))))))))eennttrree aauuttrreess.. iitt ééttéé eexxééccuuttéé HHIILLLLEE LLAAUURROO eesstt qquuii pprreenndd eenn oottaaggee iioonnaalliittéé aamméérriiccaaiinnee eenntt eesstt qquuee lleess ddeessttrruuccttiioonn.. aa bbaassee nnaavvaallee HHIILLLLEE LLAAUURROO,, lleess ggaarrççoonnss dduu nnaavviirree taaiitt eenn ffaaiitt qquu''uunn ee ccrrooiissiièèrree eenn rraaiissoonn mmeenntt dduu ppllaann ddee rroouuttee.. mmaalliittééss ddee ddééppaarrtt ttrrèèss ee ttrrooiiss hhoommmmeess dduu aiilllleeuurr eett àà llaa ggrreennaaddee eett qquuaattrree vviinnggtt oonnzzee LLIIMMBBUURRGG,, eeûûtt lliieeuu eenn ee eesstt ééttaaiitt ddééttoouurrnnéé àà nneemmeenntt ppeennddaanntt lleeqquueell ggéérriieenn )),, nnoouuss vveerrrroonnss n AAllggéérriiee ,,qquuee llaa SSNNCCMM aabboorrééss ppaarr ppeeuu ééttéé éévvooqquuéé ddaannss
  • ((((((((4444444477777777)))))))) :::::::: SSiittuuééee àà 4400 kkiilloommèèttrreess dd ((((((((4444444488888888)))))))) :::::::: LLee nnoouuvveell OObbss,, NNoottrree ééppoo PPaarrmmii lleess mmeessuurreess ddiissssuuaassiivveess llééggiioonnnnaaiirreess àà cchhaaqquuee vvooyyaaggee ss mmiilliittaaiirreess FFrraannççaaiiss eett uunn ooffffiicciieerr mmaattéérriiaauuxx ppoouurr ffiillttrreerr lleess ppaassssaa SSuurr llee ppllaann ppoolliittiiqquuee,, llaa CCoommmmiis 1111 sseepptteemmbbrree 22000011 ddee llaa qquueesstt ttrraannssppoorrttss ((((((((4444444499999999)))))))),, qquuii ffaaiissaaiitt ddééjjàà ppaassssaaggeerrss eemmbbaarrqquuaanntt ssuurr nnaavv SSuurrvviieennnneenntt aalloorrss lleess éévvèènneemmeen ddeeuuxx ttoouurrss dduu WWoorrlldd TTrraaddee CCeenn CCeett éévvèènneemmeenntt ttrraaggiiqquuee aa ffaaiitt pp nn''ééttaaiitt àà ll''aabbrrii dduu tteerrrroorriissmmee eett ppoouuvvaaiieenntt êêttrree uuttiilliissééss àà ddeess ffiinn LL''ooppiinniioonn ppuubblliiqquuee,, ttrrèèss mmaarrqquuéé ddeeuuxx ttoouurrss jjuummeelllleess qquuii ss''eeffffoonndd ccoommmmiiss ccoonnttrree uunn ssuuppeerr ttaannkkeerr nniivveeaauu dd''uunnee ddee cceess ttrraanncchheess dd llaarrggee dduu YYeemmeenn,, llee 66 OOccttoobbrree 22 LLee bbiillaann dd''uunn mmoorrtt aauurraaiitt ppuu êêttrr qquuee ppeeuutt rreepprréésseenntteerr uunn ppééttrroollii mmeennééee àà ssoonn eennccoonnttrree.. AAuu ttrraavveerrss ddee cceettttee éénnuumméérraattiioo mmeennaacceess ppootteennttiieelllleess pprroovveennaann nnaavviirree ppeeuutt ddeevveenniirr uunnee aarrmmee pp mmaassssiivvee,, vvooiirree mmêêmmee llee ttrraannssppo ((((((((4444444499999999)))))))) :::::::: CCOOMM((22000011)) 337700 dduu 1122 ssee LLeess nnaavviirreess ddee ttrraannssppoorrtt ddee ppaass cciibblleess ddiirreecctteess mmaaiiss ttoouutteess ssoorrtt nnaavviirreess ppééttrroolliieerr oouu ggaazziieerr qquuii pp tteerrrroorriisstteess ppoouurrrraaiieenntt êêttrree tteennttéé ooùù ddeess iinnttéérrêêttss ééccoonnoommiiqquueess ssoo eennvviirroonnnneemmeennttaalleess qquuee ll''oonn ppeeuu MMaaiinntteennaanntt nnoouuss ccoommpprreennoonnss mm ccoonnsseennssuuss iinntteerrnnaattiioonnaall mmaaiiss iill ll''eennvviirroonnnneemmeenntt ddee ccee ccoonntteexxttee ééccoonnoommiiqquuee eennggeennddrréé ppaarr llaa ssûû CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE DDDDDDDDEEEEEEEEUUUUUUUUXXXXXXXXIIIIIIIIEEEEEEEEMMMMMMMMEEEEEEEE :::::::: AAAAAAAASSSSSSSSPPPPPPPPEEEEEEEECCCCCCCCTTTTTTTT §§22..11 :: CCOOÛÛTT DDEE LLAA SSUURREETTEE MMAA ddaannss llee ssuudd ddee TTeell AAvviivv.. ooqquuee,, sseemmaaiinnee dduu 3311//0077//22000033 nn°°2200 mmiisseess eenn ppllaaccee ppaarr llaa SSNNSSMM,, iill yy aavvaa ssuurr ll''AAllggéérriiee,, uunn ffiillttrraaggee ddee ll''aaccccèèss aauu rr ssûûrreettéé ppllaaccéé àà ll''eennttrrééee dduu nnaavviirree aavv aaggeerrss.. issssiioonn EEuurrooppééeennnnee ssee pprrééooccccuuppaaiitt ddéé ttiioonn ddee ssûûrreettéé ccoommmmee llee pprroouuvvee llee llii àà rrééfféérreennccee àà llaa nnéécceessssiittéé ddee rreennffoorrcc vviirreess rrééaalliissaanntt ddeess ccrrooiissiièèrreess eenn EEuurroo ennttss dduu 1111 SSeepptteemmbbrree 22000011 qquuii vviirreenn nntteerr eett llaa ddiissppaarriittiioonn ddee pplluuss ddee 33000000 pprreennddrree ccoonnsscciieennccee aauu mmoonnddee eennttiieerr qquuee ttoouuss lleess mmooyyeennss aaéérriieennss,, tteerrrreess nnss ddeessttrruuccttrriicceess.. ééee ppaarr lleess iimmaaggeess tteerrrriibblleess ddiiffffuussééeess ddrreenntt,, aassssiissttee uunn ppeeuu pplluuss dd''uunn aann aa rr ffrraannççaaiiss,, llee LLIIMMBBUURRGG.. CCee ssuuppeerr ttaann ddee ccaarrggaaiissoonn ppaarr uunnee vveeddeettttee rraappiiddee 22000022.. rree bbeeaauuccoouupp pplluuss lloouurrdd eett cceett éévvèènnee iieerr ddaannss uunn ggrraanndd ppoorrtt ssii uunnee aaccttiioonn oonn,, hheeuurreeuusseemmeenntt lliimmiittéé,, nnoouuss ppoouuvvoo nntt dduu mmiilliieeuu mmaarriittiimmee eennvveerrss ddeess iinnttéé ppaarr ddeessttiinnaattiioonn,, oouu llee vveecctteeuurr dd''uunnee poorrtteeuurr iinnnnoocceenntt ddee cchhaarrggeess iinnaapppprroopp eepptteemmbbrree 22000011 ssssaaggeerrss ssoonntt bbiieenn ssûûrr ddeess cciibblleess pprriivv tteess ddee nnaavviirreess ppeeuuvveenntt êêttrree uuttiilliissééeess ppeeuuvveenntt ddeevveenniirr ddee vvéérriittaabblleess bboommbb ééss ddee ffaaiirree eexxpplloosseerr ddee tteellss nnaavviirreess ee oonntt rreepprréésseennttééss,, aavveecc lleess ccoonnssééqquueenn uutt iimmaaggiinneerr.. mmiieeuuxx ppoouurrqquuooii cceettttee nnoottiioonn ddee ssûûrreet ccoonnvviieenntt ééggaalleemmeenntt,, ttoouujjoouurrss ddaannss ee ddee ssûûrreettéé,, ddee ss''aattttaarrddeerr llééggèèrreemmeenn ûûrreettéé mmaarriittiimmee.. TTTTTTTT EEEEEEEECCCCCCCCOOOOOOOONNNNNNNNOOOOOOOOMMMMMMMMIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE AARRIITTIIMMEE 002211.. aaiitt ll''eemmbbaarrqquueemmeenntt ddee uuxx nnaavviirreess ppaarr ddeess vveecc uunn ddéétteecctteeuurr ddee ééjjàà ééggaalleemmeenntt aavvaanntt llee iivvrree bbllaanncc ssuurr lleess cceerr llaa ssûûrreettéé ddeess ooppee.. nntt llaa ddeessttrruuccttiioonn ddeess 00 ppeerrssoonnnneess.. rr qquu''aauuccuunn ppaayyss ssttrreess,, eett mmaarriittiimmeess ss eett rreeddiiffffuussééeess ddeess aapprrèèss àà uunn aatttteennttaatt nnkkeerr eesstt ppeerrccuuttéé aauu bboouurrrrééee dd''eexxpplloossiiff aauu emmeenntt rréévvèèllee llee rriissqquuee nn aatttteennttaatt ssuuiicciiddee eesstt oonnss ddiissttiinngguueerr lleess éérrêêttss eexxttéérriieeuurrss :: ttoouutt aarrmmee ddee ddeessttrruuccttiioonn pprriiééeess.. vviillééggiiééss ccaarr ccee ssoonntt ddeess ss,, eenn ppaarrttiiccuulliieerr lleess bbeess fflloottttaanntteess.. DDeess eenn zzoonnee ppoorrttuuaaiirree,, llàà nncceess hhuummaaiinneess eett ettéé ddééttiieenntt uunn ll''ooppttiiqquuee ddee ddééccoouuvvrriirr nntt ssuurr ll''aassppeecctt
  • TToouutt dd''aabboorrdd iill aappppaarraaîîtt aauussssii iimm eenn ooeeuuvvrree ppoouurr rreennffoorrcceerr llaa ssûûrr ssiimmpplleemmeenntt uunn ssuurrccooûûtt.. EElllleess aauu pprrootteeccttiioonn ddeess pprrooffeessssiioonnnneellss pp ssûûrreettéé ddeess aapppprroovviissiioonnnneemmeennttss qquuii ccoonncceerrnnee llaa lluuttttee ccoonnttrree lleess dd''aacchheemmiinneemmeenntt ddeess mmaarrcchhaanndd ccaarraaccttèèrree ddiissssuuaassiiff eenn rraaiissoonn ddee ttrraaffiiccss iilllliicciitteess eett ddeess ffrraauuddeess.. PPoouurr eexxeemmppllee ddaannss llee ppoorrtt ddee RR ddaannss llee ppoorrtt ddee RRootttteerrddaamm,, ddaann ccoonnttrreeppaarrttiiee lleeuurr uuttiilliissaattiioonn aa ggé ddoouuaanniièèrreess eett ffiissccaalleess,, aalloorrss qquu mmooyyeennnnee àà uunn tteell ccoonnttrrôôllee..((((((((5555555500000000)))))))) ((((((((5555555500000000)))))))) :::::::: CCoommmmuunniiccaattiioonn ddee llaa ccoomm ééccoonnoommiiqquuee eett ssoocciiaall eeuurrooppééeenn ssûûrreettéé ddeess ttrraannssppoorrttss mmaarriittiimmee DDaannss ssoonn eennsseemmbbllee ddoonncc llee rreenn qquu''uunnee ppeerrttee ééccoonnoommiiqquuee ccoommmm CCooooppéérraattiioonn eett ddee DDéévveellooppppeemm mmaarriittiimmee :: éévvaalluuaattiioonn ddeess rriissqquu llee ccooûûtt ddee ccee rreennffoorrcceemmeenntt eesstt ggrraannddee aammpplleeuurr.. IIll sseerraaiitt éévvaalluu mmoonnttaanntt gglloobbaall ddee ll''iinnvveessttiisssseemm ddeessttiinnééeess àà ccoonnttrreerr llaa mmeennaaccee tt ccoorrrreessppoonndd àà ll''iinnssttaallllaattiioonn ddeess éé ssuupppplléémmeennttaaiirree ppoouurr lleess eexxppllooiitt ss''ééllèèvveerraaiitt ééggaalleemmeenntt àà pprrééss ddee UUnnee ééttuuddee mmeennééee ppaarr lleess UUSS CCoo ccoommppoossééee ddee 2277 nnaavviirreess sseerraaiitt cchhaarrggéé ddeess qquueessttiioonnss ddee ssûûrreettéé ééttaabblliisssseemmeenntt ddeess ppllaannss ddee ssûûrr LLee ssuurrccooûûtt ppoouurr llaa ppaarrttiiee eexxppllooii ssooiitt 2255000000 UUSS$$ ppaarr nnaavviirree.. DDee mmêêmmee lleess CCooaasstt GGuuaarrddss eesstti ssoouutteenniirr lleess pprroojjeettss ddee ssûûrreettéé pp RReessttee ttoouutteeffooiiss qquu''iill nn''yy aa ddoonncc eett llee ccooûûtt dd''uunn aaccttee tteerrrroorriissttee.. CCeeppeennddaanntt ccee ccooûûtt eesstt ttoouutt dd''aabb mmaarriittiimmee àà ssaavvooiirr lleess ccoommppaaggnnii ((((((((5555555511111111)))))))) :::::::: ppuubblliiccaattiioonn aappppaarruuee ddaannss ggoouuvveerrnneemmeenntt ddeess EEttaattss--UUnniiss mmppoorrttaanntt ddee ssoouulliiggnneerr qquuee lleess mmeessuur rreettéé dduu ttrraannssppoorrtt mmaarriittiimmee nnee ccoonnssttii uurroonntt ssuurrttoouutt ddeess iinncciiddeenncceess bbéénnééffiiqq ppoorrttuuaaiirreess eett ddee llaa mmeerr,, ttoouutt ccoommmmee ss ssttrraattééggiiqquueess,, mmaaiiss aauussssii ddeess rreettoomm s ttrraaffiiccss ddee ttoouuss ggeennrreess,, llaa ttaaxxaattiioonn,, ddiisseess ttrraannssppoorrttééeess.. CCeess mmeessuurreess pprréé eess ccoonnttrrôôlleess eeffffeeccttuuééss,, eett ffaacciilliitteerroonntt RRootttteerrddaamm,, ll''iinnssttaallllaattiioonn ddeess ssccaannnneeuu nnss llee ccaaddrree dduu CCSSII,, aa ccooûûttéé 1155 mmiilllliioon éénnéérréé,, eenn uunn aann,, 8888 mmiilllliioonnss dd''EEuurrooss uuee sseeuullss ddeeuuxx ppoouurr cceenntt ddeess ccoonntteenneeu )))))))) mmmmiissssiioonn aauu ccoonnsseeiill,, aauu ppaarrlleemmeenntt ee nn eett aauu ccoommiittéé ddeess rrééggiioonnss rreellaattiivveess àà eess.. nnffoorrcceemmeenntt ddee llaa ssûûrreettéé dduu ttrraannssppoorrtt mmee llee ddéémmoonnttrree uunn rraappppoorrtt éémmiiss ppaarr mmeenntt EEccoonnoommiiqquuee,, rraappppoorrtt iinnttiittuulléé «« LL uueess eett iimmppaacctt ééccoonnoommiiqquuee »».. EEnn eeffffee «« bbiieenn iinnfféérriieeuurr »» àà cceelluuii dd''uunn aatttteennt uuaaiitt àà qquueellqquueess 5588 mmiilllliiaarrddss ddee ddoollllaarr mmeenntt ccoorrrreessppoonnddaanntt aauuxx nnoouuvveelllleess mm tteerrrroorriissttee ss''ééllèèvveerraaiitt àà 11,,33 mmiilllliiaarrdd dd ééqquuiippeemmeennttss ddee ssûûrreettéé eett aauu rreeccrruuttee ttaannttss ddee nnaavviirree,, eett lleess ccooûûttss dd''eexxppllooi ee 773300 mmiilllliioonnss ddee ddoollllaarrss.. ooaasstt GGuuaarrdd ((((((((5555555511111111)))))))) eessttiimmee qquuee llee ccooûûtt ddee 225500000000 UUSS$$ ppoouurr lleess ffrraaiiss ffiixxeess d éé)) eett ddee 227700000000 UUSS$$ ppoouurr lleess ffrraaiiss vv rreettéé eett aauuddiitt eett cceerrttiiffiiccaattiioonn ddee cceess mm iittaattiioonn ddeess nnaavviirreess ss''ééllèèvveerraaiitt qquuaanntt tiimmeenntt ééggaalleemmeenntt lleess bbeessooiinnss iinniittiiaauuxx ppoorrttuuaaiirree oouu ddee tteerrmmiinnaauuxx aauuccuunnee ccoommmmuunnee mmeessuurree eennttrree llee cc bboorrdd ssuuppppoorrttéé ppaarr lleess aacctteeuurrss eeuuxx mm iieess mmaarriittiimmeess eett lleess ppoorrttss aaiinnssii qquuee ss llee FFeeddeerraall RReeggiisstteerr,, rrééssuumméé jjoouurrnnaa urreess qquuii sseerroonntt mmiisseess iittuueerroonntt ppaass qquueess eenn mmaattiièèrree ddee ddeess ppaassssaaggeerrss,, ddee mmbbééss iinnddiirreecctteess eenn ccee eett llaa ssûûrreettéé éésseenntteerroonntt eenn eeffffeett uunn tt llaa rréépprreessssiioonn ddeess uurrss ppoouurr ccoonntteenneeuurrss onnss dd''EEuurrooss ;; eenn ss ddee rreecceetttteess uurrss ssoonntt ssoouummiiss eenn eeuurrooppééeenn,, aauu ccoommiittéé àà ll''aamméélliioorraattiioonn ddee llaa tt mmaarriittiimmee nn''eesstt ppaass rr ll''OOrrggaanniissaattiioonn ddee LLaa ssûûrreettéé dduu ttrraannssppoorrtt eett ll''OOCCDDEE eessttiimmee qquuee nttaatt tteerrrroorriissttee ddee rrss aalloorrss qquuee llee mmeessuurreess ddee ssûûrreettéé ddee ddoollllaarrss,, ccee qquuii eemmeenntt dduu ppeerrssoonnnneell iittaattiioonn aannnnuueellss ppoouurr uunnee ccoommppaaggnniiee dduu ssiièèggee (( ppeerrssoonnnneell vvaarriiaabblleess dduu ssiièèggee (( mmêêmmeess ppllaannss )) .. àà lluuii àà 667755000000 UUSS$$ xx àà 11,,44 mmiilllliiaarrddss ppoouurr ccooûûtt ddee llaa pprréévveennttiioonn mmêêmmee dduu ttrraannssppoorrtt lleess cchhaarrggeeuurrss.. aalliieerr ddeess aaccttiivviittééss dduu
  • §§22..22 :: RREEPPAARRTTIIRR CCEE CCOOUUTT LLee ccooûûtt ddee llaa ssûûrreettéé mmaarriittiimmee nn AArrmmaatteeuurr ddee FFrraannccee rrééccllaammaanntt ddee cceess mmeessuurreess,, eessttiimmaanntt qquu''iill PPaarraallllèèlleemmeenntt àà llaa ddeemmaannddee dd''AA ddee TTrraannssppoorrtt ddee FFrreett )) ss''eesstt rraapp eett dduu LLiittttoorraall ((DD..TT..MM..PP..LL)) aaffiinn dd ffrraannççaaiiss.. LL''AAUUTTFF eessttiimmee qquuee lleess ffiinnaanncceemmeenntt ddeess ccooûûttss ddee ssûûrreett ddééjjàà aannnnoonnccéé uunn ppllaann ddee ffiinnaanncc ddeerrnniièèrreemmeenntt llee HHoommeellaanndd SSeeccu ddee $$330000 mmiilllliioonnss dd''aaiiddeess àà cceerrttaa mmiissee eenn ppllaaccee ddee mmeessuurreess rreennffoo rrééggaalliieennnneess ddee ll''EEttaatt eett ddooiitt ddoonn llee ccooûûtt ddee ppaassssaaggee dd''uunn ccoonntteenn ccoonntteenneeuurrss,, ccee ssuurrccooûûtt ddeevvrraa êê mmaarriittiimmee.. DDeerrnniièèrreemmeenntt ssuuiittee aauu CCoommiittéé ii ccoommmmuunniiqquuééeess àà cceettttee ooccccaassiioonn mmaarriittiimmeess ffrraannççaaiiss ((CCCCMMFF)),, aa ffaa ssûûrreettéé ssuurr llee ffrreett mmaarriittiimmee,, rraapp ssuuppppoorrttéé ppaarr lleess aauuttoorriittééss ppuubbllii ééggaalleemmeenntt ddee ll''aauuttrree ccôôttéé ddee ll''AA ffaarroouucchhee ddee llaa ppaarrtt ddeess cchhaarrggeeuu CCeeppeennddaanntt àà ll''hheeuurree aaccttuueellllee,, iill cchhaarrggee ffiinnaanncciièèrree ppaarr lleess ppoouuvvoo CCeerrttaaiinnss aarrmmaatteeuurrss aavvaannççaanntt mm bboorrdd ddeess nnaavviirreess mmaarrcchhaannddss aaffi ssuupppplléémmeennttaaiirreess mmaaiiss aavveecc llee pp nnee ssoonntt pplluuss ssuuffffiissaannttss eett cceettttee ((((((((5555555522222222)))))))) :::::::: DDééccllaarraattiioonn eenn ddaattee dduu 00 CCee sseerraa ddee ttoouuttee mmaanniièèrree aauuxx aa iillss eessssaaiieerroonntt ssaannss ddoouuttee ddee rréépp PPaarr lleeuurr aammpplleeuurr,, lleess mmeessuurreess ss sshhiippppiinngg.. BBiieenn rraarreess ééttaaiieenntt cceeuu pprréévvuuee,, eett oonn iimmaaggiinnee llee ttoolllléé qq vvéérriiffiiee uunnee ffooiiss eennccoorree ttoouutt ccoomm ccaattaassttrroopphheess ppeerrmmeetttteenntt ddee ssoorr ffrraanncchhiirr uunnee mmaarrcchhee eessccaarrppééee.. DDeeppuuiiss llee 1111 sseepptteemmbbrree ddee nnoomm mmaarriittiimmee qquuee ccee ssooiitt ddee llaa ppaarrtt ddee llaa ppaarrtt ddeess iinnssttaanncceess iinntteerrnnaa ccoommmmuunnaauuttaaiirree,, nnoouuss aalllloonnss mma ddee cceess oorrggaanniissmmeess.. nn''eesstt ddoonncc ppaass aannooddiinn ppoouurr lleess ccoommpp eenn ccoonnssééqquueennccee uunn ffiinnaanncceemmeenntt ppaa ss''aaggiitt dd''uunnee qquueessttiioonn dd''iinnttéérrêêtt nnaattiioo AArrmmaatteeuurr ddee FFrraannccee,, ll''AAUUTTFF (( ll''AAssssoocc pppprroocchhéé ddee llaa DDiirreeccttiioonn ddeess PPoorrttss,, dduu dd''ééttaabblliirr uunn ééttaatt ddeess lliieeuuxx eenn mmaattiièèrree ss ppoouuvvooiirrss ppuubblliiccss ddooiivveenntt pprreennddrree een ttéé,, rraappppeellaanntt ppaarr llaa mmêêmmee ooccccaassiioonn cceemmeenntt ddee 9922,,33 mmiilllliioonnss ddee ddoollllaarrss pp cuurriittyy ,, mmiinniissttèèrree ddee llaa SSûûrreettéé nnaattiioonn aaiinnss pprroojjeettss ddee ssûûrreettéé ppoorrttuuaaiirree.. LL''AA oorrccééeess ddee ssûûrreettéé eennttrree ddaannss llee cchhaamm nncc êêttrree ffiinnaannccééee ppaarr lleess ppoouuvvooiirrss ppuub nneeuurr aauu rraayyoonn XX eesstt ddee ll''oorrddrree ddee 8800// êêttrree ssuuppppoorrttéé ppaarr uunn oouu pplluussiieeuurrss aacctt iinntteerrmmiinniissttéérriieell ddee llaa mmeerr eett aauuxx oorriiee nn,, ll''AAUUTTFF,, rrééuunniiss aauu sseeiinn dduu CCoommiittéé aaiitt ssaavvooiirr qquu''iill ss''ooppppoossee àà ll''iinnssttaauurraatt ppppeellaanntt qquuee llee ccooûûtt ddeess mmeessuurreess ddee ss iiqquueess.. CCeettttee iiddééee ddee ttaaxxee ddee ssûûrreettéé AAttllaannttiiqquuee mmaaiiss aa ééggaalleemmeenntt ffaaiitt ll''oobb uurrss eett ddeess iinndduussttrriieellss.. ll eesstt ttrrèèss ppeeuu eennvviissaaggeeaabbllee ddee ppeennssee ooiirrss ppuubblliiccss,, llaa tteennddaannccee ééttaanntt àà llaa rréé mmêêmmee llaa pprrooppoossiittiioonn dd''uuttiilliisseerr ddeess mmii fiinn dd''éévviitteerr dd''aavvooiirr àà ppaayyeerr eeuuxx--mmêêmm ppaassssaaggee àà ll''aarrmmééee ddee mmééttiieerr,, lleess eeffffee ssoolluuttiioonn nn''eesstt ddoonncc ppaass eennvviissaaggeeaabbll 0011 jjuuiilllleett 22000022 ,, RReeff 332288//AADD//22000022 ;; w aacctteeuurrss dduu mmiilliieeuu mmaarriittiimmee ddee mmeettttrr ppeerrccuutteerr ccee ccooûûtt aauupprrèèss ddee lleeuurr cclliieenn ssééccuurriittaaiirreess rreepprréésseenntteenntt uunnee vvéérriittaab uuxx qquuii,, llee lleennddeemmaaiinn dduu 1111 sseepptteemmbbr qquu''aauurraaiieenntt ssuusscciittéé cceess mmeessuurreess aauuppa mmmmee ppoouurr llee sseecctteeuurr ddee llaa ssééccuurriittéé ,,qq rrttiirr àà ll''éécchheelloonn mmoonnddiiaall ddee llaa llooggiiqquuee mmbbrreeuusseess iinniittiiaattiivveess ssoonntt aappppaarruueess ee ddee EEttaattss--UUnniiss,, sseeuull ééttaatt aauussssii aaccttiiff dd aattiioonnaalleess qquuee ccee ssooiitt ll''OOMMII oouu ll''OOIITT oo maaiinntteennaanntt vvooiirr qquueelllleess oonntt ééttéé lleess ddéé ppaaggnniieess mmaarriittiimmeess,, aarr lleess ppoouuvvooiirrss ppuubblliiccss oonnaall.. cciiaattiioonn ddeess UUttiilliissaatteeuurrss uu TTrraannssppoorrtt MMaarriittiimmee ee ddee ssûûrreettéé ddeess ppoorrttss enn cchhaarrggee llee qquuee lleess EEttaattss--UUnniiss oonntt ppoouurr lleeuurr ppoorrtt ((((((((5555555522222222)))))))).. EEtt nnaallee,, aa ddéébbllooqquuéé pprrèèss AAUUTTFF eessttiimmee qquuee llaa mmpp ddeess mmiissssiioonnss ubblliiccss.. RRaappppeelloonnss qquuee //110000 eeuurrooss ppaarr tteeuurrss ddee llaa ssûûrreettéé eennttaattiioonnss ddeess cchhaarrggeeuurrss ttiioonn ddee ttoouuttee ttaaxxee ddee ssûûrreettéé ddooiitt êêttrree ppoorrttuuaaiirree ssee rreettrroouuvvee bbjjeett dd''uunnee ooppppoossiittiioonn eerr oobbtteenniirr llaa pprriissee eenn éécceessssiioonn bbuuddggééttaaiirree.. iilliittaaiirreess ddee mmééttiieerrss àà mmeess ddeess ooffffiicciieerrss eeccttiiffss eett lleess bbuuddggeettss llee.. wwwwww..aauuttff..ffrr rree llaa mmaaiinn àà llaa ppoocchhee,, nntt.. abbllee rréévvoolluuttiioonn ppoouurr llee brree 22000011,, ll''aavvaaiieenntt aarraavvaanntt.. AAiinnssii,, oonn qquuee sseeuulleess lleess ee ddeess ppeettiittss ppaass,, eett ddee eenn mmaattiièèrree ddee ssûûrreettéé ddaannss ccee ddoommaaiinnee oouu oouu eennccoorree ssuurr llee ppllaann éémmaarrcchheess ssééccuurriittaaiirreess
  • SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEEMMMM LLaa ssûûrreettéé dd''uunnee cchhaaîînnee ddee ttrraannss aapppprroocchhee ttrraaiittaanntt eenn ppaarraallllèèllee dd ssûûrreettéé ddeess ttrraannssppoorrttss ddaannss ssoonn IIll eesstt ttoouutt àà ffaaiitt ttrrèèss aaiisséé dd''eennvvi mmooyyeenn ddee ttrraannssppoorrtt mmaaiiss ééggaallee éélléémmeennttss dduu ttrraannssppoorrtt :: cc''eesstt pp ssûûrreettéé mmaarriittiimmee ttoouucchheenntt aauussssii ((((((((5555555533333333)))))))) :: CCoommmmuunniiccaattiioonn ddee llaa ccoomm ééccoonnoommiiqquuee eett ssoocciiaall eeuurrooppééeenn ssûûrreettéé ddeess ttrraannssppoorrttss mmaarriittiimmee NNoouuss aalllloonnss ddoonncc éénnoonncceerr ddaannss éévvèènneemmeennttss ttrraaggiiqquueess dduu 1111 ssee aaccttiioonnss ssoonntt mmeennééeess,, llee nniivveeaauu llee nniivveeaauu nnaattiioonnaall ppoouurr ccee qquuii cc jjee ddéébbuutteerraaii cceettttee éénnuumméérraattiioonn CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRR :::::::: DDDDDDDDUUUUUUUU CCCCCCCCOOOOOOOOTTTTTTTTEEEEEEEE IIll eesstt bbiieenn éévviiddeenntt qquuee llee ppeeuuppll sseepptteemmbbrree eett cc''eesstt ppoouurrqquuooii llaa iinnddéénniiaabbllee.. DDee mmaanniièèrree ssiimmiillaaiirr hhyyddrrooccaarrbbuurree,, lleess EEttaattss--UUnniiss dd''A uunniillaattéérraalleess,, aannttiicciippaanntt ssoouuvveenntt ddee nnééggoocciiaattiioonnss ddaannss lleess iinnssttaann nnoottaammmmeenntt,, llaa ssûûrreettéé eesstt ccoonnssii LL''aaccttiivviittéé ppaarrlleemmeennttaaiirree aa ééttéé ttrr ppaarr ll''aaddooppttiioonn ppaarr llee CCoonnggrrèèss,, ll 22000022 »».. CCeettttee llooii iimmppoossee ddee llaarr mmaarriittiimmee.. LLeess UUSSAA oonntt vvuu ééggaalleemmeenntt llaa ccrr mmiinniissttèèrree ddee llaa ssûûrreettéé iinnttéérriieeuurr ccoonntteexxttee ssééccuurriittaaiirree qquuee ttrrooiiss ttyy rrééppeerrccuussssiioonn ppoouurr llee mmoonnddee mmaa aa)) LLaa CCSSII (( CCoonnttaaiinneerr SSeeccuurriittyy I ddéévveellooppppéé cceettttee mmeessuurree,, ddeessttiinn vviinnggtt ppoorrttss eeuurrooppééeennss eett aassiiaattiiqq mmaarriittiimmee ppaarr ccoonntteenneeuurrss vveerrss lle SSoonn pprriinncciippee ss''aarrttiiccuullee aauuttoouurr dd 11.. LL''ééttaabblliisssseemmeenntt ddee ccrriittèèrreess dd rriissqquueess.. EEEEMMMMMMMMAAAAAAAARRRRRRRRCCCCCCCCHHHHHHHHEEEEEEEESSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEESSSSSSSS ssppoorrtt ééttaanntt ééggaallee àà cceellllee ddee ssoonn mmaaiill ddee llaa ddiimmeennssiioonn mmuullttiimmooddaallee ppeerrmmeett nn eennsseemmbbllee..((((((((5555555533333333)))))))) viissaaggeerr qquuee llaa ssûûrreettéé mmaarriittiimmee nn''iimmpp eemmeenntt ttoouuttee llaa cchhaaîînnee qquuii eesstt ccoonnssttiitt ppoouurrqquuooii lleess nnoouuvveelllleess mmeessuurreess pprriissee ii ddeess ddoommaaiinneess ccoommmmee llee ppoorrttuuaaiirree,, mmmmiissssiioonn aauu ccoonnsseeiill,, aauu ppaarrlleemmeenntt ee nn eett aauu ccoommiittéé ddeess rrééggiioonnss rreellaattiivvee àà eess,, CCOOMM((22000033)) 222299 ffiinnaall ,, llee 22..55..220000 ss cceettttee ppaarrttiiee,, lleess aaccttiioonnss mmeennééeess àà ll eepptteemmbbrree 22000011 eett cc''eesstt ssuurrttoouutt àà ttrroo uu iinntteerrnnaattiioonnaall ppaarr llee bbiiaaiiss ddee ll''OOMMII,, ll ccoonncceerrnnee lleess EEttaattss--UUnniiss,, cc''eesstt dd''aaiilllleeuu nn ddee mmeessuurreess.. EEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS EEEEEEEETTTTTTTTAAAAAAAATTTTTTTTSSSSSSSS--------UUUUUUUUNNNNNNNNIIIIIIIISSSSSSSS llee aamméérriiccaaiinn aa ééttéé ttrrèèss mmaarrqquuéé ppaarr lle ddéétteerrmmiinnaattiioonn aamméérriiccaaiinnee ddaannss ccee dd rree àà ssoonn aaccttiioonn eenn mmaattiièèrree ddee ppoolllluuttiioo 'AAmméérriiqquuee oonntt pprriiss ddeess mmeessuurreess ddee pp tt aauu ppllaann ddee llaa mmiissee eenn ooeeuuvvrree ddeess dd nncceess iinntteerrnnaattiioonnaalleess.. DDaannss llee ddoommaaiinn iiddéérrééee ccoommmmee uunnee «« aaffffaaiirree ddee ssééccuu rrèèss rriicchhee eenn iinniittiiaattiivveess.. EEllllee ss''eesstt ccoonn lee 1144 nnoovveemmbbrree 22000022 dduu «« MMaarriittiimmee rrggeess eexxiiggeenncceess eenn mmaattiièèrree ddee ssûûrreettéé rrééaattiioonn eeffffeeccttiivvee ddeeppuuiiss llee 11eerr MMaarrss 22 rree(( DDeeppaarrttmmeenntt ooff HHoommeellaanndd SSeeccuurriitt yyppeess ddee mmeessuurreess iimmppoorrttaanntteess eett aayyaa aarriittiimmee oonntt ééttéé mmiisseess eenn ppllaaccee.. IInniittiiaattiivvee )) :: DDeeppuuiiss llaa mmii--22000022,, lleess nnééee àà êêttrree aapppplliiqquuéé ddaannss uunnee pprreemmiièè qquueess ccoonncceennttrraanntt llaa pplluuss ggrraannddee ppaarr leess EEttaattss--UUnniiss.. ddee qquuaattrree ppooiinnttss ppoouurr uunn mmêêmmee ppoorrtt ddee ssûûrreettéé ppeerrmmeettttaanntt dd''iiddeennttiiffiieerr lleess lllloonn llee pplluuss ffaaiibbllee,, uunnee ttttrraa dd''aamméélliioorreerr llaa pplliiqquuee ppaass qquuee llee ttuuééee ppaarr lleess ddiifffféérreennttss eess eenn ffaavveeuurr ddee llaa , lleess ddoouuaanneess,, .......... eeuurrooppééeenn,, aauu ccoommiittéé ll''aamméélliioorraattiioonn ddee llaa 0033 llaa ssuuiittee ddeess ooiiss nniivveeaauuxx qquuee cceess llee nniivveeaauu EEuurrooppééeenn eett uurrss ppaarr ccee nniivveeaauu qquuee leess éévvèènneemmeennttss dduu 1111 ddoommaaiinnee eesstt oonn mmaarriittiimmee ppaarr pprrootteeccttiioonn ddiissppoossiittiioonnss eenn ccoouurrss nnee mmaarriittiimmee uurriittéé iinnttéérriieeuurree »».. nnccrrèètteemmeenntt ttrraadduuiittee SSeeccuurriittyy AAcctt ooff éé àà ll''iinndduussttrriiee 22000033 dd''uunn ggrraanndd ttyy)) eett cc''eesstt ddaannss ccee aanntt dd''éénnoorrmmeess EEttaattss--UUnniiss oonntt èèrree pphhaassee ddaannss lleess rrtt dduu ccoommmmeerrccee t :: ccoonntteenneeuurrss àà hhaauuttss
  • 22.. LLee pprree--ssccrreeeenniinngg ddeess ccoonntteenn 33.. LL''uuttiilliissaattiioonn ddee mmooyyeennss tteecchhnn hhaauuttss rriiqquueess.. 44.. LLaa mmiissee eenn ppllaaccee ddee ccoonntteennee bb)) LLaa rrèèggllee ddiittee «« ddeess 2244 hheeuurree ffoouurrnniirr lleeuurr mmaanniiffeessttee ddee cchhaarrgg eeffffeeccttiivvee ssuurr lleess nnaavviirreess eenn ppaarrtt CCeess iinnffoorrmmaattiioonnss ppeerrmmeettttrraaiieenntt ddee ddaannggeerr tteerrrroorriissttee qquuee ppeeuuvvee CCeettttee rrèèggllee eesstt eeffffeeccttiivvee ddeeppuuiiss cc)) LLaa pprrooppoossiittiioonn ddee rrèègglleemmeenntt lliisstteess dd''ééqquuiippaaggee :: CCeettttee pprrooppooss vviissaass ssuurr bbaassee ddeess lliisstteess dd''ééqquuiipp ééttrraannggeerrss ddeemmaannddaanntt àà eennttrreerr LLeess EEttaattss--UUnniiss dd''AAmméérriiqquuee ssoonntt llaa ssûûrreettéé mmaarriittiimmee mmaaiiss iill ss''aaggiitt ddoonncc iinntteerrnnee.. CCeeppeennddaanntt llaa ssûûrre iinnssttaanncceess iinntteerrnnaattiioonnaalleess oonntt éégg CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCOOOOOOOONNNNNNNNDDDDDDDD :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEEMMMMMMMMAAAAAAAA IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLLEEEEEEEESSSSSSSS :::::::: §§22..11 LL''OOMMII :: LL''oorrggaanniissaattiioonn MMaarriittiimmee IInntteerrnnaa eett àà llaa ssûûrreettéé ddeess nnaavviirreess.. LLeess tt ddéécceemmbbrree 22000022 lloorrss ddee llaa CCoonnfféé ll''OOMMII ss''aarrttiiccuullee aauuttoouurr ddee ddeeuuxx ii)) LLaa mmooddiiffiiccaattiioonn ddee llaa ccoonnvveenntt àà cceettttee ccoonnvveennttiioonn dd''iinnttééggrreerr llaa ddeess aassppeeccttss tteecchhnniiqquueess eett iimmppoo dd''iiddeennttiiffiiccaattiioonn aauuttoommaattiiqquuee ddee ppoouuvvaanntt ssiiggnnaalleerr àà uunn oorrggaanniissmm LLee ddeerrnniieerr ppooiinntt ccoonncceerrnnee llee mmaa ttrrèèss vviissiibbllee ddee ll''eexxttéérriieeuurr.. iiii)) LL''aaddooppttiioonn dd''uunn ccooddee,, llee ccooddee iinnssttaauurree lleess ddiissppoossiittiioonnss àà ssuuiivvrr ll''oobbtteennttiioonn dd''uunn cceerrttiiffiiccaatt ddee ssûû ffaaiitt ccee ccooddee ss''aappppaarreennttee eenn qquuee §§22..22 LL''OOIITT :: LL''OOrrggaanniissaattiioonn iinntteerrnnaattiioonnaallee dduu ssééccuurriittaaiirreess ccaarr lleess ggeennss ddee mmee nneeuurrss aavvaanntt lleeuurr aarrrriivvééee ddaannss lleess ppoorr nnoollooggiiqquueess ppoouurr pprrooccééddeerr aauu ssccrreeeennii eeuurrss ssééccuurriissééss eett ppeerrmmeettttaanntt uunn ssuuiivv eess ddee pprrééaavviiss »» :: LLeess ttrraannssppoorrtteeuurrss mm ggeemmeenntt 2244 hheeuurreess aavvaanntt qquuee cceettttee oopp ttaannccee ppoouurr lleess EEttaattss--UUnniiss.. tt aauuxx ddoouuaanneess aamméérriiccaaiinneess dd''éévvaalluueerr eenntt rreevvêêttiirr lleess ccoonntteenneeuurrss ddeessttiinnééss àà ss llee 22 FFéévvrriieerr 22000033.. rreellaattiiff àà llaa ssuupppprreessssiioonn ddeess vviissaass ddéé ssiittiioonn vviissee àà ssuupppprriimmeerr llaa pprraattiiqquuee dd ppaaggeess ppoouurr lleess mmeemmbbrreess dd''ééqquuiippaaggee ddaannss uunn ppoorrtt ddeess EEttaattss--UUnniiss dd''AAmméérri tt ddoonncc àà ll''oorriiggiinnee dd''iinniittiiaattiivveess ((uunniillaattéé tt ssuurrttoouutt ddee mmeessuurreess qquuii ttoouucchheenntt llee reettéé mmaarriittiimmee ééttaanntt ddeevveennuuee uunnee pprriio ggaalleemmeenntt eennttaamméé ddeess aaccttiioonnss ddaannss cc AAAAAAAARRRRRRRRCCCCCCCCHHHHHHHHEEEEEEEESSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEESSSSSSSS DDDDDDDDEEEEEEEESSSSSSSS IIIIIIIINNNNNNNNSSSSSSSSTTTTTTTTAAAAAAAANNNN aattiioonnaallee ss''eesstt iinnttéérreessssééee rrééeelllleemmeenntt aa ttrraavvaauuxx rreellaattiiffss àà ccee ddoommaaiinnee ssee ssoonn éérreennccee DDiipplloommaattiiqquuee ddee ll''OOMMII.. LLaa ddéé pprriinncciippaalleess mmeessuurreess :: ttiioonn SSOOLLAASS aavveecc llaa ccrrééaattiioonn dduu cchhaapp aa ddiimmeennssiioonn ddee llaa ssûûrreettéé mmaarriittiimmee.. EE oossee aauu nnaavviirree ddee ppoossssééddeerr àà bboorrdd uunn eess nnaavviirreess,, dd''uunn ssyyssttèèmmee dd''aallaarrmmee iinn mmee àà tteerrrree qquu'' uunn éévvèènneemmeenntt ssee ddéérroo aarrqquuaaggee dduu nnuumméérroo iinntteerrnnaattiioonnaall dduu ee IISSPPSS ((IInntteerrnnaattiioonnaall SShhiipp aanndd PPoorrtt rree ppoouurr llaa mmiissee eenn ppllaaccee ddeess pprrooccéédduu ûûrreettéé,, llaa rréééévvaalluuaattiioonn dduu ppllaann ddee ssûûrree eellqquueess ssoorrtteess aauu ccooddee IISSMM ppoouurr llee ddoo uu ttrraavvaaiill eesstt iimmpplliiqquuééee ééggaalleemmeenntt ddaa eerr ppaarrttiicciippeenntt ddiirreecctteemmeenntt aauu ttrraannssppoo rrttss ddeess EEttaattss--UUnniiss .. iinngg ddeess ccoonntteenneeuurrss àà vvii iinntteelllliiggeenntt.. mmaarriittiimmeess ddooiivveenntt ppéérraattiioonn nnee ssooiitt rr llee rriissqquuee eenn mmaattiièèrree à ccee ppaayyss.. éélliivvrrééss ssuurr bbaassee ddeess ddee llaa ddéélliivvrraannccee ddee eess ddeess nnaavviirreess riiqquuee .. éérraalleess)) eenn ffaavveeuurr ddee ee ddoommaaiinnee ddoouuaanniieerr ioorriittéé mmoonnddiiaallee,, ddeess ccee ddoommaaiinnee.. AAAANNNNNNNNCCCCCCCCEEEEEEEESSSSSSSS aauu ddoommaaiinnee mmaarriittiimmee nntt ccoonncclluuss llee 1122 éémmaarrcchhee ssééccuurriittaaiirree ddee ppiittrree XXII..22 ppeerrmmeett ddoonncc EEllllee nnee ccoommppoorrttee qquuee nn ssyyssttèèmmee ,,ddiitt AAIISS,, naauuddiibbllee eett ccaacchhéé oouullee àà bboorrdd dduu nnaavviirree.. uu nnaavviirree ddee mmaanniièèrree FFaacciilliittyy SSeeccuurriittyy)) qquuii uurreess iinntteerrnneess,, eettéé ddeess nnaavviirreess,, eenn oommaaiinnee ddee llaa ssûûrreettéé.. aannss lleess ddéémmaarrcchheess oorrtt iinntteerrnnaattiioonnaall ddee
  • mmaarrcchhaannddiissee,, aauu ttrraannssppoorrtt ddee pp ppoorrtt.. IIll ffaauutt ddoonncc êêttrree cceerrttaaiinn dd mmaarriittiimmee.. EEnn mmaarrss 22000022,, aa ééttéé iinnssccrriittee àà iinntteerrnnaattiioonnaallee dduu TTrraavvaaiill ddee JJuuiin pplluuss ssûûrr dd''iiddeennttiiffiiccaattiioonn ddeess ggeenn ssuurr lleess ppiièècceess dd''iiddeennttiittéé ddeess ggeenn UUnnee ddeess qquueessttiioonnss jjuuggééeess iimmppoo llaa ssûûrreettéé mmaarriittiimmee,, eesstt dd''aaiilllleeuurr ccoommppéétteennccee ddee ll''OOIITT.. LLeess mmaarriinnss ddeevvrraaiieenntt êêttrree eenn ppoo iiddeennttiiffiiccaattiioonn «« ppoossiittiivvee eett vvéérriiff ddééttiieenntt llee ddooccuummeenntt eesstt bbiieenn ccee ddee ll''aauutthheennttiicciittéé dduu ddooccuummeenntt pp §§22..33.. LL''OOMMDD :: LL''oorrggaanniissaattiioonn MMoonnddiiaallee ddeess DDoo ssûûrreettéé eett àà llaa ffaacciilliittaattiioonn ddeess éécc aapppplliiccaattiioonn aauurraa ppoouurr bbuutt ddee pprr tteerrrroorriisstteess,, eett llaa cchhaaîînnee llooggiissttiiqq ffrraauudduulleeuuxx dd''aarrmmeess ddee ddeessttrruucctt eesssseennttiieelllleemmeenntt ssuurr ttrrooiiss ppooiinnttss aa.. LL''aassssiissttaannccee ddeess aauuttoorriittééss ddoo cchhaaîînnee llooggiissttiiqquuee.. bb.. LL''aaccccèèss ppoouurr lleess aauuttoorriittééss ddoo cc.. LLaa rréévviissiioonn ddee llaa ccoonnvveennttiioonn ((((((((5555555544444444)))))))) :::::::: CCoonnfféérreennccee qquuii ss''eesstt tteennuu ll''oorrddrree dduu jjoouurr.. UUnn qquueessttiioonnnnaaiirr RRaappppoorrtt VVIIII((11)),,VVIIII((22AA)) eett VVIIII((22 9922--22__001122888822__99 LLeess iinnssttaanncceess iinntteerrnnaattiioonnaalleess ssoo mmeessuurreess àà mmeettttrree eenn ooeeuuvvrree aaff cceeppeennddaanntt eett ddee mmaanniièèrree ssiimmiillaa EEuurrooppééeennnnee eesstt eellllee aauussssii aaccttiivve aavvaanntt mmêêmmee lleess aatttteennttaattss dduu 1111 ttrraannssppoorrttss,, qquuii ffaaiissaaiitt ddééjjàà rrééfféé eemmbbaarrqquuaanntt ssuurr ddeess nnaavviirreess rrééaa aatttteennttiivvee aauuxx ttrraavvaauuxx ddeess ddiifffféérr CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE TTTTTTTTRRRRRRRROOOOOOOOIIIIIIIISSSSSSSSIIIIIIIIEEEEEEEEMMMMMMMMEEEEEEEE :::::::: LLLLLLLLAAAAAAAA DDDDDDDDEEEEEEEEMMMMMMMM ppaassssaaggeerr,, eett oonntt ffaacciilleemmeenntt aaccccèèss àà tt ddee llaa qquuaalliittéé ddee llaa ppeerrssoonnnnee eenn ppoossssee ll''oorrddrree dduu jjoouurr ddee llaa 9911èèmmee sseessssiioonn dd inn 22000033,, uunnee qquueessttiioonn uurrggeennttee ccoonnccee nnss ddee mmeerr,, eenn vvuuee ddee llaa rréévviissiioonn ddee nnss ddee mmeerr,, qquuii ddaattee ddee 11995588((((((((5555555544444444)))))))).. oorrttaanntteess lloorrss ddeess ttrraavvaauuxx ddee ll''OOMMII ppoo rrss cceellllee ddee ll''iiddeennttiiffiiccaattiioonn ddeess ggeennss dd oosssseessssiioonn dd''uunn ddooccuummeenntt qquuii ppeerrmmee ffiiaabbllee »» :: «« ppoossiittiivvee »» eenn ddéétteerrmmiinnaann eellllee àà qquuii iill aa ééttéé ddéélliivvrréé,, «« vvéérriiffiiaabbllee ppaarr rraappppoorrtt àà llaa ssoouurrccee.. oouuaanneess aa aaddooppttéé eenn JJuuiinn 22000022 uunnee rréé cchhaannggeess ddee llaa cchhaaîînnee llooggiissttiiqquuee iinntteerr rroottééggeerr llee ccoommmmeerrccee iinntteerrnnaattiioonnaall ccoo qquuee iinntteerrnnaattiioonnaallee ccoonnttrree ssoonn uuttiilliissaatt ttiioonnss mmaassssiivvee ppoouurr ddeess vviissééeess tteerrrroorr ss pprriinncciippaauuxx :: oouuaanniièèrreess ddaannss ll''ééttaabblliisssseemmeenntt ddee rréé oouuaanniièèrreess àà uunnee bbaassee ddee ddoonnnnééeess ddee ddee ll''OOMMDD ddee 11997722 ssuurr lleess ccoonntteenneeuurr uuee llee 1199 jjuuiinn 22000033.. CCeettttee qquueessttiioonn éé rree aa ééttéé ééllaabboorréé ppoouurr oobbtteenniirr lleess aavviis 22BB)) rreeff :: IISSBBNN 9922--22--221122888855--00,, IISSBBNN oonntt bbiieenn ssûûrr lleess pplluuss rreepprréésseennttaattiivveess ffiinn dd''aamméélliioorreerr llee sseecctteeuurr ddee llaa ssûûrreett aaiirree aauu ddoommaaiinnee ddee llaa ssééccuurriittéé mmaarriitt vee ddaannss ccee ddoommaaiinnee.. DDééjjàà ccoonncceerrnnééee 11 sseepptteemmbbrree 22000011 ccoommmmee llee pprroouuvvee éérreennccee àà llaa nnéécceessssiittéé ddee rreennffoorrcceerr llaa aalliissaanntt ddeess ccrrooiissiièèrreess eenn EEuurrooppee,, llaa CC rreenntteess iinnssttaanncceess eett nnoottaammmmeenntt ddee ll'' MMMMMMMMAAAAAAAARRRRRRRRCCCCCCCCHHHHHHHHEEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEE DDDDDDDDEEEEEEEE LLLLLLLL''''''''EEEEEEEEUUUUUUUURRRRRRRROOOOOOOOPPPPPPPPEEEEEEEE ttoouutteess lleess zzoonneess dd''uunn eessssiioonn dd''uunn lliivvrreett ddee llaa CCoonnfféérreennccee eerrnnaanntt uunn ssyyssttèèmmee llaa ccoonnvveennttiioonn nn°°110088 oouurr ll''aamméélliioorraattiioonn ddee ddee mmeerr,, rreelleevvaanntt ddee llaa eettttee dd''ooppéérreerr uunnee nntt qquuee llaa ppeerrssoonnnnee qquuii ee »» ggrrââccee aauu ccoonnttrrôôllee ééssoolluuttiioonn rreellaattiivvee àà llaa rrnnaattiioonnaallee.. SSaa mmiissee eenn oonnttrree lleess aattttaaqquueess ttiioonn ppoouurr llee ttrraannssppoorrtt rriisstteess.. LL''OOMMDD ttrraavvaaiillllee ééggiimmeess ddee ssûûrreettéé ddee llaa ee ll''OOMMDD.. rrss.. ééttaaiitt llaa nnuumméérroo 77 àà iss ddeess ddiifffféérreennttss ééttaattss.. NN 9922--22--221122888866--99,,IISSBBNN ss ppoouurr ééllaabboorreerr ddeess ttéé mmaarriittiimmee,, ttiimmee,, ll''UUnniioonn ee ppaarr llee pprroobbllèèmmee ee llee LLiivvrree bbllaanncc ssuurr lleess ssûûrreettéé ddeess ppaassssaaggeerrss CCoommmmiissssiioonn rreessttee ttrrèèss ''OOMMII.. EEEEEEEE
  • LLaa CCoommmmiissssiioonn eeuurrooppééeennnnee ccoonn ssûûrreettéé ddee ll''eennsseemmbbllee ddee llaa cchhaaîî ffoouurrnniisssseeuurr aauu ccoonnssoommmmaatteeuurr.. uunnee pprrooppoossiittiioonn ddee rrèègglleemmeenntt (((((((( ll''aapppplliiccaattiioonn ddeess nnoorrmmeess lleess pplluu LLaa ccoommmmiissssiioonn aa ddoonncc cchhooiissii dd''aa mmaarriittiimmee eenn aaddooppttaanntt ddeess iinnssttrr BBiieenn qquu''eellllee ssee ssooiitt iinnssppiirrééee ddeess ll''OOrrggaanniissaattiioonn mmaarriittiimmee iinntteerrnnaa ttrraavvaauuxx ccoommpplléémmeennttaaiirreess ddooiivvee iinntteerrnnaattiioonnaalleess,, eett nnoottaammmmeenntt ttrraaiitteemmeenntt gglloobbaall ddeess pprroobbllèèmmee bbiillaattéérraalleess tteelllleess qquuee cceelllleess qquuii CC''eesstt ppoouurrqquuooii llaa ccoommmmuunniiccaattiioo llaa ssûûrreettéé ddeess nnaavviirreess eett ddeess iinnss ééllaarrggiitt llee ddéébbaatt aauu ttrraannssppoorrtt mmaa ((((((((5555555555555555)))))))) :::::::: RRèègglleemmeenntt dduu PPaarrlleemmeenntt ssûûrreettéé ddeess nnaavviirreess eett ddeess iinnssttaall EEllllee ss''iinnttéérreessssee eenn ppaarrttiiccuulliieerr,, aa ll''iiddeennttiiffiiccaattiioonn ddeess ggeennss ddee mmeerr ttrraannssppoorrtt iinntteerrmmooddaallee.. LLee rrèègglleemmeenntt vvaa aauu--ddeellàà ddeess mm cceerrttaaiinneess eexxiiggeenncceess ccoorrrreessppoonndd IISSPPSS)),, aaffiinn ddee rreelleevveerr llee nniivveeaauu LLee rrèègglleemmeenntt vvaa aauu--ddeellàà ddeess mm cceerrttaaiinneess eexxiiggeenncceess ccoorrrreessppoonndd IISSPPSS)),, aaffiinn ddee rreelleevveerr llee nniivveeaauu dd''iinntteerrpprrééttaattiioonn dd''uunn EEttaatt mmeemmb dd''uunnee aauuttoorriittéé nnaattiioonnaallee rreessppoonn ppoorrttuuaaiirreess ,, eett ll''aaddooppttiioonn,, ppoouurr mmiissee eenn ooeeuuvvrree ddeess ppllaannss nnaattiioo uunn pprroocceessssuuss dd''iinnssppeeccttiioonnss,, ssuupp ccoonnttrrôôllee eett llaa mmiissee eenn ooeeuuvvrree dd SSuurrttoouutt ccee rrèègglleemmeenntt éétteenndd ll''eenn SSOOLLAASS eett ddee llaa ppaarrttiiee AA dduu ccoodde aauu sseeiinn ddee llaa CCoommmmuunnaauuttéé,, eett p LLaa ttoouuttee rréécceennttee AAggeennccee EEuurrooppéé uunnee ffooiiss llaa ssééccuurriittéé eett llaa ssûûrreettéé ss''eesstt vvuu aattttrriibbuueerr uunn rrôôllee dd''aassssii DDaannss llee ddoommaaiinnee ddee llaa ssûûrreettéé mm vvoolloonnttéé ppoolliittiiqquuee dd''aamméélliioorraattiioonn ll''iimmppaaccttee dd''uunn aatttteennttaatt eesstt bbeeaauu nnssiiddèèrree qquuee ddééssoorrmmaaiiss iill eesstt nnéécceessssaa îînnee llooggiissttiiqquuee aapppprroovviissiioonnnnaanntt llee ttrraann EEnn ccoonnssééqquueennccee,, eellllee aa aaddooppttéé uunnee ((((((((5555555555555555)))))))) vviissaanntt àà iimmppoosseerr ddaannss ttoouutteess ll''UU uuss éélleevvééeess ddee ssûûrreettéé dduu ttrraannssppoorrtt mmaa aappppoorrtteerr uunnee rrééppoonnssee gglloobbaallee aauu pprroo rruummeennttss iinntteerrnnaattiioonnaauuxx ccoommmmee llee ccoo ss ccoonncclluussiioonnss ddee llaa CCoonnfféérreennccee ddiipplloom aattiioonnaallee dduu 1122 ddéécceemmbbrree 22000022,, eellllee ee eenntt nnééaannmmooiinnss êêttrree mmeennééss ddaannss dd''aauu aauu sseeiinn ddee ll''UUnniioonn EEuurrooppééeennnnee,, ppoouu eess qquuii ssee ppoosseenntt eett éévviitteerr llee rreeccoouurrss oonntt ééttéé llaannccééss ppaarr cceerrttaaiinnss ppaayyss ttiieerr oonn ddee llaa CCoommmmiissssiioonn EEuurrooppééeennnnee vvaa ssttaallllaattiioonnss ppoorrttuuaaiirreess tteellllee qquu''eellllee eesstt aarriittiimmee eenn ggéénnéérraall.. tt eeuurrooppééeenn eett dduu CCoonnsseeiill rreellaattiivvee àà ll'' llllaattiioonnss ppoorrttuuaaiirreess.. 22000033//00008899 (( CCOODD aauuxx zzoonneess ppoorrttuuaaiirreess ccoonnssiiddéérrééeess ddaa rr eett àà llaa ssûûrreettéé dd''uunn bboouutt àà ll''aauuttrree ddee mmeessuurreess aaddooppttééeess ppaarr ll''OOMMII eenn cceeccii qq ddaanntt sseeuulleemmeenntt àà ddeess rreeccoommmmaannddaattii uu ddee ssûûrreettéé mmeessuurreess aaddooppttééeess ppaarr ll''OOMMII eenn cceeccii qq ddaanntt sseeuulleemmeenntt àà ddeess rreeccoommmmaannddaattii uu ddee ssûûrreettéé rreecchheerrcchhéé eett ssuurrttoouutt dd''éévv bbrree àà ll''aauuttrree :: cc''eesstt ppoouurr cceellaa qquu''iill iimm nnssaabbllee ddee llaa ssûûrreettéé ddeess nnaavviirreess eett ddee cceerrttaaiinneess mmooddaalliittééss dduu rrèègglleemmeenntt,, dd oonnaauuxx aaddooppttééss ddaannss llee ccaaddrree dduu rrèèggllee ppeerrvviisséé ppaarr llaa ccoommmmiissssiioonn,, ppoouurr vvéérrii ddeess ppllaannss nnaattiioonnaauuxx aaddooppttééss ddaannss llee nnsseemmbbllee ddeess eexxiiggeenncceess dduu cchhaappiittrree XX ee IISSPPSS aauuxx nnaavviirreess eeffffeeccttuuaanntt ddeess dd pplluuss ppaarrttiiccuulliièèrreemmeenntt aauuxx nnaavviirreess àà ééeennnnee ppoouurr llaa ssééccuurriittéé mmaarriittiimmee (( EEMM éé nnee ssoonntt mmaaiinntteennaanntt eennvviissaaggééss qquuee iissttaannccee àà llaa CCoommmmiissssiioonn ddaannss ll''eexxééccuu mmaarriittiimmee,, aauujjoouurrdd''hhuuii,, iill eesstt ddiiffffiicciillee dd nn ddeess ssttrruuccttuurreess eett ddeess mmooyyeennss eenn pp uuccoouupp pplluuss ggrraanndd qquuee ll''iimmppaaccttee dd''uunn aaiirree dd''aamméélliioorreerr llaa nnssppoorrtt mmaarriittiimmee,, dduu ccoommmmuunniiccaattiioonn eett UUnniioonn eeuurrooppééeennnnee aarriittiimmee.. oobbllèèmmee ddee ssûûrreettéé ooddee IISSPPSS.. mmaattiiqquuee ddee eessttiimmee qquuee ddeess uuttrreess eenncceeiinntteess uurr ggaarraannttiirr uunn àà ddeess iinniittiiaattiivveess rrss.. aa aauu--ddeellàà dduu ccaaddrree ddee tt aabboorrddééee ppaarr ll''OOMMII eett ''aamméélliioorraattiioonn ddee llaa DD )) aannss lleeuurr gglloobbaalliittéé,, àà ee llaa cchhaaîînnee ddee qquu''iill rreenndd oobblliiggaattooiirreess iioonnss ((ppaarrttiiee BB dduu ccooddee qquu''iill rreenndd oobblliiggaattooiirreess iioonnss ((ppaarrttiiee BB dduu ccooddee vviitteerr ddeess ddiivveerrggeenncceess mmppoossee llaa nnoommiinnaattiioonn eess iinnssttaallllaattiioonnss dd''uunn ccaalleennddrriieerr ddee eemmeenntt,, qquu''iill pprréévvooiitt iiffiieerr lleess mmooddaalliittééss ddee ccaaddrree dduu rrèègglleemmeenntt.. XXII--22 ddee llaa CCoonnvveennttiioonn ddeesssseerrtteess nnaattiioonnaalleess ppaassssaaggeerrss.. MMSSAA )) ((((((((5555555566666666)))))))) ,, eennccoorree ddee mmaanniièèrree ssiimmiillaaiirree,, uuttiioonn ddee sseess ttââcchheess.. ddee mmeettttrree eenn ddoouuttee llaa ppllaaccee.. AA ll''éévviiddeennccee nn aacccciiddeenntt mmaarriittiimmee
  • mmêêmmee aavveecc ppoolllluuttiioonn,, cceett iimmppaacc dduu PPrreessttiiggee,, ll''éémmoottiioonn aa ssuurrttoouutt ((((((((5555555566666666)))))))) :::::::: AAggeennccee ccrrééééee ppaarr llee rrèèggll CCoonnsseeiill dduu 2277 JJuuiinn 22000022 LLeess aatttteennttaattss dduu 1111 sseepptteemmbbrree mmoonnddiiaallee.. MMaaiiss bbiieenn qquuee cceettttee vv oouu tteennssiioonnss ssoonntt ddééjjàà aappppaarruueess pprrooppoossee ddaannss llaa pprroocchhaaiinnee sseecctt SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFF LLaa ddiimmeennssiioonn ddee llaa ssûûrreettéé eesstt dd ss''aaggiitt dd''uunn ddoommaaiinnee qquuii eemmppiièètte iinntteerrvveennaannttss,, ccee qquuii rreenndd ddiiffffiiccii ddiifffféérreennttss sseecctteeuurrss.. CCoommmmee ttoouu ssoonntt aappppaarruueess eett aappppaarraaiisssseenntt qquuee llee 11eerr JJuuiilllleett 22000044.. CCeess ddiiffff ppoolliittiiqquuee oouu «« ddiipplloommaattiiqquuee »» ee .. SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFF CCoommmmee nnoouuss ll''aavvoonnss éénnoonnccéé aauu mmaaiiss cceettttee vvoolloonnttéé ss''eesstt ssoollddeerr CCoommmmiissssiioonn EEuurrooppééeennnnee.. LLaa pprreemmiièèrree rrééaaccttiioonn ddee llaa CCoomm pprriisseess ddaannss llee ccaaddrree dduu CCSSII.. CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRR :::::::: LLLLLLLLEEEEEEEE CCCCCCCCAAAAAAAASSSSSSSS DDDDDDDD LLeess EEttaattss--UUnniiss ffoorrttss ddee lleeuurr ppuuiis mmoonnddiiaauuxx eenn tteerrmmeess dd''éécchhaannggee aavveecc nnoottaammmmeenntt uunn ccoonnttrrôôllee ppaa dd''éécchhaannggeess dd''iinnffoorrmmaattiioonnss eett ddee cceett aauuddiitt ppaarr lleess ddoouuaanneess aamméérr lleeuurr ppeerrmmeettttaanntt dd''eeffffeeccttuueerr lleess llaabbeell,, lleess éécchhaannggeess ssee ttrroouuvveenntt ssuurrttoouutt aavveecc ddeess ddééllaaiiss bbeeaauuccoou CCeess ddiissppoossiittiioonnss oonntt ééttéé ccoonnççuuee mmaanniièèrree bbiillaattéérraallee ddaannss ll''iiggnnoorraa llaa CCoommmmiissssiioonn,, qquuii aa ééttéé aammeenn iinnssttiittuuaanntt llaa CCoommmmuunnaauuttéé eeuurroo FFaaccee àà cceettttee ssiittuuaattiioonn,, eett aauuxx rréé aamméérriiccaaiinneess,, llaa CCoommmmiissssiioonn aa oo nnééggoocciiaattiioonn ssuurr lleess mmaattiièèrreess rreel ccttee ééttaanntt mmoonnddiiaall eett nnoonn sseeuulleemmeenntt tt ééttéé EEuurrooppééeennnnee.. leemmeenntt 11440066//22000022//CCEE dduu PPaarrlleemmeenntt 22000011 oouu ddee BBAALLII oonntt qquuaanntt àà eeuuxx uu vvoolloonnttéé ppoolliittiiqquuee ssooiitt éévviiddeennttee,, lleess pp ss aavvaanntt mmêêmmee ll''eennttrrééee eenn vviigguueeuurr dduu ttiioonn ddee lleess rraappppeelleerr.. IIIIFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEE MMMMMMMMIIIIIIIISSSSSSSSEEEEEEEE EEEEEEEENNNNNNNN ddoonncc uunnee nnoottiioonn ttoouuttee rréécceennttee ddaannss ll ee ssuurr pplluussiieeuurrss sseecctteeuurrss eett ooùù iill eexxiiss iillee llaa ddéétteerrmmiinnaattiioonn ddeess ffrroonnttiièèrreess eexx uuttee rréégglleemmeennttaattiioonn nnaaiissssaannttee,, ddeess ddii eennccoorree,, rraappppeelloonnss qquuee llee ccooddee IISSPPSS ffiiccuullttééss ssoonntt ddee ddeeuuxx ssoorrtteess :: ddeess ddiiff eett ddeess ddiiffffiiccuullttééss ddiissoonnss pplluuss pprraattiiqquuee FFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEESSSSSSSS PPPPPPPPOOOOOOOOLLLLLLLLIIIIIIIITTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEESSSSSSSS OOOOOOOOUUUUUUUU «««««««« DDDDDDDDIIIIIIIIPPPPPPPP uu pprrééaallaabbllee,, lleess EEttaattss--UUnniiss ssoonntt ttrrèèss ppaarr ddeess iinniittiiaattiivveess ddéénnoonnccééeess eett iinnaac mmmmiissssiioonn EEuurrooppééeennnnee aa ssuuiivvii lleess aaccttiioo DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA CCCCCCCCSSSSSSSSIIIIIIII :::::::: issssaannccee ééccoonnoommiiqquuee oonntt ddéémmaarrcchhéé llee eess ddee ccoonntteenneeuurrss eett oonntt iimmppoosséé ddeess aarr lleess ddoouuaanneess aamméérriiccaaiinneess ddeess ssyysstt eess ssyyssttèèmmeess ddee ccoonnttrrôôllee ddeess ccoonntteennee rriiccaaiinneess,, llee ppoorrtt ccoonncceerrnnéé ssee vvooiitt ddéécc éécchhaannggeess ccoommmmeerrcciiaauuxx vveerrss lleess EEttaa tt rraalleennttiiss ppaarr ddeess ffoorrmmaalliittééss bbeeaauuccoouu uupp pplluuss lloonnggss.. eess eett mmiisseess eenn ppllaaccee,, eenn ccee qquuii ccoonnccee aannccee ddee ll''aaccqquuiiss ccoommmmuunnaauuttaaiirree eett ss nnééee àà rrééaaggiirr ccoonnffoorrmméémmeenntt aauuxx ddiissppoo ooppééeennnnee.. ééppoonnsseess iinnddiivviidduueelllleess ddeess EEttaattss mmeemm oobbtteennuu llee 1188 mmaarrss 22000033 dduu CCoonnsseeiill uu elleevvaanntt dduu ddoommaaiinnee ccoommmmuunnaauuttaaiirree a rrééggiioonnaall.. AA llaa ssuuiittee t eeuurrooppééeenn eett dduu uunnee rrééppeerrccuussssiioonn pprreemmiièèrreess ddiiffffiiccuullttééss uu ccooddee IISSPPSS eett jjee mmee OOOOOOOOEEEEEEEEUUUUUUUUVVVVVVVVRRRRRRRREEEEEEEE :::::::: llee mmoonnddee mmaarriittiimmee ;; iill ssttee ddee nnoommbbrreeuuxx xxaacctteess eennttrree lleess iiffffiiccuullttééss nn''eennttrreerraa eenn vviigguueeuurr ffffiiccuullttééss dd''oorrddrree eess ddee llooggiissttiiqquuee.. PPPPPPPPLLLLLLLLOOOOOOOOMMMMMMMMAAAAAAAATTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE »»»»»»»» :::::::: aaccttiiffss eenn llaa mmaattiièèrree acccceeppttaabblleess ppoouurr llaa oonnss aamméérriiccaaiinneess eess pplluuss ggrraannddss ppoorrttss mmeessuurreess ddee ssûûrreettéé ttèèmmeess iinnffoorrmmaattiiqquueess eeuurrss ((ssccaannnneerr)).. AApprrèèss cceerrnneerr uunn llaabbeell CCSSII aattss--UUnniiss.. SSaannss ccee uupp pplluuss ccoommpplleexxeess eett eerrnnee ll''EEuurrooppee,, ddee ssaannss ccoonncceerrttaattiioonn aavveecc oossiittiioonnss dduu TTrraaiittéé mmbbrreess aauuxx ddeemmaannddeess uunnee aauuttoorriissaattiioonn ddee aaffiinn ddee ppaarrvveenniirr aavveecc
  • lleess aauuttoorriittééss ddoouuaanniièèrreess aamméérriicc ppoorrttaanntt ssuurr llee ddéévveellooppppeemmeenntt dd nnéécceessssiittéé ddee ssééccuurriisseerr llee ccoommmm eesstt ddeessttiinnéé àà ssuuppppllaanntteerr lleess aarrrr EEttaattss mmeemmbbrreess eett llee sseerrvviiccee ddee rréécciipprroocciittéé eett ddee nnoonn--ddiissccrriimmiinnaa CCoommmmuunnaauuttéé eett lleess EEttaattss--UUnniiss.. ccoonnjjooiinntt ddeess mmiisseess eenn ooeeuuvvrree dd LLaa pprriinncciippaallee pprrééooccccuuppaattiioonn ddee ddééllooyyaallee eennttrree lleess ppoorrttss((((((((5555555577777777)))))))),, ccoo HHaavvrree eett MMaarrsseeiillllee ccoonncceerrnnaanntt ll CC''eesstt ppoouurrqquuooii llaa CCoommmmiissssiioonn éé qquuee ddeess ccrriittèèrreess ccoommmmuunnss ppoouurr ssiittuuaattiioonn ddee ccoonnccuurrrreennccee ss''iinnssttaa LLeess EEttaattss--UUnniiss ttrrèèss pprrééooccccuuppééss eenn llaa mmaattiièèrree eett iillss ssuuiivveenntt ddee tt ppaassssaaggee cceerrttaaiinnss ddrrooiittss qquuii llaa aa ((((((((5555555577777777)))))))) :: vvooiirr nnoottee AAFF EEUURR--22000033--55 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCOOOOOOOONNNNNNNNDDDDDDDD :::::::: LLLLLLLLEEEEEEEE CCCCCCCCOOOOOOOODDDDDDDDEEEEEEEE SSuuiittee àà llaa rrééuunniioonn dduu ggrroouuppee ddee ddeess ttrraannssppoorrttss qquuii ss''eesstt rrééuunnii àà ll''UUnniioonn EEuurrooppééeennnnee oonntt eeuu ll''oocccc iinntteerrnnaattiioonnaallee ppoouurr lleess mmeessuurreess aaddooppttééeess eenn ddéécceemmbbrree 22000022.. LLeess GGaarrddee--CCôôtteess aamméérriiccaaiinnss oonn iinnttéérriimmaaiirreess dduu 11eerr jjuuiilllleett.. CCeeppeennddaanntt iillss ffoonntt ffaaccee àà ddeess pp ppoouurr aapppprroouuvveerr lleess ppllaannss ddee ssûû EEttaattss dduu ppaavviilllloonn)).. CCeellaa cc''eesstt ddéé pplluuss pprréécciisséémmeenntt ddaannss llee ccaaddrree eennvviissaaggee ddee ttoouucchheerr uunn ppoorrtt aamm OOiill PPoolllluuttiioonn EEmmeerrggeennccyy PPllaann)) qq ccaaddrree ddeess cceerrttiiffiiccaattss oobblliiggaattooiirree vvaalliiddiittéé ddeess cceerrttiiffiiccaattss ssûûrreettéé ddéé DDee lleeuurr ccôôttéé lleess UUSSAA oonntt ccoommmm ccoonncceerrnnééss aauu ttoottaall)).. CCeettttee ddéémmaarrcchhee eesstt eennccoorree uunnee ccrriittiiqquuee ppaarr rraappppoorrtt àà cceettttee ddéémm VVooiiccii ddoonncc éénnoonnccééss lleess pprriinncciippaa eennttrree llaa ccoommmmuunnaauuttéé EEuurrooppééeenn ddiifffféérreenntteess mmeessuurreess qquuii ccoonncceerrnn éévvooqquuéé eennccoorree lloorrss ddeess ddiifffféérreenn ccaaiinneess àà uunn aaccccoorrdd eennttrree llaa CCoommmmuunn dd''uunn ssyyssttèèmmee ddee ccoonnttrrôôllee ddeess eexxppoorrtt mmeerrccee iinntteerrnnaattiioonnaall eeffffeeccttuuéé ppaarr ccoonntte rraannggeemmeennttss bbiillaattéérraauuxx ccoonncclluuss ppoouurr eess ddoouuaanneess aamméérriiccaaiinneess.. IIll sseerraa bbaasséé aattiioonn ss''aapppplliiqquuaanntt àà ll''eennsseemmbbllee ddeess éé .. AA tteerrmmee cceett aaccccoorrdd ddeevvrraaiitt ppeerrmmeetttt ddee mmeessuurreess ddeessssiinnééeess ddee ccoommmmuunn aacc llaa ccoommmmiissssiioonn eesstt dd''éévviitteerr ddeess éélléémm oommmmee cceellaa eesstt ddééjjàà aappppaarruu ssuurr llee ppllaa llee CCSSII.. ééttuuddiiee ééggaalleemmeenntt ddeess ssttaannddaarrddss ccoomm rr lleess ccoonnttrrôôlleess ddoouuaanniieerrss aaffiinn ddee nnee aauurreerr.. ppaarr cceess qquueessttiioonnss ddee ssûûrreettéé ddééssiirreenn ttrrèèss pprrêêtt llaa qquueessttiioonn dduu ccooddee IISSPPSS,, ss aauussssii iirrrriittee llaa CCoommmmuunnaauuttéé EEuurrooppééeenn 5599//cciirrcc 1111003399 dduu 2266 MMaaii 22000033 IIIIIIIISSSSSSSSPPPPPPPPSSSSSSSS :::::::: ee ccooooppéérraattiioonn UUnniioonn EEuurrooppééeennnnee // EE àà WWaasshhiinnggttoonn lleess 1177 eett 1188 jjuuiilllleett 220000 ccaassiioonn ddee pprréécciisseerr qquu''iillss ssoouuttiieennnneenntt ss ddee ssûûrreettéé,, cc''eesstt--àà--ddiirree ll''aapppplliiccaattiioonn nntt ssuuiivvii cceettttee aapppprroocchhee eenn ééllaabboorraanntt pprreessssiioonnss ppoolliittiiqquueess ddee llaa ppaarrtt ddee llaa cc ûûrreettéé ddeess nnaavviirreess ((aauu lliieeuu dd''aacccceepptteerr ééjjàà ttrraadduuiitt ddaannss llee ddoommaaiinnee ddee llaa sséécc ee ddee ll''OOPPAA ppaarr ll''oobblliiggaattiioonn àà ttoouutt nnaavvi mméérriiccaaiinn ddee ffaaiirree vvaalliiddeerr ppaarr lleess UUSSCC qquuii ddooiitt ddééjjàà êêttrree aapppprroouuvvéé ppaarr ll''EEttaatt eess.. LLeess EEttaattss--UUnniiss ddaannss ccee ccaass nnee rreecc éélliivvrrééss ppaarr lleess ddiifffféérreennttss EEttaattss dduu ppaa mmeennccéé uunnee éévvaalluuaattiioonn ddeess ppoorrttss ééttrraann ee ffooiiss uunniillaattéérraallee eett llaa CCoommmmiissssiioonn EE mmaarrcchhee.. EEllllee aa ffaaiitt lleess mmêêmmeess rreemmaarrq aauuxx pprroobbllèèmmeess rreennccoonnttrrééss ssuurr llee ppllaann nnnnee eett lleess EEttaattss--UUnniiss ppoouurr llaa mmiissee eenn nneenntt llaa ssûûrreettéé mmaarriittiimmee.. UUnn pprroobbllèèmm nntteess ddiissccuussssiioonnss mmaaiiss nnuull ddoouuttee qquu''iill nnaauuttéé eett lleess EEttaattss--UUnniiss ttaattiioonnss,, qquuii iinnttèèggrree llaa teenneeuurrss.. UUnn tteell aaccccoorrdd ll''hheeuurree eennttrree cceerrttaaiinnss éé ssuurr ddeess pprriinncciippeess ddee éécchhaannggeess eennttrree llaa ttrree uunn ccoonnttrrôôllee ccccoorrdd.. mmeennttss ddee ccoommppééttiittiioonn aann nnaattiioonnaall eennttrree LLee mmmmuunnss ddee ssûûrreettéé,, aaiinnssii ppaass llaaiisssseerr uunnee nntt aavvooiirr llaa mmaaiinn mmiissee ss''aaccccaappaarraanntt aauu nnnnee.. EEttaattss UUnniiss ssuurr llaa ssûûrreettéé 0033,, lleess EEttaattss--UUnniiss eett tt uunnee aapppprroocchhee nn ddeess mmeessuurreess lleeuurrss rrèègglleess cchhaammbbrree ddeess ddééppuuttééss lleess ddéécciissiioonnss ddeess ccuurriittéé mmaarriittiimmee eett iirree ppééttrroolliieerr qquuii CCGGss lleeuurr ppllaann SSOOPPEEPP (( tt dduu ppaavviilllloonn ddaannss llee ccoonnnnaaîîttrraaiieenntt ppaass llaa aavviilllloonn.. nnggeerrss ((22,,660000 ppoorrttss EEuurrooppééeennnnee eesstt ttrrèèss rqquueess qquuee ppoouurr llaa CCSSII.. nn ddeess ddiissccuussssiioonnss nn ooeeuuvvrree ddeess mmee aa ééttéé ttrrèèss ppeeuu ll llee sseerraa ttrrèèss
  • rraappiiddeemmeenntt aapprrèèss llaa mmiissee eenn aapp jjuurriiddiiccttiioonn :: qquueelllleess ssoonntt lleess mmee ppaavviilllloonn ééttrraannggeerr,, ddaannss llee ccaaddrree LLeess aauuttrreess ddiiffffiiccuullttééss qquuii aappppaarraa SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFF BBeeaauuccoouupp pplluuss pprraattiiqquueess qquuee llee llooggiissttiiqquueess ssoonntt ttoouutteeffooiiss ttrrèèss pp ooeeuuvvrree dduu ccooddee IISSPPSS.. LLee pplluuss éé ccoonnffoorrmmiittéé aavveecc llee nnoouuvveeaauu cchhaa ccooddee IISSPPSS eesstt ddééjjàà bbiieenn aavvaannccéé eett aa ffaaiitt ggrraavveerr llee nnuumméérroo iinntteerr ddiissppoossiittiioonnss.. EEnn ffaaiitt llee ccooddee IISSPPSS nnee ddoonnnnee bb ttrroopp ddee lliibbeerrttéé aauuxx EEttaattss ppoouurr llaa pprroobbllèèmmeess ddee mmiissee eenn ooeeuuvvrree.. PPoouurr eexxeemmpplleess :: CCeerrttaaiinnss ppaayyss ssoonntt llooiinn ddee ppooss ffaauuddrraa ddéétteerrmmiinneerr qquueellllee ddeevvrraa ppoouurr qquu''iillss aatttteeiiggnneenntt ddeess ssttaanndd ddéécceemmbbrree 22000022 lloorrss ddee llaa ccoonnfféé LLee ppooiinntt rreessttaanntt eett nnoonn llee mmooii ssaavvooiirr llee ccôôttéé cceerrttiiffiiccaattiioonn eett ééllaa ss''aaggiitt dd''uunn pprroobbllèèmmee iimmppoorrttaanntt eett nnoottaammmmeenntt llaa FFrraannccee nn''oonntt pp pprrooffeessssiioonnnneellss ppoouurr ccee qquuii eesstt dd DDaannss llee ccaass ddee llaa FFrraannccee eeuu lliieeuu pprrooffeessssiioonnnneellss aauu sseeiinn dd''AArrmmaattee ffoorrmmaattiioonn ddeess CCoommppaaggnniiee SSeeccuu nn''aauurraaiitt jjaammaaiiss dduu êêttrree eennttaamméé qquueellqquueess mmooiiss ddee llaa mmiissee eenn ooee pprroovveennaanntt ddeess sseerrvviicceess ddee ll''EEttaa CCeess rrééuunniioonnss rreessttèèrreenntt ssttéérriilleess ccoonncceerrnnééee,, àà ssaavvooiirr lleess aaffffaaiirreess ppoouurr qquuee lleess ccoommppaaggnniieess eennttaamm ffoorrmmaattiioonnss sseerraaiieenntt rreeccoonnnnuueess àà uunn mmuurr ddee ssiilleennccee.. LLeess rrééppeerrcc iimmppoorrttaanntteess :: IIll nnee rreessttee qquuee ttrr llee ccooddee IISSPPSS ffiinn ddéécceemmbbrree,, llaa CC dd''ééttaabblliirr ddeess ppllaannss ddee ssûûrreettéé nnaa aauuxx yyeeuuxx ddee ll''aaddmmiinniissttrraattiioonn FFrr pppplliiccaattiioonn dduu ccooddee IISSPPSS,, llaa qquueessttiioonn eessuurreess ddee pprrootteeccttiioonn qquuee ppeeuutt pprreenndd ee dduu ccooddee IISSPPSS,, ddaannss uunn ppoorrtt dd''uunn aa aaiisssseenntt ddééjjàà ttoouucchheenntt àà llaa llooggiissttiiqquuee FFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEE LLLLLLLLOOOOOOOOGGGGGGGGIIIIIIIISSSSSSSSTTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE :::::::: eess pprroobbllèèmmeess eexxppoossééss pprrééccééddeemmmmeenn pprrééooccccuuppaanntt àà mmaaiinntteennaanntt mmooiinnss dd''uu ééttoonnnnaanntt ééttaanntt qquuee dduu ccôôttéé ddeess nnaavviirr aappiittrree ddee SSOOLLAASS qquuii ccoorrrreessppoonndd àà llaa ééee.. GGrraanndd nnoommbbrree ddee nnaavviirreess ppoossssèèdd rrnnaattiioonnaall dduu nnaavviirree ccoonnffoorrmméémmeenntt aauu bbiieenn ssoouuvveenntt qquuee ddeess ddiirreeccttiioonnss mmaaiiss aa mmiissee eenn ooeeuuvvrree ddee ccee ccooddee,, ccee qquuii ssssééddeerr ddeess ssttaannddaarrddss ccoonnvveennaabblleess ee aa êêttrree ll''aassssiissttaannccee àà aappppoorrtteerr aauuxx ppaayy ddaarrddss ddee ssûûrreettéé ééqquuiivvaalleenntt.. LLaa rrééssoolluu éérreennccee ddiipplloommaattiiqquuee ssuurr llaa ssûûrreettéé mm iinnddrree ccoonncceerrnnee llaa ppaarrttiiee «« mmaannaaggeemm aabboorraattiioonn ddeess ppllaannss ddee ssûûrreettéé ccoommpp ccaarr jjuussqquu''àà ccee jjoouurr cceerrttaaiinnss ééttaattss ddee ppaass eennccoorree ffaaiitt ccoonnnnaaîîttrree lleeuurr ppoossiittiioo ddeess mmooddaalliittééss ddee cceerrttiiffiiccaattiioonnss.. uu aauu ddéébbuutt ddee ll''aannnnééee ddee nnoommbbrreeuussee eeuurr ddee FFrraannccee ppoouurr eessssaayyeerr dd''ééllaabboorr uurriittyy OOffffiicceerr eett SShhiipp SSeeccuurriittyy OOffffiicceerr . ééee,, ééttaanntt dduu rreessssoorrtt ddee ll''aaddmmiinniissttrraattiioo eeuuvvrree dduu ccooddee IISSPPSS eett ssaannss llaa mmooiinndd aatt eellllee aa ééttéé rreenndduuee nnéécceessssaaiirree.. dduu ffaaiitt eennccoorree uunnee ffooiiss dduu ssiilleennccee ddee ss mmaarriittiimmeess.. EEnn eeffffeett,, uunn ppaarraammèèttrree mmeenntt lleess ffoorrmmaattiioonnss,, iill ffaallllaaiitt bbiieenn ssaa ppaarr llaa FFrraannccee eett llàà eennccoorree lleess aarrmmaatt ccuuttiioonnss ppoouurr uunnee ccoommppaaggnniiee ccoommmmee rrooiiss mmooiiss aavvaanntt qquuee lleess EEttaattss--UUnniiss nne CCMMAA//CCGGMM ééttaanntt mmaaiinntteennaanntt ccoonnttrraaiinn aavviirree eett ccoommppaaggnniiee ssaannss êêttrree ssuurr qquu'' rraannççaaiissee.. ddeess ccoonnfflliittss ddee ddrree uunn nnaavviirree bbaattttaanntt aauuttrree ééttaatt ?? ee ddee mmiissee eenn ooeeuuvvrree.. nntt,, lleess pprroobbllèèmmeess ddee uunn aann ddee llaa mmiissee eenn rreess,, llaa ppaarrttiiee mmiissee eenn aa ppaarrttiiee tteecchhnniiqquuee dduu ddee ddééjjàà ll''aappppaarreeiill AAIISS uuxx nnoouuvveelllleess ss llaaiissssee ssaannss ddoouuttee ii vvaa ppoosseerr qquueellqquueess eenn mmaattiièèrree ddee ssûûrreettéé,, iill yyss lleess mmooiinnss ffaavvoorriissééss uuttiioonn 55 aaddooppttééee llee 1122 mmaarriittiimmee nnee llee ddiitt ppaass.. mmeenntt »» dduu ccooddee,, àà ppaaggnniieess eett nnaavviirreess.. IIll ee ll''UUnniioonn EEuurrooppééeennnnee oonn aauupprrèèss ddeess eess rrééuunniioonnss eennttrree lleess rreerr uunn pprroojjeett ddee .. CCeettttee ddéémmaarrcchhee oonn FFrraannççaaiissee,, mmaaiiss àà ddrree iinnffoorrmmaattiioonn ee ll''aaddmmiinniissttrraattiioonn ééttaaiitt iinnddiissppeennssaabbllee aavvooiirr qquueelllleess tteeuurrss ssee ssoonntt hheeuurrttééss ee llaa CCMMAA//CCGGMM ssoonntt nee mmeetttteenntt eenn pprraattiiqquuee nntt ddee pprreennddrree llee rriissqquuee ''iillss sseerroonntt ssaattiissffaaiissaanntt
  • EEnn JJuuiilllleett 22000044 ddoonncc ddee nnoommbb mmaaiiss ppoouurr llee mmoommeenntt ll''OOMMII ss''eess nnoommmmeerr eett ddee mmeettttrree eenn ppllaaccee PPoouurr llee mmoommeenntt eenn FFrraannccee rriieenn mmaanniièèrree cceess oorrggaanniissmmeess ddeevvrroonn lleess ssuuiitteess ddoonnnnééeess àà uunnee aallaarrmm EEggaalleemmeenntt ssuurr uunn ppllaann nnaattiioonna 22000044,, ddee nnoommbbrreeuusseess aaccttiioonnss.. nniivveeaauuxx ddee ssûûrreettéé eett lleess ccoonnddiittii ddoonncc êêttrree hhoommooggèènnee ccee qquuii ppoouu vviiggiippiirraattee aapppplliiqquuéé ddaannss ll''eenncceeiinn aapppplliiccaabbllee aauuxx nnaavviirreess mmaaiiss aauuss UUnnee aauuttrree ddiiffffiiccuullttéé ssee ffeerraa ccoo ffrreett mmaarriittiimmee,, lleess vvoolluummeess ssoonntt mmaarrcchhaannddiisseess nnee ssoonntt rrééaalliisstteemm llee mmooddee ddeess ccoonnttrrôôlleess cciibbllééss.. LLee ssyyssttèèmmee ddeess 2244 hheeuurreess ddee ppoossee ddee rrééeelllleess ddiiffffiiccuullttééss aauupprrèè ll''iimmmmoobbiilliissaattiioonn ppuurree eett ssiimmppllee ééccoonnoommiiqquueemmeenntt nn''eesstt ppaass aannoo EEtt dd''aauuttrreess ddiiffffiiccuullttééss aappppaarraaîîttrro AA ll''hheeuurree aaccttuueellllee,, ccee qquuee ll''oonn pp mmaallhheeuurreeuusseemmeenntt eelllleess ssoonntt ddee qquu''aauu bbaallbbuuttiieemmeenntt.. EEssppéérroonnss qq ss''eessssoouuffffllee ppaass ccoommmmee cceellaa eesstt mmaarriittiimmee.. CCCCCCCCOOOOOOOONNNNNNNNCCCCCCCCLLLLLLLLUUUUUUUUSSSSSSSSIIIIIIIIOOOOOOOONNNNNNNN AApprrèèss ttoouuttee ccaattaassttrroopphhee mmaarriittiimm rrééccllaammeerr ddeess rréégglleemmeennttaattiioonnss ee éévvèènneemmeennttss ppuuiisssseenntt ssee pprroodduuii llaa rréégglleemmeennttaattiioonn,, ééllaabboorrééee aauu bbeellllee eett bbiieenn eett qquuii pplluuss eesstt rreecc ssééccuurriittéé mmaarriittiimmee.. SSii ll''OOMMII ppeenn ddee cceettttee rréégglleemmeennttaattiioonn,, iill nn''eenn pprriiss llee rreellaaiiss ccoommmmee nnoottaammmmeenn MMaaiiss aalloorrss ppoouurrqquuooii ddee tteellss éévvèè rreessttee uunn éélléémmeenntt iimmpprréévviissiibbllee ee rréégglleemmeennttaattiioonn nn''eesstt ppaass aapppplliiqq rréégglleemmeennttaaiirree nn''eesstt ppaass aapppplliiqquu rraaiissoonnss dd''oorrddrree ééccoonnoommiiqquuee eett oouuvveerrttee ppoouurr éécchhaappppeerr aauuxx oobbllii mmaarriittiimmee,,cchhaaccuunn ss''yy eennggoouuffffrree.. eeffffiiccaaccee ppoouurr rreemmeettttrree lleess ccoonnttrr mmiilliieeuu ddeess ttrraannssppoorrtteeuurrss mmaarriittiim bbrreeuuxx nnaavviirreess ppoossssééddeerroonntt llee ssyyssttèèmm sstt ccoonntteennttéé ddee llaaiisssseerr llee cchhooiixx aauuxx dd lleess oorrggaanniissmmeess cchhaarrggééss ddee llaa rréécceeppt nn nn''aa eennccoorree ééttéé ddiiffffuusséé ssuurr llaa qquueessttiioo nntt ééggaalleemmeenntt êêttrree ééqquuiippéé ddee rréécceeppttee mmee ?? naall lleess ggoouuvveerrnneemmeennttss ddeevvrroonntt mmeennee IIll ss''aaggiitt nnoottaammmmeenntt dd''ééttaabblliirr lleess rrèègg iioonnss ddee lleeuurr mmiissee eenn ooeeuuvvrree.. LL''iinntteerrff uurr ll''iinnssttaanntt nn''eesstt ppaass eennccoorree llee ccaass ppu nnttee ppoorrttuuaaiirree ccoommppoorrttee 44 nniivveeaauuxx aall ssssii aauuxx eenncceeiinntteess ppoorrttuuaaiirreess 33 nniivveeaa oonnnnaaîîttrree aauu nniivveeaauu ppoorrttuuaaiirree :: eenn mmaa tt tteelllleemmeenntt iimmppoorrttaannttss qquuee lleess ccoonnttrr mmeenntt ccoonncceevvaabblleess àà ll''eennttrrééee eenn zzoonnee nnoottiiccee ppoouurr lleess ccoonntteenneeuurrss iimmppoosséé pp èèss ddeess cchhaarrggeeuurrss,, ccaarr ccee ssyyssttèèmmee rree ddee llaa mmaarrcchhaannddiissee ppeennddaanntt uunn jjoouurr,, ooddiinn.. oonntt ssûûrreemmeenntt lloorrss ddee llaa mmiissee eenn ooeeuu ppeeuutt rreetteenniirr ddee cceess ddéémmaarrcchheess ssééccuurr eevveennuueess nnéécceessssaaiirreess mmaaiiss qquuee nnoouuss qquuee llaa vvoolloonnttéé àà aaggiirr ddéémmoonnttrrééee ppaarr t bbiieenn ssoouuvveenntt llee ccaass ddaannss llee sseecctteeuurr mmee,, ll''éémmoottiioonn eesstt ggrraannddee eett lleess cciittooyy eenn llaa mmaattiièèrree eett ttrroouuvveenntt ssccaannddaalleeuuxx iirree.. CCeettttee ééttuuddee aavvaaiitt ppoouurr bbuutt pprriinncc ffiill ddeess ccaattaassttrroopphheess mmaarriittiimmeess eett dduu coouuvvrree mmaaiinntteennaanntt llaa ttoottaalliittéé ddeess ddoomm nnddaanntt ddee ttrrèèss nnoommbbrreeuusseess aannnnééeess aa é nn eesstt pplluuss ddee mmêêmmee aauujjoouurrdd''hhuuii,, dd''aauu nntt ll''UUnniioonn EEuurrooppééeennnnee.. èènneemmeennttss ssee pprroodduuiisseenntt ?? TToouutt dd''aabboo eett uunn mmiilliieeuu hhoossttiillee mmaaiiss ssuurrttoouutt ppaarr qquuééee ppaarr ttoouuss eett ddee llaa mmêêmmee mmaanniièèrr uuéé ppaarr ttoouuss ddee llaa mmêêmmee mmaanniièèrree pprriinn llaa nnaattuurree hhuummaaiinnee ééttaanntt aaiinnssii ffaaiittee dd iiggaattiioonnss qquuii iinnccoommbbeenntt àà ttoouuss lleess aacc .. EEtt mmaallhheeuurreeuusseemmeenntt sseeuull llee bbââttoonn rreevveennaannttss ddaannss llee ddrrooiitt cchheemmiinn.. LLee pp immeess eesstt uunn mmiilliieeuu ooppaaqquuee eett iinntteerrnnaa mmee dd''aallaarrmmee ssiilleenncciieeuussee ddiifffféérreennttss ééttaattss ddee ttiioonn ddee cceess aallaarrmmeess.. oonn eett ddee ttoouuttee eeuurrss ;; qquueelllleess sseerroonntt eerr àà tteerrmmeess ppoouurr JJuuiinn gglleess ddééffiinniissssaannttss lleess 33 ffaaccee nnaavviirree // tteerrrree ddooiitt puuiissqquuee llee ppllaann lloorrss qquuee llee ccooddee IISSPPSS aauuxx.. aattiièèrree ddee ttrraannssppoorrtt ddee rrôôlleess pphhyyssiiqquueess ddeess ppoorrttuuaaiirree qquuee sseelloonn ppaarr lleess EEttaattss--UUnniiss eevviieenntt pprraattiiqquueemmeenntt àà ,, ccee qquuii uuvvrree dduu ccooddee IISSPPSS.. rriittaaiirreess,, cc''eesstt qquuee nn''eenn ssoommmmeess eennccoorree rr ttoouutt ddeerrnniièèrreemmeenntt nnee rr ddee llaa ssééccuurriittéé yyeennss oonntt tteennddaannccee àà xx qquuee ddee tteellss cciippaall ddee ddéémmoonnttrreerr qquuee uu XXXXèèmmee ssiièèccllee,, eexxiissttee mmaaiinneess lliiééss àà llaa ééttéé llee sseeuull iinniittiiaatteeuurr uuttrreess eennttiittééss aayyaanntt oorrdd ppaarrccee qquuee llaa mmeerr rrccee qquuee cceettttee rree.. LLee ccaaddrree nncciippaalleemmeenntt ppoouurr ddeess ddèèss qquu''uunnee bbrrèècchhee eesstt cctteeuurrss ddee llaa ssééccuurriittéé rreessttee uunn mmooyyeenn pprroobbllèèmmee ééttaanntt qquuee llee aattiioonnaall qquuii ppeerrmmeett
  • bbiieenn ssoouuvveenntt dd''éécchhaappppeerr aauuxx ssaannccttiioonnss.. MMaaiiss iill eesstt vvrraaii qquuee ll''aammbbiiaannccee aaccttuueellllee ddaannss ccee sseecctteeuurr eesstt pplluuss àà ll''ooppttiimmiissmmee,, lleess ttaauuxx ddee ffrreett cceess ddeerrnniièèrreess aannnnééeess oonntt tteennddaannccee àà rreemmoonntteerr eett llee ffaacctteeuurr qquuaalliittéé eesstt ddee pplluuss eenn pplluuss pprriiss eenn ccoonnssiiddéérraattiioonn eett mmeennttiioonnnnéé ddaannss lleess eenncceeiinntteess iinntteerrnnaattiioonnaalleess.. LLaa ssééccuurriittéé mmaarriittiimmee eenngglloobbee mmaaiinntteennaanntt uunn aauuttrree sseecctteeuurr ooùù,, eett cceellaa eesstt ssuuffffiissaammmmeenntt rraarree ppoouurr llee nnootteerr,, uunn ccoonnsseennssuuss aa ééttéé ttrroouuvvéé rraappiiddeemmeenntt.. IIll ss''aaggiitt ddee llaa ssûûrreettéé mmaarriittiimmee,, ddoommaaiinnee ttrrèèss ssoouuvveenntt éévvooqquuéé cceess ddeerrnniieerrss tteemmppss ddaannss llee mmiilliieeuu mmaarriittiimmee.. BBiieenn qquuee cceettttee nnoottiioonn ééttaaiitt ddééjjàà pprriissee eenn ccoommppttee ppaarr ll''UUnniioonn EEuurrooppééeennnnee aavvaanntt llee 1111 sseepptteemmbbrree 22000022,, eellllee aa ffaaiitt ll''oobbjjeett ddee pplluussiieeuurrss rréégglleemmeennttaattiioonnss,, ll''uunnee nnaattiioonnaallee aauuxx EEttaattss--UUnniiss,, llaa CCSSII eett ll''aauuttrree iinntteerrnnaattiioonnaallee,, llee ccooddee IISSPPSS,, ssuuiittee àà llaa pprreessssiioonn ddeess EEttaattss-- UUnniiss.. CCeess rréégglleemmeennttaattiioonnss ssoonntt ddeess rréégglleemmeennttaattiioonnss rréécceenntteess eett ddooiivveenntt ffaaiirree ffaaccee àà ddeess ddiiffffiiccuullttééss ddee mmiissee eenn ooeeuuvvrree.. CCeess ddoommaaiinneess ddee llaa ssééccuurriittéé mmaarriittiimmee eett mmaaiinntteennaanntt ddee llaa ssûûrreettéé mmaarriittiimmee rreesstteenntt ddeess ddoommaaiinneess ttrrèèss vvaasstteess eett ddééppeennddaanntt ddee llaa vvoolloonnttéé ddeess iinntteerrvveennaannttss eett ddeess oorrggaanneess nnoorrmmaattiiffss,, iill nnee ppeeuutt eexxiisstteerr ddee ffoorrmmuullee mmaatthhéémmaattiiqquuee qquuii ppuuiissssee ppeerrmmeettttrree ddee ppeennsseerr qquuee cceess ddoommaaiinneess sseerroonntt ttoottaalleemmeenntt mmaaîîttrriissééss.. IIll rreessttee cceeppeennddaanntt àà eessppéérreerr qquuee cceettttee éévvoolluuttiioonn ddeess mmeennttaalliittééss pprrééccééddeemmmmeenntt mmeennttiioonnnnééee ppeerrmmeettttee dd''aannttiicciippeerr lleess ccaattaassttrroopphheess mmaarriittiimmeess eett nnoonn pplluuss ddee lleess ssuubbiirr.. BBBBBBBBiiiiiiiibbbbbbbblllllllliiiiiiiiooooooooggggggggrrrrrrrraaaaaaaapppppppphhhhhhhhiiiiiiiieeeeeeee OOOOOOOOuuuuuuuuvvvvvvvvrrrrrrrraaaaaaaaggggggggeeeeeeeessssssss :::::::: BBOOIISSSSOONN PPhhiilliippppee,, «« PPoolliittiiqquueess eett ddrrooiittss ddee llaa ssééccuurriittéé mmaarriittiimmee »»,, BBuurreeaauu VVéérriittaass,, mmaaii 11999988,, nn°°116600 BBOONNAASSSSIIEESS PPiieerrrree,, «« DDrrooiitt mmaarriittiimmee ggéénnéérraall »» ;; CCoouurrss ppoollyyccooppiiééss.. BBOONNAASSSSIIEESS PPiieerrrree,, «« LLaa ppoolliittiiqquuee ccoommmmuunnee ddeess ttrraannssppoorrttss :: hhiissttoorriiqquuee eett aavveenniirr »»,, LLaa ccoommmmuunnaauuttéé eeuurrooppééeennnnee eett llaa MMeerr,, pp..550055 eett ssuuiivv.. RREEMMOONNDD GGOOUUIILLLLOOUUDD MMaarrttiinnee,, »»DDrrooiitt mmaarriittiimmee,, PPeeddoonnee,, 22èèmmee eedd,, 11999933.. WWOOLLGGEENNSSIINNGGEERR JJaaccqquueess -- LLaa ggrraannddee aavveennttuurree ddee llaa pprreessssee -- DDééccoouuvveerrtteess GGaalllliimmaarrdd 11998899 AAAAAAAAcccccccctttttttteeeeeeeessssssss ddddddddeeeeeeeessssssss iiiiiiiinnnnnnnnssssssssttttttttiiiiiiiittttttttuuuuuuuuttttttttiiiiiiiioooooooonnnnnnnnssssssss eeeeeeeeuuuuuuuurrrrrrrrooooooooppppppppééééééééeeeeeeeennnnnnnnnnnnnnnneeeeeeeessssssss 11)) DDiirreeccttiivveess eett rréégglleemmeennttss DDiirreeccttiivvee 9944//5577 dduu CCoonnsseeiill dduu 2222 nnoovveemmbbrree 11999944 ééttaabblliissssaanntt ddeess rrèègglleess eett nnoorrmmeess ccoommmmuunneess ccoonncceerrnnaanntt lleess oorrggaanniissmmeess hhaabbiilliittééss àà eeffffeeccttuueerr ll''iinnssppeeccttiioonn eett llaa vviissiittee ddeess nnaavviirreess eett lleess aaccttiivviittééss ppeerrttiinneenntteess ddeess aaddmmiinniissttrraattiioonnss mmaarriittiimmeess,, JJOOCCEE LL 331199//2200 dduu 1122 ddéécceemmbbrree 11999944.. DDiirreeccttiivvee 9955//2211 dduu CCoonnsseeiill dduu 1199 jjuuiinn 11999955 ccoonncceerrnnaanntt ll''aapppplliiccaattiioonn aauuxx nnaavviirreess ffaaiissaanntt eessccaallee ddaannss lleess ppoorrttss ddee llaa CCoommmmuunnaauuttéé oouu ddaannss lleess eeaauuxx rreelleevvaanntt ddee llaa jjuurriiddiiccttiioonn ddeess EEttaattss mmeemmbbrreess,, ddeess nnoorrmmeess iinntteerrnnaattiioonnaalleess rreellaattiivveess àà llaa ssééccuurriittéé mmaarriittiimmee,, àà llaa pprréévveennttiioonn eett aauuxx ccoonnddiittiioonnss ddee vviiee eett ddee ttrraavvaaiill àà bboorrdd ddeess nnaavviirreess (( ccoonnttrrôôllee ppaarr ll''EEttaatt dduu ppoorrtt )),, JJOOCCEE LL 115577//11 dduu 77 jjuuiilllleett 11999955..
  • DDiirreeccttiivvee 22000011//110055//CCEE dduu PPaarrlleemmeenntt eeuurrooppééeenn eett dduu CCoonnsseeiill dduu 1199 ddéécceemmbbrree 22000011 mmooddiiffiiaanntt llaa ddiirreeccttiivvee 9944//5577//CCEE dduu CCoonnsseeiill.. DDiirreeccttiivvee 22000011//110066//CCEE dduu PPaarrlleemmeenntt eeuurrooppééeenn eett dduu CCoonnsseeiill dduu 1199 ddéécceemmbbrree 22000011 mmooddiiffiiaanntt llaa ddiirreeccttiivvee 9955//2211//CCEE dduu CCoonnsseeiill.. RRèègglleemmeenntt ((CCEE)) nn°°441177//22000022 RRèègglleemmeenntt 11440066//22000022//CCEE dduu 2277 jjuuiinn 22000022 22)) AAcctteess ddee llaa ccoommmmiissssiioonn CCOOMM (( 9922 )) 449944 ffiinnaall dduu 22 ddéécceemmbbrree 11999922,, «« LLee ddéévveellooppppeemmeenntt ffuuttuurr ddee llaa ppoolliittiiqquuee ccoommmmuunnee ddeess ttrraannssppoorrttss »».. CCOOMM (( 9933 )) 6666 ffiinnaall dduu 2244 fféévvrriieerr 11999933,, «« PPoouurr uunnee ppoolliittiiqquuee ccoommmmuunnee ddee llaa ssééccuurriittéé mmaarriittiimmee »».. CCOOMM (( 9966 )) 8811 ffiinnaall dduu 1133 mmaarrss 11999966,, «« VVeerrss uunnee nnoouuvveellllee ssttrraattééggiiee mmaarriittiimmee »».. CCOOMM (( 22000000 )) 114422 ffiinnaall dduu 2211 mmaarrss 22000000,, «« CCoommmmuunniiccaattiioonn ddee llaa CCoommmmiissssiioonn aauu CCoonnsseeiill eett eeuu PPaarrlleemmeenntt eeuurrooppééeenn ssuurr llaa ssééccuurriittéé dduu ttrraannssppoorrtt ppééttrroolliieerr »».... RRRRRRRRaaaaaaaappppppppppppppppoooooooorrrrrrrrttttttttssssssss eeeeeeeetttttttt ddddddddooooooooccccccccuuuuuuuummmmmmmmeeeeeeeennnnnnnnttttttttssssssss ddddddddeeeeeeee ttttttttrrrrrrrraaaaaaaavvvvvvvvaaaaaaaaiiiiiiiillllllll BBAARRRREEAAUU AAllaaiinn,, «« LLee rreennffoorrcceemmeenntt ddee llaa ssééccuurriittéé mmaarriittiimmee :: uunnee aarrddeennttee eett pprreessssaannttee oobblliiggaattiioonn ppoouurr ll''EEuurrooppee »» ;; RRaappppoorrtt dd''iinnffoorrmmaattiioonn ddee llaa ddééllééggaattiioonn ddee ll''AAsssseemmbbllééee NNaattiioonnaallee ppoouurr ll''UUnniioonn eeuurrooppééeennnnee.. DDEE RRIICCHHEEMMOONNTT HHeennrrii,, «« EErriikkaa :: iinnddeemmnniisseerr eett pprréévveenniirr»» ;; RRaappppoorrtt dd''iinnffoorrmmaattiioonn dduu SSéénnaatt nn°° 444411 ((11999999--22000000)) -- TToommee 11 -- MMiissssiioonn ccoommmmuunnee dd''iinnffoorrmmaattiioonn ;; 1122 mmaaii 22000000.. JJOOSSSSEELLIINN CC.. ,, «« LLaa ssééccuurriittéé mmaarriittiimmee :: uunn ddééffii eeuurrooppééeenn eett mmoonnddiiaall »»,, DDééllééggaattiioonn ppoouurr ll''UUnniioonn eeuurrooppééeennnnee,, rraappppoorrtt ddee ll''AAsssseemmbbllééee nnaattiioonnaallee,, nn°°11448822 dduu 55 jjuuiilllleett 11999944,, pp.. 5555-- 5566.. TTTTTTTThhhhhhhhèèèèèèèèsssssssseeeeeeeessssssss eeeeeeeetttttttt mmmmmmmméééééééémmmmmmmmooooooooiiiiiiiirrrrrrrreeeeeeeessssssss BBEELLLLAAYYEERR--RROOIILLLLEE AA.. ,, «« LLee ttrraannssppoorrtt mmaarriittiimmee eett lleess ppoolliittiiqquueess ddee ssééccuurriittéé ddee ll''UUnniioonn EEuurrooppééeennnnee »»,, TThhèèssee ddee ddrrooiitt ppuubblliicc ppuubblliiééee ppaarr llee ppôôllee eeuurrooppééeenn JJeeaann-- MMoonnnneett,, UUnniivveerrssiittéé RReennnneess II ;; EEddiittiioonnss AAPPOOGGEEEE 22000000.. FFAAUURREE LLiioonneell,, «« LLaa ccoommmmuunnaauuttaarriissaattiioonn dduu MMéémmoorraanndduumm ddee PPaarriiss »»,, MMéémmooiirree dduu DDEESSSS DDrrooiitt mmaarriittiimmee eett ddrrooiitt ddeess ttrraannssppoorrttss ddee llaa ffaaccuullttéé dd''AAiixx--eenn--pprroovveennccee ssoouuss llaa ddiirreeccttiioonn ddee CChhrriissttiiaann SSCCAAPPEELL ;; CCeennttrree ddee ddrrooiitt mmaarriittiimmee eett ddeess ttrraannssppoorrttss (( CCDDMMTT )) 11999999.. SSAALLEEAA OOUUAADDJJ iinnttiittuulléé ::»»LLaa mmiissee eenn ooeeuuvvrree dduu IISSMM ccooddee ppaarr lleess ccoommppaaggnniieess mmaarriittiimmeess»» CCDDMMTT,,11999999 VVAACCCCAARROO SSoopphhiiee,, »»EEvvoolluuttiioonn ddee llaa ssééccuurriittéé mmaarriittiimmee eett aaddooppttiioonn ddee ll''IISSMM CCooddee :: llee ppooiinntt ddee vvuuee ddeess ssoocciiééttééss ddee ccllaassssiiffiiccaattiioonn »»,, mméémmooiirree ddee DDEESSSS,, DDrrooiitt mmaarriittiimmee eett ddeess ttrraannssppoorrttss,, AAiixx eenn PPrroovveennccee,, 11999955..
  • RRRRRRRReeeeeeeevvvvvvvvuuuuuuuueeeeeeeessssssss eeeeeeeetttttttt ppppppppéééééééérrrrrrrriiiiiiiiooooooooddddddddiiiiiiiiqqqqqqqquuuuuuuueeeeeeeessssssss MMAARRCCHHAANNDD GGuuyy,, «« MMaarriinnee mmaarrcchhaannddee.. LLaa ssééccuurriittéé mmaarriittiimmee »»,, JJuurriiss--ccllaasssseeuurr ccoommmmeerrcciiaall,, eedd.. tteecchhnniiqquueess,, 11999911,, nn°°11,, pp..33 BBuulllleettiinn ddee llaa NNaavviiggaattiioonn eett ddeess PPêêcchheess mmaarriittiimmeess,, rraappppoorrtt ddee llaa CCoommmmiissssiioonn SSéénnaattoorriiaallee ddeess EEttaattss--UUnniiss ssuurr llaa CCaattaassttrroopphhee dduu TTIITTAANNIICC,, ssoouurrccee :: ggaalllliiccaa..bbnnff..ffrr JJoouurrnnaall ddee llaa MMaarriinnee MMaarrcchhaannddee ((JJMMMM)),, hheebbddoommaaddaaiirree LLee MMaarriinn LLeess rreefflleettss ddee ll''OO..MM..II SSAALLVVAARRAANNII RR.. && LLIINNDDSSTTRROOMM SS.. ,, TThhee IInntteerrnnaattiioonnaall JJoouurrnnaall ooff SShhiippppiinngg LLaaww,, «« LLooookkiinngg bbeehhiinndd tthhee DDiirreeccttiivvee oonn PPoorrtt SSttaattee CCoonnttrrooll »».. PPaarrtt II,, MMaarrss 11999977 SSSSSSSSiiiiiiiitttttttteeeeeeeessssssss IIIIIIIInnnnnnnntttttttteeeeeeeerrrrrrrrnnnnnnnneeeeeeeetttttttt CCeennttrree ddee ddrrooiitt mmaarriittiimmee eett ddeess ttrraannssppoorrttss dd''AAiixx eenn PPrroovveennccee (( CCDDMMTT )) :: hhttttpp::////wwwwww..ccddmmtt..ddrrooiitt..uu--33mmrrss..ffrr CCoommiittéé cceennttrraall ddeess aarrmmaatteeuurrss :: hhttttpp::////wwwwww..aarrmmaatteeuurrssddeeffrraannccee..oorrgg CCoommmmiissssiioonn eeuurrooppééeennnnee :: hhttttpp::////wwwwww..eeuurrooppaa..eeuu..iinntt IISSEEMMAARR :: hhttttpp::////wwwwww..iisseemmaarr..aassssoo..ffrr MMiinniissttèèrree ddeess TTrraannssppoorrttss :: hhttttpp::////wwwwww..eeqquuiippeemmeenntt..ggoouuvv..ffrr// MMéémmoorraanndduumm ddee PPaarriiss ((MMOOUU )) :: hhttttpp::////wwwwww..ppaarriissmmoouu..oorrgg OO..MM..II :: hhttttpp::////wwwwww..iimmoo..oorrgg OOCCDDEE :: hhttttpp::////wwwwww..ooeeccdd..oorrgg OOMMDD :: hhttttpp::////wwwwww..wwccoooommdd..oorrgg PPaarrlleemmeenntt eeuurrooppééeenn :: hhttttpp::////wwwwww..eeuurrooppaarrll..eeuu..iinntt PPaarrlleemmeenntt ffrraannççaaiiss (( aasssseemmbbllééee nnaattiioonnaallee eett sséénnaatt )) :: hhttttpp::////wwwwww..sseennaatt..ffrr hhttttpp::////wwwwww..aasssseemmbblleeee--nnaatt..ffrr EEEEEEEEnnnnnnnnttttttttrrrrrrrreeeeeeeettttttttiiiiiiiieeeeeeeennnnnnnnssssssss
  • EEnnttrreettiieenn aavveecc MMoonnssiieeuurr GGeeoorrggeess TTOOUURRRREETT ,, aaddmmiinniissttrraatteeuurr ddeess aaffffaaiirreess mmaarriittiimmeess,, ddiirreecctteeuurr dduu BBEEAA mmeerr.. EEnnttrreettiieenn aavveecc MMoonnssiieeuurr PPiieerrrree AALLDDEEBBEERRTT ,, IISSMM mmaannaaggeerr dduu ggrroouuppee CCMMAA//CCGGMM EEnnttrreettiieenn aavveecc MMoonnssiieeuurr FFrrééddéérriicc FFIIEEVVEETT ,, fflleeeett mmaannaaggeerr ddee llaa ssoocciiééttéé FFoouuqquueett SSaaccoopp MMaarriittiimmee.. TTTTTTTTAAAAAAAABBBBBBBBLLLLLLLLEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS AAAAAAAANNNNNNNNNNNNNNNNEEEEEEEEXXXXXXXXEEEEEEEESSSSSSSS AANNNNEEXXEE 11 :: IINNDDEEXX DDEESS RREESSOOLLUUTTIIOONNSS DDEE LL''OOMMII PPRROOVVEENNAANNTT DDUU MMAARRIINNEE SSAAFFEETTYY CCOOMMMMIITTTTEEEE EETT DDUU MMAARRIINNEE EENNVVIIRROONNMMEENNTT PPRROOTTEECCTTIIOONN CCOOMMMMIITTTTEEEE PPAAGGEE 9933 AANNNNEEXXEE 22 :: TTAABBLLEEAAUU RREECCAAPPIITTUULLAAIIFF DDEESS RREEGGLLEEMMEENNTTSS EEUURROOPPEEEENNSS EENN MMAATTIIEERREE DDEE SSEECCUURRIITTEE MMAARRIITTIIMMEE PPAAGGEE 110011 AANNNNEEXXEE 33 :: LLIISSTTEE NNOOIIRREE EETT LLIISSTTEE BBLLAANNCCHHEE DDUU MMEEMMOORREENNDDUUMM DDEE PPAARRIISS .. PPAAGGEE 110033 AANNNNEEXXEE 44 :: LLEESS 1100 PPRREEMMIIEERREESS FFLLOOTTTTEESS MMAARRCCHHAANNDDEESS DD''AAPPRREESS LLEE PPAAVVIILLLLOONN PPAAGGEE 110044 AANNNNEEXXEE 55 :: TTAABBLLEEAAUU DDEESS CCOOUUTTSS EESSTTIIMMEESS DDEE LLAA SSUURREETTEE MMAARRIITTIIMMEE PPOOUURR DDEESS CCOOMMPPAAGGNNIIEESS TTYYPPEESS ,, EEXXTTRRAAIITT DDUU FFEEDDEERRAALL RREEGGIISSTTEERR,, RRÉÉSSUUMMÉÉ JJOOUURRNNAALLIIEERR DDEESS AACCTTIIVVIITTÉÉSS DDUU GGOOUUVVEERRNNEEMMEENNTT DDEESS EETTAATTSS--UUNNIISS.. PPAAGGEE 110055 AAAAAAAANNNNNNNNNNNNNNNNEEEEEEEEXXXXXXXXEEEEEEEE 11111111 MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE SSSSSSSSAAAAAAAAFFFFFFFFEEEEEEEETTTTTTTTYYYYYYYY CCCCCCCCOOOOOOOOMMMMMMMMMMMMMMMMIIIIIIIITTTTTTTTTTTTTTTTEEEEEEEEEEEEEEEE MMSSCC..11((XXLLVV)) 11998811 aammeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..22((XXLLVV)) 11998811 aammeennddmmeennttss ttoo tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa MMSSCC..33((4488)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr SSaaffee CCoonnttaaiinneerrss ((CCSSCC)),, 11997722 MMSSCC..44((4488)) AAddooppttiioonn ooff tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) ((AAmmeennddeedd bbyy MMEEPPCC..1199((2222)),, MMSSCC..1100((5544))))
  • MMSSCC..55((4488)) AAddooppttiioonn ooff tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk ((IIGGCC CCooddee)) MMSSCC..66((4488)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..77((4488)) RReeccoommmmeennddaattiioonnss oonn cchheemmiiccaall ttaannkkeerrss aanndd ggaass ccaarrrriieerrss ccoonnssttrruucctteedd bbeeffoorree 11 JJuullyy 11998866 MMSSCC..88((4488)) RReeccoommmmeennddaattiioonnss ccoonncceerrnniinngg ffiirree ssaaffeettyy rreeqquuiirreemmeennttss aaddddiittiioonnaall ttoo tthhoossee ccoonnttaaiinneedd iinn cchhaapptteerr IIII--22 ooff tthhee 11998811 SSOOLLAASS aammeennddmmeennttss MMSSCC..99((5533)) AAddooppttiioonn ooff tthhee rreevviisseedd CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMSSCC..1100((5544)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((rreessoolluuttiioonn MMSSCC..44((4488)))) MMSSCC..1111((5555)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..1122((5566)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..1133((5577)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..1144((5577)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMSSCC..1155((5577)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMSSCC..1166((5588)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) ((HHaarrmmoonniizzeedd ssyysstteemm ooff ssuurrvveeyy aanndd cceerrttiiffiiccaattiioonn)) MMSSCC..1177((5588)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss
  • CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk ((IIGGCC CCooddee)) ((HHaarrmmoonniizzeedd ssyysstteemm ooff ssuurrvveeyy aanndd cceerrttiiffiiccaattiioonn)) MMSSCC..1188((5588)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) ((HHaarrmmoonniizzeedd ssyysstteemm ooff ssuurrvveeyy aanndd cceerrttiiffiiccaattiioonn)) MMSSCC..1199((5588)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..2200((5599)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr SSaaffee CCoonnttaaiinneerrss ((CCSSCC)),, 11997722 MMSSCC..2211((5599)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn oonn SSttaannddaarrddss ooff TTrraaiinniinngg,, CCeerrttiiffiiccaattiioonn aanndd WWaattcchhkkeeeeppiinngg ffoorr SSeeaaffaarreerrss,, 11997788 MMSSCC..2222((5599)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..2233((5599)) AAddooppttiioonn ooff tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee SSaaffee CCaarrrriiaaggee ooff GGrraaiinn iinn BBuullkk MMSSCC..2244((6600)) AAmmeennddmmeennttss ttoo cchhaapptteerr IIII--22 ooff tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 ((FFiirree ssaaffeettyy mmeeaassuurreess ffoorr eexxiissttiinngg ppaasssseennggeerr sshhiippss)) RReessoolluuttiioonn nnuummbbeerr RReessoolluuttiioonn ttiittllee ((SSttaattuuss)) MMSSCC..2255((6600)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk ((HHaarrmmoonniizzeedd ssyysstteemm ooff ssuurrvveeyy aanndd cceerrttiiffiiccaattiioonn)) MMSSCC..2266((6600)) AAmmeennddmmeennttss ttoo cchhaapptteerr IIII--11 ooff tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 ((EExxiissttiinngg rroo--rroo ppaasssseennggeerr sshhiippss)) MMSSCC..2277((6611)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..2288((6611)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMSSCC..2299((6611)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss
  • CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMSSCC..3300((6611)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk ((IIGGCC CCooddee)) MMSSCC..3311((6633)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..3322((6633)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk ((IIGGCC CCooddee)) MMSSCC..3333((6633)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn oonn SSttaannddaarrddss ooff TTrraaiinniinngg,, CCeerrttiiffiiccaattiioonn aanndd WWaattcchhkkeeeeppiinngg ((SSTTCCWW)),, 11997788 MMSSCC..3344((6633)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk MMSSCC..3355((6633)) GGuuiiddeelliinneess ffoorr eemmeerrggeennccyy ttoowwiinngg aarrrraannggeemmeennttss oonn ttaannkkeerrss MMSSCC..3366((6633)) IInntteerrnnaattiioonnaall CCooddee ooff SSaaffeettyy ffoorr HHiigghh--SSppeeeedd CCrraafftt ((AAmmeennddeedd bbyy MMSSCC..111199((7744)))) MMSSCC..3377((6633)) AAmmeennddmmeennttss ttoo tthhee CCooddee ooff SSaaffeettyy ffoorr DDyynnaammiiccaallllyy SSuuppppoorrtteedd CCrraafftt MMSSCC..3388((6633)) AAmmeennddmmeennttss ttoo tthhee 11998899 CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff MMoobbiillee OOffffsshhoorree DDrriilllliinngg UUnniittss ((MMOODDUU CCooddee)) MMSSCC..3399((6633)) AAmmeennddmmeennttss ttoo tthhee CCooddee oonn AAllaarrmmss aanndd IInnddiiccaattoorrss ((RReevvookkeedd bbyy AA..883300((1199)))) MMSSCC..4400((6644)) SSttaannddaarrdd ffoorr qquuaalliiffyyiinngg mmaarriinnee mmaatteerriiaallss ffoorr hhiigghh--ssppeeeedd ccrraafftt aass ffiirree-- rreessttrriiccttiinngg mmaatteerriiaallss MMSSCC..4411((6644)) IInntteerriimm ssttaannddaarrdd ffoorr mmeeaassuurriinngg ssmmookkee aanndd ttooxxiicc pprroodduuccttss ooff ccoommbbuussttiioonn MMSSCC..4422((6644)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..4433((6644)) GGuuiiddeelliinneess ffoorr ccrriitteerriiaa ffoorr sshhiipp rreeppoorrttiinngg ssyysstteemmss ((AAmmeennddeedd bbyy MMSSCC..111111((7733)))) MMSSCC..4444((6655)) SSttaannddaarrddss ffoorr ffiixxeedd sspprriinnkklleerr ssyysstteemmss ffoorr hhiigghh--ssppeeeedd ccrraafftt MMSSCC..4455((6655)) TTeesstt pprroocceedduurreess ffoorr ffiirree rreessiissttiinngg ddiivviissiioonnss ooff hhiigghh--ssppeeeedd ccrraafftt
  • MMSSCC..4466((6655)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..4477((6666)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..4488((6666)) IInntteerrnnaattiioonnaall LLiiffee--SSaavviinngg AApppplliiaannccee ((LLSSAA)) CCooddee MMSSCC..4499((6666)) AAmmeennddmmeennttss ttoo tthhee GGuuiiddeelliinneess oonn tthhee eennhhaanncceedd pprrooggrraammmmee ooff iinnssppeeccttiioonnss dduurriinngg ssuurrvveeyyss ooff bbuullkk ccaarrrriieerrss aanndd ooiill ttaannkkeerrss ((rreessoolluuttiioonn AA..774444((1188)))) MMSSCC..5500((6666)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)))) MMSSCC..5511((6666)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)))) MMSSCC..5522((6666)) MMaannddaattoorryy sshhiipp rreeppoorrttiinngg ssyysstteemmss MMSSCC..5533((6666)) PPeerrffoorrmmaannccee ssttaannddaarrddss ffoorr sshhiippbboorrnnee GGLLOONNAASSSS rreecceeiivveerr eeqquuiippmmeenntt)) ((RReevviisseedd bbyy MMSSCC..111133((7733)))) MMSSCC..5544((6666)) AAmmeennddmmeennttss ttoo tthhee RReeccoommmmeennddaattiioonn oonn tteessttiinngg ooff lliiffee--ssaavviinngg aapppplliiaanncceess ((rreessoolluuttiioonn AA..668899((1177)))) MMSSCC..5555((6666)) AAmmeennddmmeennttss ttoo tthhee RReeccoommmmeennddaattiioonn oonn ccoonnddiittiioonnss ffoorr tthhee aapppprroovvaall ooff sseerrvviicciinngg ssttaattiioonnss ffoorr iinnffllaattaabbllee lliiffeerraaffttss ((rreessoolluuttiioonn AA..776611((1188)))) MMSSCC..5566((6666)) AAmmeennddmmeennttss ttoo tthhee PPeerrffoorrmmaannccee ssttaannddaarrddss ffoorr ffllooaatt--ffrreeee ssaatteelllliittee EEPPIIRRBBss ooppeerraattiinngg oonn 440066 MMHHzz ((rreessoolluuttiioonn AA..881100((1188)))) MMSSCC..5577((6677)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..5588((6677)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMSSCC..5599((6677)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss
  • CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk ((IIGGCC CCooddee)) MMSSCC..6600((6677)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk ((GGCC CCooddee)) MMSSCC..6611((6677)) IInntteerrnnaattiioonnaall CCooddee ffoorr AApppplliiccaattiioonn ooff FFiirree TTeesstt PPrroocceedduurreess MMSSCC..6622((6677)) GGuuiiddeelliinneess ffoorr ssaaffee aacccceessss ttoo ttaannkkeerr bboowwss MMSSCC..6633((6677)) MMaannddaattoorryy sshhiipp rreeppoorrttiinngg ssyysstteemmss MMSSCC..6644((6677)) RReeccoommmmeennddaattiioonnss oonn nneeww aanndd aammeennddeedd ppeerrffoorrmmaannccee ssttaannddaarrddss)) ((AAnnnneexx 22 rreevviisseedd bbyy MMSSCC..111144((7733)))) MMSSCC..6655((6688)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744,, aass aammeennddeedd MMSSCC..6666((6688)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn oonn SSttaannddaarrddss ooff TTrraaiinniinngg,, CCeerrttiiffiiccaattiioonn aanndd WWaattcchhkkeeeeppiinngg ffoorr SSeeaaffaarreerrss,, 11997788,, aass aammeennddeedd MMSSCC..6677((6688)) AAmmeennddmmeennttss ttoo tthhee SSeeaaffaarreerr''ss TTrraaiinniinngg,, CCeerrttiiffiiccaattiioonn aanndd WWaattcchhkkeeeeppiinngg ((SSTTCCWW)) CCooddee MMSSCC..6688((6688)) AAmmeennddmmeennttss ttoo ppeerrffoorrmmaannccee ssttaannddaarrddss ffoorr sshhiippbboorrnnee rraaddiiooccoommmmuunniiccaattiioonnss eeqquuiippmmeenntt MMSSCC..6699((6699)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744,, aass aammeennddeedd MMSSCC..7700((6699)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn oonn MMaarriittiimmee SSeeaarrcchh aanndd RReessccuuee,, 11997799 MMSSCC..7711((6699)) AAmmeennddmmeennttss ttoo tthhee GGeenneerraall PPrroovviissiioonnss oonn SShhiippss'' RRoouutteeiinngg ((rreessoolluuttiioonn AA..557722((1144)),, aass aammeennddeedd)) MMSSCC..7722((6699)) AAddooppttiioonn,, ddeessiiggnnaattiioonn aanndd ssuubbssttiittuuttiioonn ooff aarrcchhiippeellaaggiicc sseeaa llaanneess MMSSCC..7733((6699)) MMaannddaattoorryy sshhiipp rreeppoorrttiinngg ssyysstteemmss MMSSCC..7744((6699)) NNeeww aanndd aammeennddeedd ppeerrffoorrmmaannccee ssttaannddaarrddss ((AAnnnneexx 11 rreevviisseedd bbyy MMSSCC..111155((7733))))
  • MMSSCC..7755((6699)) AAmmeennddmmeennttss ttoo tthhee CCooddee oonn IInnttaacctt SSttaabbiilliittyy ffoorr AAllll TTyyppeess ooff SShhiippss CCoovveerreedd bbyy IIMMOO IInnssttrruummeennttss ((rreessoolluuttiioonn AA..774499((1188)))) MMSSCC..7766((6699)) EExxtteennddeedd aapppplliiccaattiioonn ooff tthhee EExxppllaannaattoorryy nnootteess ttoo tthhee SSOOLLAASS rreegguullaattiioonnss oonn ssuubbddiivviissiioonn aanndd ddaammaaggee ssttaabbiilliittyy ooff ccaarrggoo sshhiippss ooff 110000 mmeettrreess iinn lleennggtthh aanndd oovveerr ((rreessoolluuttiioonn AA..668844((1177)))) MMSSCC..7777((6699)) MMaaiinntteennaannccee ooff aa ccoonnttiinnuuoouuss lliisstteenniinngg wwaattcchh oonn VVHHFF cchhaannnneell 1166 bbyy SSOOLLAASS sshhiippss wwhhiillsstt aatt sseeaa aafftteerr 11 FFeebbrruuaarryy 11999999 aanndd iinnssttaallllaattiioonn ooff VVHHFF DDSSCC ffaacciilliittiieess oonn nnoonn--SSOOLLAASS sshhiippss MMSSCC..7788((7700)) AAmmeennddmmeennttss ttoo tthhee SSeeaaffaarreerrss'' TTrraaiinniinngg,, CCeerrttiiffiiccaattiioonn aanndd WWaattcchhkkeeeeppiinngg ((SSTTCCWW)) CCooddee MMSSCC..7799((7700)) IInntteerrpprreettaattiioonn ooff SSOOLLAASS cchhaapptteerr XXIIII oonn aaddddiittiioonnaall ssaaffeettyy mmeeaassuurreess ffoorr bbuullkk ccaarrrriieerrss MMSSCC..8800((7700)) NNeeww ppeerrffoorrmmaannccee ssttaannddaarrddss ffoorr rraaddiiooccoommmmuunniiccaattiioonn eeqquuiippmmeenntt MMSSCC..8811((7700)) RReevviisseedd rreeccoommmmeennddaattiioonn oonn tteessttiinngg ooff lliiffee--ssaavviinngg aapppplliiaanncceess MMSSCC..8822((7700)) AAmmeennddmmeennttss ttoo rreessoolluuttiioonn AA..776600((1188)) oonn ssyymmbboollss rreellaatteedd ttoo lliiffee--ssaavviinngg aapppplliiaanncceess aanndd aarrrraannggeemmeennttss MMSSCC..8833((7700)) AAmmeennddmmeennttss ttoo tthhee ssuurrvveeyy gguuiiddeelliinneess uunnddeerr tthhee hhaarrmmoonniizzeedd ssyysstteemm ooff ssuurrvveeyy aanndd cceerrttiiffiiccaattiioonn ((rreessoolluuttiioonn AA..774466((1188)))) MMSSCC..8844((7700)) AAmmeennddmmeennttss ttoo tthhee gguuiiddeelliinneess oonn ssuurrvveeyyss rreeqquuiirreedd bbyy tthhee 11997788 SSOOLLAASS PPrroottooccooll,, tthhee IInntteerrnnaattiioonnaall BBuullkk CChheemmiiccaall CCooddee aanndd tthhee IInntteerrnnaattiioonnaall GGaass CCaarrrriieerr CCooddee ((rreessoolluuttiioonn AA..556600((1144)))) MMSSCC..8855((7700)) MMaannddaattoorryy sshhiipp rreeppoorrttiinngg ssyysstteemmss MMSSCC..8866((7700)) NNeeww aanndd aammeennddeedd ppeerrffoorrmmaannccee ssttaannddaarrddss ffoorr nnaavviiggaattiioonnaall eeqquuiippmmeenntt MMSSCC..8877((7711)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744,, aass aammeennddeedd MMSSCC..8888((7711)) IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee SSaaffee CCaarrrriiaaggee ooff PPaacckkaaggeedd IIrrrraaddiiaatteedd NNuucclleeaarr FFuueell,, PPlluuttoonniiuumm aanndd HHiigghh--LLeevveell RRaaddiiooaaccttiivvee WWaasstteess oonn BBooaarrdd SShhiippss ((IINNFF CCooddee))
  • MMSSCC..8899((7711)) IInntteerrpprreettaattiioonn ooff tthhee pprroovviissiioonnss ooff SSOOLLAASS cchhaapptteerr XXIIII oonn aaddddiittiioonnaall ssaaffeettyy mmeeaassuurreess ffoorr bbuullkk ccaarrrriieerrss MMSSCC..9900((7711)) AAmmeennddmmeennttss ttoo tthhee ssttaannddaarrdd ffoorr qquuaalliiffyyiinngg mmaarriinnee mmaatteerriiaallss ffoorr hhiigghh--ssppeeeedd ccrraafftt aass ffiirreerreessttrriiccttiinngg mmaatteerriiaallss ((rreessoolluuttiioonn MMSSCC..4400((6644)))) MMSSCC..9911((7722)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744,, aass aammeennddeedd MMSSCC..9922((7722)) AAmmeennddmmeennttss ttoo tthhee PPrroottooccooll ooff 11998888 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..9933((7722)) MMaannddaattoorryy sshhiipp rreeppoorrttiinngg ssyysstteemm MMSSCC..9944((7722)) PPeerrffoorrmmaannccee ssttaannddaarrddss ffoorr nniigghhtt vviissiioonn eeqquuiippmmeenntt ffoorr hhiigghh--ssppeeeedd ccrraafftt MMSSCC..9955((7722)) PPeerrffoorrmmaannccee ssttaannddaarrddss ffoorr ddaayylliigghhtt ssiiggnnaalllliinngg llaammppss MMSSCC..9966((7722)) AAmmeennddmmeennttss ttoo ppeerrffoorrmmaannccee ssttaannddaarrddss ffoorr ddeevviicceess ttoo iinnddiiccaattee ssppeeeedd aanndd ddiissttaannccee ((rreessoolluuttiioonn AA..882244((1199)))) MMSSCC..9977((7733)) IInntteerrnnaattiioonnaall CCooddee ooff SSaaffeettyy ffoorr HHiigghh--SSppeeeedd CCrraafftt,, 22000000 ((22000000 HHSSCC CCooddee)) MMSSCC..9988((7733)) IInntteerrnnaattiioonnaall CCooddee ffoorr FFiirree SSaaffeettyy SSyysstteemmss ((FFSSSS CCooddee)) MMSSCC..9999((7733)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744,, aass aammeennddeedd MMSSCC..110000((7733)) AAmmeennddmmeennttss ttoo tthhee PPrroottooccooll ooff 11998888 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..110011((7733)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr AApppplliiccaattiioonn ooff FFiirree TTeesstt PPrroocceedduurreess ((FFTTPP CCooddee)) MMSSCC..110022((7733)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMSSCC..110033((7733)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss
  • CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk ((IIGGCC CCooddee)) MMSSCC..110044((7733)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall SSaaffeettyy MMaannaaggeemmeenntt ((IISSMM)) CCooddee MMSSCC..110055((7733)) AAmmeennddmmeennttss ttoo tthhee GGuuiiddeelliinneess oonn tthhee eennhhaanncceedd pprrooggrraammmmee ooff iinnssppeeccttiioonnss dduurriinngg ssuurrvveeyyss ooff bbuullkk ccaarrrriieerrss aanndd ooiill ttaannkkeerrss ((rreessoolluuttiioonn AA..774444((1188)),, aass aammeennddeedd)) MMSSCC..110066((7733)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg LLiiqquueeffiieedd GGaasseess iinn BBuullkk ((GGCC CCooddee)) MMSSCC..110077((7733)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMSSCC..110088((7733)) RReeccoommmmeennddaattiioonn oonn ccoommpplliiaannccee wwiitthh tthhee rreeqquuiirreemmeennttss ooff ppaarraaggrraapphh 22..22..11..11 ooff aannnneexx 1122 ttoo aannnneexx BB ttoo rreessoolluuttiioonn AA..774444((1188)) MMSSCC..110099((7733)) CCaarrrriiaaggee ooff vvooyyaaggee ddaattaa rreeccoorrddeerrss ((VVDDRRss)) oonn eexxiissttiinngg ccaarrggoo sshhiippss MMSSCC..111100((7733)) MMaannddaattoorryy sshhiipp rreeppoorrttiinngg ssyysstteemm MMSSCC..111111((7733)) AAmmeennddmmeennttss ttoo gguuiiddeelliinneess aanndd ccrriitteerriiaa ffoorr sshhiipp rreeppoorrttiinngg ssyysstteemmss ((rreessoolluuttiioonn MMSSCC..4433((6644)))) MMSSCC..111122((7733)) RReevviisseedd ppeerrffoorrmmaannccee ssttaannddaarrddss ffoorr sshhiippbboorrnnee gglloobbaall ppoossiittiioonniinngg ((GGPPSS)) rreecceeiivveerr eeqquuiippmmeenntt MMSSCC..111133((7733)) RReevviisseedd ppeerrffoorrmmaannccee ssttaannddaarrddss ffoorr sshhiippbboorrnnee GGLLOONNAASSSS rreecceeiivveerr eeqquuiippmmeenntt MMSSCC..111144((7733)) RReevviisseedd ppeerrffoorrmmaannccee ssttaannddaarrddss ffoorr sshhiippbboorrnnee DDGGPPSS aanndd DDGGLLOONNAASSSS mmaarriittiimmee rraaddiioo bbeeaaccoonn rreecceeiivveerr eeqquuiippmmeenntt MMSSCC..111155((7733)) RReevviisseedd ppeerrffoorrmmaannccee ssttaannddaarrddss ffoorr sshhiippbboorrnnee ccoommbbiinneedd GGPPSS//GGLLOONNAASSSS rreecceeiivveerr eeqquuiippmmeenntt MMSSCC..111166((7733)) PPeerrffoorrmmaannccee ssttaannddaarrddss ffoorr mmaarriinnee ttrraannssmmiittttiinngg hheeaaddiinngg ddeevviicceess ((TTHHDDss)) MMSSCC..111177((7744)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744,, aass aammeennddeedd
  • MMSSCC..111188((7744)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee SSaaffee CCaarrrriiaaggee ooff PPaacckkaaggeedd IIrrrraaddiiaatteedd NNuucclleeaarr FFuueell,, PPlluuttoonniiuumm aanndd HHiigghh--LLeevveell RRaaddiiooaaccttiivvee WWaasstteess oonn BBooaarrdd SShhiippss ((IINNFF CCooddee)) MMSSCC..111199((7744)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ooff SSaaffeettyy ffoorr HHiigghh--SSppeeeedd CCrraafftt ((11999944 HHSSCC CCooddee)) MMSSCC..112200((7744)) AAmmeennddmmeennttss ttoo tthhee ppeerrffoorrmmaannccee ssttaannddaarrddss ffoorr ffllooaatt--ffrreeee ssaatteelllliittee eemmeerrggeennccyy ppoossiittiioonniinnddiiccaattiinngg rraaddiioo bbeeaaccoonnss ((EEPPIIRRBBss)) ooppeerraattiinngg oonn 440066 MMHHzz ((rreessoolluuttiioonn AA..881100((1199)))) MMSSCC..112211((7744)) UUssee ooff tthhee SSppaanniisshh llaanngguuaaggee iinn IIMMOO iinnssttrruummeennttss rreellaattiinngg ttoo mmaarriittiimmee ssaaffeettyy MMSSCC..112222((7755)) AAddooppttiioonn ooff tthhee IInntteerrnnaattiioonnaall MMaarriittiimmee DDaannggeerroouuss GGooooddss ((IIMMDDGG)) CCooddee MMSSCC..112233((7755)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744,, aass aammeennddeedd MMSSCC..112244((7755)) AAmmeennddmmeennttss ttoo tthhee PPrroottooccooll ooff 11998888 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee SSaaffeettyy ooff LLiiffee aatt SSeeaa,, 11997744 MMSSCC..112255((7755)) AAmmeennddmmeennttss ttoo tthhee GGuuiiddeelliinneess oonn tthhee eennhhaannccee pprrooggrraammmmee ooff iinnssppeeccttiioonnss dduurriinngg ssuurrvveeyyss ooff bbuullkk ccaarrrriieerrss aanndd ooiill ttaannkkeerrss ((rreessoolluuttiioonn AA..774444((1188)) aass aammeennddeedd)) ((AAmmeennddss AA..774444((1188)))) MMSSCC..112266((7755)) MMaannddaattoorryy sshhiipp rreeppoorrttiinngg ssyysstteemmss MMSSCC..112277((7755)) AAmmeennddmmeennttss ttoo tthhee eexxiissttiinngg mmaannddaattoorryy sshhiipp rreeppoorrttiinngg ssyysstteemmss MMSSCC..112288((7755)) PPeerrffoorrmmaannccee ssttaannddaarrddss ffoorr aa bbrriiddggee nnaavviiggaattiioonnaall wwaattcchh aallaarrmm ssyysstteemm ((BBNNWWAASS)) MMSSCC..112299((7755)) MMaarriittiimmee ssaaffeettyy aanndd ssaaffeettyy--rreellaatteedd rraaddiiooccoommmmuunniiccaattiioonnss MMSSCC..113300((7755)) PPeerrffoorrmmaannccee ssttaannddaarrddss ffoorr IInnmmaarrssaatt sshhiipp eeaarrtthh ssttaattiioonnss ccaappaabbllee ooff ttwwoo-- wwaayy ccoommmmuunniiccaattiioonnss MMSSCC..113311((7755)) MMaaiinntteennaannccee ooff aa ccoonnttiinnuuoouuss lliisstteenniinngg wwaattcchh oonn VVHHFF cchhaannnneell bbyy SSOOLLAASS sshhiippss wwhhiillsstt aatt sseeaa aanndd iinnssttaallllaattiioonn ooff VVHHFF DDSSCC ffaacciilliittiieess oonn nnoonn--SSOOLLAASS sshhiippss ((RReevvookkeess MMSSCC..7777((6699)))) MMSSCC..113322((7755)) AAmmeennddmmeennttss ttoo tthhee gguuiiddeelliinneess ffoorr eemmeerrggeennccyy ttoowwiinngg aarrrraannggeemmeennttss oonn ttaannkkeerrss ((rreessoolluuttiioonn
  • MMSSCC..3355((6633)))) ((AAmmeennddss MMSSCC..3355((6633)))) MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIINNNNNNNNEEEEEEEE EEEEEEEENNNNNNNNVVVVVVVVIIIIIIIIRRRRRRRROOOOOOOONNNNNNNNMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT PPPPPPPPRRRRRRRROOOOOOOOTTTTTTTTEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN CCCCCCCCOOOOOOOOMMMMMMMMMMMMMMMMIIIIIIIITTTTTTTTTTTTTTTTEEEEEEEEEEEEEEEE MMEEPPCC..11((IIII)) EEssttaabblliisshhmmeenntt ooff tthhee lliisstt ooff ssuubbssttaanncceess ttoo bbee aannnneexxeedd ttoo tthhee PPrroottooccooll rreellaattiinngg ttoo IInntteerrvveennttiioonn oonn tthhee HHiigghh SSeeaass iinn CCaasseess ooff MMaarriinnee PPoolllluuttiioonn bbyy SSuubbssttaanncceess OOtthheerr TThhaann OOiill MMEEPPCC..22((VVII)) RReeccoommmmeennddaattiioonn oonn iinntteerrnnaattiioonnaall eefffflluueenntt ssttaannddaarrddss aanndd gguuiiddeelliinneess ffoorr ppeerrffoorrmmaannccee tteessttss ffoorr sseewwaaggee ttrreeaattmmeenntt ppllaannttss MMEEPPCC..33((XXIIII)) RReeccoommmmeennddaattiioonn oonn tthhee ssttaannddaarrdd ffoorrmmaatt ooff tthhee ccrruuddee ooiill wwaasshhiinngg ooppeerraattiioonnss aanndd eeqquuiippmmeenntt mmaannuuaall MMEEPPCC..44((XXIIIIII)) RReeccoommmmeennddaattiioonn rreeggaarrddiinngg aacccceeppttaannccee ooff ooiill ccoonntteenntt mmeetteerrss iinn ooiill ttaannkkeerrss MMEEPPCC..55((XXIIIIII)) SSppeecciiffiiccaattiioonn ffoorr ooiill//wwaatteerr iinntteerrffaaccee ddeetteeccttoorrss MMEEPPCC..66((XXIIVV)) AApppplliiccaattiioonn ooff tthhee pprroovviissiioonnss ooff AAnnnneexx II ooff tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733,, aass mmooddiiffiieedd bbyy tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg tthheerreettoo,, oonn tthhee ddiisscchhaarrggee ooff ooiill iinn tthhee BBaallttiicc SSeeaa aarreeaa MMEEPPCC..77((XXVV)) EEnnttrriieess iinn ooiill rreeccoorrdd bbooookkss oonn mmeetthhooddss ooff ddiissppoossaall ooff rreessiidduuee MMEEPPCC..88((XXVVII)) DDiisscchhaarrggee ooff ooiillss nnoott ssppeecciiffiieedd bbyy tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ooff tthhee SSeeaa bbyy OOiill,, 11995544,, aass aammeennddeedd iinn 11996622 aanndd 11996699 MMEEPPCC..99((1177)) AApppplliiccaattiioonn ooff tthhee pprroovviissiioonnss ooff AAnnnneexx VV ooff MMAARRPPOOLL 7733//7788 oonn tthhee ddiisscchhaarrggee ooff ggaarrbbaaggee iinn tthhee BBaallttiicc SSeeaa aarreeaa MMEEPPCC..1100((1188)) AApppplliiccaattiioonn sscchheemmee ffoorr ooiill ddiisscchhaarrggee mmoonniittoorriinngg aanndd ccoonnttrrooll ssyysstteemmss MMEEPPCC..1111((1188)) GGuuiiddeelliinneess ffoorr ssuurrvveeyyss uunnddeerr AAnnnneexx II ooff tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733,, aass mmooddiiffiieedd bbyy tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg tthheerreettoo MMEEPPCC..1122((1188)) RReeggiioonnaall aarrrraannggeemmeennttss ffoorr ccoommbbaattiinngg mmaajjoorr iinncciiddeennttss ooff mmaarriinnee ppoolllluuttiioonn MMEEPPCC..1133((1199)) GGuuiiddeelliinneess ffoorr ppllaann aapppprroovvaall aanndd iinnssttaallllaattiioonn ssuurrvveeyy ooff ooiill ddiisscchhaarrggee mmoonniittoorriinngg aanndd ccoonnttrrooll ssyysstteemmss ffoorr ooiill ttaannkkeerrss aanndd eennvviirroonnmmeennttaall tteessttiinngg ooff ccoonnttrrooll sseeccttiioonnss tthheerreeooff
  • MMEEPPCC..1144((2200)) AAmmeennddmmeennttss ttoo AAnnnneexx II ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..1155((2211)) IInnssttaallllaattiioonn ooff ooiill ddiisscchhaarrggee mmoonniittoorriinngg aanndd ccoonnttrrooll ssyysstteemmss iinn eexxiissttiinngg ooiill ttaannkkeerrss MMEEPPCC..1166((2222)) AAmmeennddmmeennttss ttoo AAnnnneexx IIII ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..1177((2222)) IImmpplleemmeennttaattiioonn ooff AAnnnneexx IIII ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..1188((2222)) SSttaannddaarrddss ffoorr pprroocceedduurreess aanndd aarrrraannggeemmeennttss ffoorr tthhee ddiisscchhaarrggee ooff nnooxxiioouuss lliiqquuiidd ssuubbssttaanncceess ((AAmmeennddeedd bbyy MMEEPPCC..6622((3355)))) MMEEPPCC..1199((2222)) IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMEEPPCC..2200((2222)) CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMEEPPCC..2211((2222)) AAmmeennddmmeennttss ttoo PPrroottooccooll II ttoo MMAARRPPOOLL 7733//7788 aanndd tthhee tteexxtt ooff tthhee PPrroottooccooll,, aass aammeennddeedd,, aannnneexxeedd tthheerreettoo MMEEPPCC..2222((2222)) GGuuiiddeelliinneess ffoorr rreeppoorrttiinngg iinncciiddeennttss iinnvvoollvviinngg hhaarrmmffuull ssuubbssttaanncceess aanndd tthhee tteexxtt ooff gguuiiddeelliinneess aannnneexxeedd tthheerreettoo MMEEPPCC..2233((2222)) TThhee aapppplliiccaattiioonn ooff AAnnnneexx IIII ooff MMAARRPPOOLL 7733//7788 oonn tthhee ddiisscchhaarrggee ooff nnooxxiioouuss lliiqquuiidd ssuubbssttaanncceess iinn tthhee BBaallttiicc SSeeaa aarreeaa MMEEPPCC..2244((2222)) AAmmeennddmmeennttss ttoo tthhee rreevviisseedd gguuiiddeelliinneess aanndd ssppeecciiffiiccaattiioonnss ffoorr ooiill ddiisscchhaarrggee mmoonniittoorriinngg aanndd ccoonnttrrooll ssyysstteemmss ffoorr ooiill ttaannkkeerrss aass aaddoopptteedd bbyy tthhee OOrrggaanniizzaattiioonn bbyy rreessoolluuttiioonn AA..558866((1144)) aanndd ttoo tthhee rreeccoommmmeennddaattiioonnss oonn iinntteerrnnaattiioonnaall ppeerrffoorrmmaannccee ssppeecciiffiiccaattiioonnss ffoorr ooiillyy--wwaatteerr sseeppaarraattiinngg eeqquuiippmmeenntt aanndd ooiill ccoonntteenntt mmeetteerrss aaddoopptteedd bbyy tthhee OOrrggaanniizzaattiioonn bbyy rreessoolluuttiioonn AA..339933((XX)) MMEEPPCC..2255((2233)) GGuuiiddeelliinneess ffoorr ssuurrvveeyyss uunnddeerr AAnnnneexx IIII ooff tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff
  • PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733,, aass mmooddiiffiieedd bbyy tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg tthheerreettoo ((MMAARRPPOOLL 7733//7788)) MMEEPPCC..2266((2233)) PPrroocceedduurreess ffoorr tthhee ccoonnttrrooll ooff sshhiippss aanndd ddiisscchhaarrggeess uunnddeerr AAnnnneexx IIII ooff tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733,, aass mmooddiiffiieedd bbyy tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg tthheerreettoo ((MMAARRPPOOLL 7733//7788)) ((RReevvookkeedd bbyy AA..778877((1199)))) MMEEPPCC..2277((2233)) CCaatteeggoorriizzaattiioonn ooff lliiqquuiidd ssuubbssttaanncceess MMEEPPCC..2288((2244)) CCoommpplliiaannccee wwiitthh AAnnnneexx IIII ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..2299((2255)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((DDeessiiggnnaattiioonn ooff tthhee GGuullff ooff AAddeenn aass aa ssppeecciiaall aarreeaa)) MMEEPPCC..3300((2255)) GGuuiiddeelliinneess ffoorr rreeppoorrttiinngg iinncciiddeennttss iinnvvoollvviinngg hhaarrmmffuull ssuubbssttaanncceess MMEEPPCC..3311((2266)) EEssttaabblliisshhmmeenntt ooff tthhee ddaattee ooff aapppplliiccaattiioonn ooff tthhee pprroovviissiioonnss ooff rreegguullaattiioonn 55 ooff AAnnnneexx VV ooff tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733,, aass mmooddiiffiieedd bbyy tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg tthheerreettoo,, oonn tthhee ddiisscchhaarrggee ooff ggaarrbbaaggee iinn tthhee BBaallttiicc SSeeaa MMEEPPCC..3322((2277)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMEEPPCC..3333((2277)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMEEPPCC..3344((2277)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((AAppppeennddiicceess IIII aanndd IIIIII ooff AAnnnneexx IIII ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..3355((2277)) IImmpplleemmeennttaattiioonn ooff AAnnnneexx IIIIII ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..3366((2288)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn
  • ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((AAmmeennddmmeennttss ttoo AAnnnneexx VV ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..3377((2288)) EEssttaabblliisshhmmeenntt ooff tthhee ddaattee ooff aapppplliiccaattiioonn ooff tthhee pprroovviissiioonnss ooff rreegguullaattiioonn 55 ooff AAnnnneexx VV ooff tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733,, aass mmooddiiffiieedd bbyy tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg tthheerreettoo,, oonn tthhee ddiisscchhaarrggee ooff ggaarrbbaaggee iinn tthhee BBaallttiicc SSeeaa MMEEPPCC..3388((2299)) AApppplliiccaattiioonn ooff tthhee pprroovviissiioonnss ooff AAnnnneexx IIVV ooff tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733,, aass mmooddiiffiieedd bbyy tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg tthheerreettoo,, oonn tthhee ddiisscchhaarrggee ooff sseewwaaggee iinn tthhee BBaallttiicc SSeeaa aarreeaa MMEEPPCC..3399((2299)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((IInnttrroodduuccttiioonn ooff tthhee hhaarrmmoonniizzeedd ssyysstteemm ooff ssuurrvveeyy aanndd cceerrttiiffiiccaattiioonn uunnddeerr AAnnnneexxeess II aanndd VV ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..4400((2299)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) ((HHaarrmmoonniizzeedd ssyysstteemm ooff ssuurrvveeyy aanndd cceerrttiiffiiccaattiioonn)) MMEEPPCC..4411((2299)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) ((HHaarrmmoonniizzeedd ssyysstteemm ooff ssuurrvveeyy aanndd cceerrttiiffiiccaattiioonn)) MMEEPPCC..4422((3300)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((DDeessiiggnnaattiioonn ooff AAnnttaarrccttiicc aarreeaa aass aa ssppeecciiaall aarreeaa uunnddeerr AAnnnneexx VV ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..4433((3300)) PPrreevveennttiioonn ooff ppoolllluuttiioonn bbyy ggaarrbbaaggee iinn tthhee MMeeddiitteerrrraanneeaann MMEEPPCC..4444((3300)) IIddeennttiiffiiccaattiioonn ooff tthhee GGrreeaatt BBaarrrriieerr RReeeeff rreeggiioonn aass aa ppaarrttiiccuullaarrllyy sseennssiittiivvee aarreeaa MMEEPPCC..4455((3300)) PPrrootteeccttiioonn ooff tthhee GGrreeaatt BBaarrrriieerr RReeeeff rreeggiioonn
  • MMEEPPCC..4466((3300)) MMeeaassuurreess ttoo ccoonnttrrooll ppootteennttiiaall aaddvveerrssee iimmppaaccttss aassssoocciiaatteedd wwiitthh uussee ooff ttrriibbuuttyyll ttiinn ccoommppoouunnddss iinn aannttiiffoouulliinngg ppaaiinnttss MMEEPPCC..4477((3311)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((NNeeww rreegguullaattiioonn 2266 aanndd ootthheerr aammeennddmmeennttss ttoo AAnnnneexx II ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..4488((3311)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((DDeessiiggnnaattiioonn ooff tthhee WWiiddeerr CCaarriibbbbeeaann aarreeaa aass aa ssppeecciiaall aarreeaa uunnddeerr AAnnnneexx VV ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..4499((3311)) RReevviissiioonn ooff tthhee lliisstt ooff ssuubbssttaanncceess ttoo bbee aannnneexxeedd ttoo tthhee PPrroottooccooll rreellaattiinngg ttoo tthhee IInntteerrvveennttiioonn oonn tthhee HHiigghh SSeeaass iinn CCaasseess ooff MMaarriinnee PPoolllluuttiioonn bbyy SSuubbssttaanncceess OOtthheerr TThhaann OOiill MMEEPPCC..5500((3311)) IInntteerrnnaattiioonnaall gguuiiddeelliinneess ffoorr pprreevveennttiinngg tthhee iinnttrroodduuccttiioonn ooff uunnwwaanntteedd aaqquuaattiicc oorrggaanniissmmss aanndd ppaatthhooggeennss ffrroomm sshhiippss'' bbaallllaasstt wwaatteerr aanndd sseeddiimmeenntt ddiisscchhaarrggeess MMEEPPCC..5511((3322)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((DDiisscchhaarrggee ccrriitteerriiaa ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..5522((3322)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((NNeeww rreegguullaattiioonnss 1133FF aanndd 1133GG aanndd rreellaatteedd aammeennddmmeennttss ttoo AAnnnneexx II ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..5533((3322)) DDeevveellooppmmeenntt ooff tthhee ccaappaacciittyy ooff sshhiipp ssccrraappppiinngg ffoorr tthhee ssmmooootthh iimmpplleemmeennttaattiioonn ooff tthhee aammeennddmmeennttss ttoo AAnnnneexx II ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..5544((3322)) GGuuiiddeelliinneess ffoorr tthhee ddeevveellooppmmeenntt ooff sshhiippbbooaarrdd ooiill ppoolllluuttiioonn eemmeerrggeennccyy ppllaannss
  • MMEEPPCC..5555((3333)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMEEPPCC..5566((3333)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMEEPPCC..5577((3333)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((DDeessiiggnnaattiioonn ooff tthhee AAnnttaarrccttiicc aarreeaa aass aa ssppeecciiaall aarreeaa aanndd lliissttss ooff lliiqquuiidd ssuubbssttaanncceess iinn AAnnnneexx IIII)) MMEEPPCC..5588((3333)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((RReevviisseedd AAnnnneexx IIIIII)) MMEEPPCC..5599((3333)) RReevviisseedd gguuiiddeelliinneess ffoorr tthhee iimmpplleemmeennttaattiioonn ooff AAnnnneexx VV ooff MMAARRPPOOLL 7733//7788 ((SSuuppeerrsseeddeedd bbyy MMEEPPCC..7766((4400)))) MMEEPPCC..6600((3333)) GGuuiiddeelliinneess aanndd ssppeecciiffiiccaattiioonnss ffoorr ppoolllluuttiioonn pprreevveennttiioonn eeqquuiippmmeenntt ffoorr mmaacchhiinneerryy ssppaaccee bbiillggeess ooff sshhiippss MMEEPPCC..6611((3344)) VViissiibbiilliittyy lliimmiittss ooff ooiill ddiisscchhaarrggeess ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..6622((3355)) AAmmeennddmmeennttss ttoo tthhee ssttaannddaarrddss ffoorr pprroocceedduurreess aanndd aarrrraannggeemmeennttss ffoorr tthhee ddiisscchhaarrggee ooff nnooxxiioouuss lliiqquuiidd ssuubbssttaanncceess MMEEPPCC..6633((3366)) OOiill ttaannkkeerr ssttaabbiilliittyy,, ooppeerraattiioonnaall ssaaffeettyy aanndd pprrootteeccttiioonn ooff tthhee mmaarriinnee eennvviirroonnmmeenntt MMEEPPCC..6644((3366)) GGuuiiddeelliinneess ffoorr aapppprroovvaall ooff aalltteerrnnaattiivvee ssttrruuccttuurraall oorr ooppeerraattiioonnaall aarrrraannggeemmeennttss aass ccaalllleedd ffoorr iinn rreegguullaattiioonn 1133GG((77)) ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..6655((3377)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((AAmmeennddmmeennttss ttoo rreegguullaattiioonn 22 aanndd nneeww rreegguullaattiioonn 99 ooff AAnnnneexx VV))
  • MMEEPPCC..6666((3377)) IInntteerriimm gguuiiddeelliinneess ffoorr tthhee aapppprroovvaall ooff aalltteerrnnaattiivvee mmeetthhooddss ooff ddeessiiggnn aanndd ccoonnssttrruuccttiioonn ooff ooiill ttaannkkeerrss uunnddeerr rreegguullaattiioonn 1133FF((55)) ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..6677((3377)) GGuuiiddeelliinneess oonn aapppplliiccaattiioonn ooff tthhee pprreeccaauuttiioonnaarryy aapppprrooaacchh iinn tthhee ccoonntteexxtt ooff ssppeecciiffiicc IIMMOO aaccttiivviittiieess MMEEPPCC..6688((3388)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((AAmmeennddmmeennttss ttoo PPrroottooccooll II)) MMEEPPCC..6699((3388)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMEEPPCC..7700((3388)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMEEPPCC..7711((3388)) GGuuiiddeelliinneess ffoorr tthhee ddeevveellooppmmeenntt ooff ggaarrbbaaggee mmaannaaggeemmeenntt ppllaannss MMEEPPCC..7722((3388)) RReevviissiioonn ooff tthhee lliisstt ooff ssuubbssttaanncceess ttoo bbee aannnneexxeedd ttoo tthhee PPrroottooccooll rreellaattiinngg ttoo IInntteerrvveennttiioonn oonn tthhee HHiigghh SSeeaass iinn CCaasseess ooff MMaarriinnee PPoolllluuttiioonn bbyy SSuubbssttaanncceess ootthheerr tthhaann OOiill MMEEPPCC..7733((3399)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee,, vvaagguuee eexxpprreessssiioonnss)) MMEEPPCC..7744((4400)) IIddeennttiiffiiccaattiioonn ooff tthhee AArrcchhiippeellaaggoo ooff SSaabbaannaa--CCaammaaggüüeeyy aass aa ppaarrttiiccuullaarrllyy sseennssiittiivvee aarreeaa MMEEPPCC..7755((4400)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((AAmmeennddmmeennttss ttoo rreegguullaattiioonn 1100 aanndd nneeww rreegguullaattiioonn 2255AA ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..7766((4400)) SSttaannddaarrdd ssppeecciiffiiccaattiioonn ffoorr sshhiippbbooaarrdd iinncciinneerraattoorrss MMEEPPCC..7777((4411)) EEssttaabblliisshhmmeenntt ooff tthhee ddaattee oonn wwhhiicchh tthhee aammeennddmmeennttss ttoo rreegguullaattiioonn 1100 ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788 iinn rreessppeecctt ooff tthhee nnoorrtthh--wweesstt EEuurrooppeeaann wwaatteerrss ssppeecciiaall aarreeaa sshhaallll ttaakkee eeffffeecctt
  • MMEEPPCC..7788((4433)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 MMEEPPCC..7799((4433)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMEEPPCC..8800((4433)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMEEPPCC..8811((4433)) AAmmeennddmmeennttss ttoo sseeccttiioonn 99 ooff tthhee ssttaannddaarrdd ffoorrmmaatt ffoorr tthhee CCOOWW MMaannuuaall ((rreessoolluuttiioonn MMEEPPCC..33((XXIIII)))) MMEEPPCC..8822((4433)) GGuuiiddeelliinneess ffoorr mmoonniittoorriinngg tthhee wwoorrlldd--wwiiddee aavveerraaggee ssuullpphhuurr ccoonntteenntt ooff rreessiidduuaall ffuueell ooiillss ssuupppplliieedd ffoorr uussee oonn bbooaarrdd sshhiippss MMEEPPCC..8833((4444)) GGuuiiddeelliinneess ffoorr eennssuurriinngg tthhee aaddeeqquuaaccyy ooff ppoorrtt wwaassttee rreecceeppttiioonn ffaacciilliittiieess MMEEPPCC..8844((4444)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff MMaarriinnee PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 MMEEPPCC..8855((4444)) GGuuiiddeelliinneess ffoorr tthhee ddeevveellooppmmeenntt ooff sshhiippbbooaarrdd mmaarriinnee ppoolllluuttiioonn eemmeerrggeennccyy ppllaannss ffoorr ooiill aanndd//oorr nnooxxiioouuss lliiqquuiidd ssuubbssttaanncceess MMEEPPCC..8866((4444)) AAmmeennddmmeennttss ttoo tthhee GGuuiiddeelliinneess ffoorr tthhee ddeevveellooppmmeenntt ooff sshhiippbbooaarrdd ooiill ppoolllluuttiioonn eemmeerrggeennccyy ppllaannss MMEEPPCC..6644((3366)) GGuuiiddeelliinneess ffoorr aapppprroovvaall ooff aalltteerrnnaattiivvee ssttrruuccttuurraall oorr ooppeerraattiioonnaall aarrrraannggeemmeennttss aass ccaalllleedd ffoorr iinn rreegguullaattiioonn 1133GG((77)) ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..6655((3377)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((AAmmeennddmmeennttss ttoo rreegguullaattiioonn 22 aanndd nneeww rreegguullaattiioonn 99 ooff AAnnnneexx VV))
  • MMEEPPCC..6666((3377)) IInntteerriimm gguuiiddeelliinneess ffoorr tthhee aapppprroovvaall ooff aalltteerrnnaattiivvee mmeetthhooddss ooff ddeessiiggnn aanndd ccoonnssttrruuccttiioonn ooff ooiill ttaannkkeerrss uunnddeerr rreegguullaattiioonn 1133FF((55)) ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788 MMEEPPCC..6677((3377)) GGuuiiddeelliinneess oonn aapppplliiccaattiioonn ooff tthhee pprreeccaauuttiioonnaarryy aapppprrooaacchh iinn tthhee ccoonntteexxtt ooff ssppeecciiffiicc IIMMOO aaccttiivviittiieess MMEEPPCC..6688((3388)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((AAmmeennddmmeennttss ttoo PPrroottooccooll II)) MMEEPPCC..6699((3388)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMEEPPCC..7700((3388)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMEEPPCC..7711((3388)) GGuuiiddeelliinneess ffoorr tthhee ddeevveellooppmmeenntt ooff ggaarrbbaaggee mmaannaaggeemmeenntt ppllaannss MMEEPPCC..7722((3388)) RReevviissiioonn ooff tthhee lliisstt ooff ssuubbssttaanncceess ttoo bbee aannnneexxeedd ttoo tthhee PPrroottooccooll rreellaattiinngg ttoo IInntteerrvveennttiioonn oonn tthhee HHiigghh SSeeaass iinn CCaasseess ooff MMaarriinnee PPoolllluuttiioonn bbyy SSuubbssttaanncceess ootthheerr tthhaann OOiill MMEEPPCC..7733((3399)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee,, vvaagguuee eexxpprreessssiioonnss)) MMEEPPCC..7744((4400)) IIddeennttiiffiiccaattiioonn ooff tthhee AArrcchhiippeellaaggoo ooff SSaabbaannaa--CCaammaaggüüeeyy aass aa ppaarrttiiccuullaarrllyy sseennssiittiivvee aarreeaa MMEEPPCC..7755((4400)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 ((AAmmeennddmmeennttss ttoo rreegguullaattiioonn 1100 aanndd nneeww rreegguullaattiioonn 2255AA ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788)) MMEEPPCC..7766((4400)) SSttaannddaarrdd ssppeecciiffiiccaattiioonn ffoorr sshhiippbbooaarrdd iinncciinneerraattoorrss MMEEPPCC..7777((4411)) EEssttaabblliisshhmmeenntt ooff tthhee ddaattee oonn wwhhiicchh tthhee aammeennddmmeennttss ttoo rreegguullaattiioonn 1100 ooff AAnnnneexx II ooff MMAARRPPOOLL 7733//7788 iinn rreessppeecctt ooff tthhee nnoorrtthh--wweesstt EEuurrooppeeaann wwaatteerrss ssppeecciiaall aarreeaa sshhaallll ttaakkee eeffffeecctt
  • MMEEPPCC..7788((4433)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 MMEEPPCC..7799((4433)) AAmmeennddmmeennttss ttoo tthhee IInntteerrnnaattiioonnaall CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((IIBBCC CCooddee)) MMEEPPCC..8800((4433)) AAmmeennddmmeennttss ttoo tthhee CCooddee ffoorr tthhee CCoonnssttrruuccttiioonn aanndd EEqquuiippmmeenntt ooff SShhiippss CCaarrrryyiinngg DDaannggeerroouuss CChheemmiiccaallss iinn BBuullkk ((BBCCHH CCooddee)) MMEEPPCC..8811((4433)) AAmmeennddmmeennttss ttoo sseeccttiioonn 99 ooff tthhee ssttaannddaarrdd ffoorrmmaatt ffoorr tthhee CCOOWW MMaannuuaall ((rreessoolluuttiioonn MMEEPPCC..33((XXIIII)))) MMEEPPCC..8822((4433)) GGuuiiddeelliinneess ffoorr mmoonniittoorriinngg tthhee wwoorrlldd--wwiiddee aavveerraaggee ssuullpphhuurr ccoonntteenntt ooff rreessiidduuaall ffuueell ooiillss ssuupppplliieedd ffoorr uussee oonn bbooaarrdd sshhiippss MMEEPPCC..8833((4444)) GGuuiiddeelliinneess ffoorr eennssuurriinngg tthhee aaddeeqquuaaccyy ooff ppoorrtt wwaassttee rreecceeppttiioonn ffaacciilliittiieess MMEEPPCC..8844((4444)) AAmmeennddmmeennttss ttoo tthhee aannnneexx ooff tthhee PPrroottooccooll ooff 11997788 rreellaattiinngg ttoo tthhee IInntteerrnnaattiioonnaall CCoonnvveennttiioonn ffoorr tthhee PPrreevveennttiioonn ooff MMaarriinnee PPoolllluuttiioonn ffrroomm SShhiippss,, 11997733 MMEEPPCC..8855((4444)) GGuuiiddeelliinneess ffoorr tthhee ddeevveellooppmmeenntt ooff sshhiippbbooaarrdd mmaarriinnee ppoolllluuttiioonn eemmeerrggeennccyy ppllaannss ffoorr ooiill aanndd//oorr nnooxxiioouuss lliiqquuiidd ssuubbssttaanncceess MMEEPPCC..8866((4444)) AAmmeennddmmeennttss ttoo tthhee GGuuiiddeelliinneess ffoorr tthhee ddeevveellooppmmeenntt ooff sshhiippbbooaarrdd ooiill ppoolllluuttiioonn eemmeerrggeennccyy ppllaannss IInnddeexx ooff IIMMOO RReessoolluuttiioonnss,, JJaannuuaarryy 11995599--MMaayy 22000022 PPaaggee 4466 RReessoolluuttiioonn nnuummbbeerr RReessoolluuttiioonn ttiittllee ((SSttaattuuss)) RREEMMEERRCCIIEEMMEENNTTSS JJee ssoouuhhaaiittee rreemmeerrcciieerr eenn pprreemmiieerr lliieeuu MMaa FFeemmmmee qquuii mm''aa ppeerrmmiiss ddee ssuuiivvrree cceettttee aannnnééee uunniivveerrssiittaaiirree ppaarraallllèèlleemmeenntt àà mmoonn eemmppllooii ppoouurr ssaa ppaattiieennccee eett ssaa ddiissppoonniibbiilliittéé.. JJee rreemmeerrcciiee MMeessssiieeuurrss AAiitt MMee ddoouuaarr eett GGHHAARRBBII HHAAMMOOUUDD ppoouurr lleeuurr aapppprroocchhee ttrrèèss ccoonnccrrèèttee ddee ll''eennsseeiiggnneemmeenntt dduu ddrrooiitt mmaarriittiimmee..
  • JJee rreemmeerrcciiee ééggaalleemmeenntt MMoonnssiieeuurr BBeenn AAbbddeerrrraahhmmaannee ppoouurr ssoonn ddéévvoouueemmeenntt eett ssoonn pprrooffeessssiioonnnnaalliissmmee eett qquuii mmaallggrréé uunn eemmppllooii dduu tteemmppss ttrrèèss cchhaarrggéé mm''aa eennttrreetteennuu ssuurr llee rrôôllee iinnddiissppeennssaabbllee ddeess eennqquuêêtteess aacccciiddeennttss lloorrss dd''uunn eennttrreettiieenn cchhaalleeuurreeuuxx.. JJee rreemmeerrcciiee MMoonnssiieeuurr GGhhaarrbbii HHaa mmoouudd ppoouurr sseess ééccllaaiirrcciisssseemmeennttss ssuurr llee ssuujjeett ddee llaa ssûûrreettéé mmaarriittiimmee aauu sseeiinn dd''uunnee ggrraannddee ccoommppaaggnniiee mmaarriittiimmee ddee ppoorrtteess ccoonntteenneeuurrss.. TTTTTTTTAAAAAAAABBBBBBBBLLLLLLLLEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS MMMMMMMMAAAAAAAATTTTTTTTIIIIIIIIEEEEEEEERRRRRRRREEEEEEEESSSSSSSS SSSSSSSSOOOOOOOOMMMMMMMMMMMMMMMMAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEE 11111111 TTTTTTTTAAAAAAAABBBBBBBBLLLLLLLLEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS AAAAAAAABBBBBBBBRRRRRRRREEEEEEEEVVVVVVVVIIIIIIIIAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS 22222222 IIIIIIIINNNNNNNNTTTTTTTTRRRRRRRROOOOOOOODDDDDDDDUUUUUUUUCCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN 33333333 PPPPPPPPRRRRRRRREEEEEEEEMMMMMMMMIIIIIIIIEEEEEEEERRRRRRRREEEEEEEE PPPPPPPPAAAAAAAARRRRRRRRTTTTTTTTIIIIIIIIEEEEEEEE :::::::: LLLLLLLLAAAAAAAA SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE 66666666 SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: SSSSSSSSOOOOOOOOUUUUUUUURRRRRRRRCCCCCCCCEEEEEEEE EEEEEEEETTTTTTTT LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE DDDDDDDD''''''''UUUUUUUUNNNNNNNNEEEEEEEE RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN SSSSSSSSAAAAAAAANNNNNNNNSSSSSSSS CCCCCCCCEEEEEEEESSSSSSSSSSSSSSSSEEEEEEEE EEEEEEEENNNNNNNN EEEEEEEESSSSSSSSSSSSSSSSOOOOOOOORRRRRRRR 66666666 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: GGGGGGGGEEEEEEEENNNNNNNNEEEEEEEESSSSSSSSEEEEEEEE DDDDDDDD''''''''UUUUUUUUNNNNNNNNEEEEEEEE RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN EEEEEEEENNNNNNNN FFFFFFFFAAAAAAAAVVVVVVVVEEEEEEEEUUUUUUUURRRRRRRR DDDDDDDDEEEEEEEE LLLLLLLL''''''''AAAAAAAAMMMMMMMMEEEEEEEELLLLLLLLIIIIIIIIOOOOOOOORRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE :::::::: 66666666 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS EEEEEEEEVVVVVVVVEEEEEEEENNNNNNNNEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS DDDDDDDDEEEEEEEE MMMMMMMMEEEEEEEERRRRRRRR EEEEEEEETTTTTTTT LLLLLLLLEEEEEEEEUUUUUUUURRRRRRRR EEEEEEEENNNNNNNNSSSSSSSSEEEEEEEEIIIIIIIIGGGGGGGGNNNNNNNNEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT 66666666 §§§§§§§§11111111........11111111 :::::::: LLLLLLLLEEEEEEEESSSSSSSS CCCCCCCCAAAAAAAATTTTTTTTAAAAAAAASSSSSSSSTTTTTTTTRRRRRRRROOOOOOOOPPPPPPPPHHHHHHHHEEEEEEEESSSSSSSS IIIIIIIINNNNNNNNSSSSSSSSTTTTTTTTRRRRRRRRUUUUUUUUCCCCCCCCTTTTTTTTIIIIIIIIVVVVVVVVEEEEEEEESSSSSSSS 66666666 §§§§§§§§11111111........22222222:::::::: LLLLLLLLEEEEEEEESSSSSSSS EEEEEEEENNNNNNNNQQQQQQQQUUUUUUUUÊÊÊÊÊÊÊÊTTTTTTTTEEEEEEEESSSSSSSS AAAAAAAACCCCCCCCCCCCCCCCIIIIIIIIDDDDDDDDEEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS 99999999 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIII :::::::: DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA PPPPPPPPOOOOOOOOLLLLLLLLIIIIIIIITTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE AAAAAAAATTTTTTTTTTTTTTTTEEEEEEEENNNNNNNNTTTTTTTTIIIIIIIISSSSSSSSTTTTTTTTEEEEEEEE AAAAAAAA LLLLLLLL''''''''OOOOOOOOBBBBBBBBLLLLLLLLIIIIIIIIGGGGGGGGAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDD''''''''AAAAAAAAGGGGGGGGIIIIIIIIRRRRRRRR 1111111144444444 §§§§§§§§22222222........11111111 :::::::: LLLLLLLLEEEEEEEE CCCCCCCCOOOOOOOONNNNNNNNTTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEE EEEEEEEECCCCCCCCOOOOOOOONNNNNNNNOOOOOOOOMMMMMMMMIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE,,,,,,,, FFFFFFFFRRRRRRRREEEEEEEEIIIIIIIINNNNNNNN AAAAAAAAUUUUUUUUXXXXXXXX PPPPPPPPRRRRRRRROOOOOOOOGGGGGGGGRRRRRRRREEEEEEEESSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEE 1111111144444444 §§§§§§§§22222222........22222222 :::::::: LLLLLLLLAAAAAAAA PPPPPPPPRRRRRRRREEEEEEEESSSSSSSSSSSSSSSSIIIIIIIIOOOOOOOONNNNNNNN PPPPPPPPOOOOOOOOPPPPPPPPUUUUUUUULLLLLLLLAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEE CCCCCCCCOOOOOOOOMMMMMMMMMMMMMMMMEEEEEEEE DDDDDDDDYYYYYYYYNNNNNNNNAAAAAAAAMMMMMMMMIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEE 1111111177777777 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE EEEEEEEETTTTTTTT EEEEEEEEFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCAAAAAAAACCCCCCCCIIIIIIIITTTTTTTTEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFEEEEEEEERRRRRRRREEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUUXXXXXXXX DDDDDDDD''''''''IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRVVVVVVVVEEEEEEEENNNNNNNNTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN 2222222233333333 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIII :::::::: LLLLLLLLEEEEEEEE NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUU SSSSSSSSUUUUUUUUPPPPPPPPRRRRRRRRAAAAAAAA NNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL :::::::: EEEEEEEENNNNNNNNTTTTTTTTRRRRRRRREEEEEEEE LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE EEEEEEEETTTTTTTT GGGGGGGGLLLLLLLLOOOOOOOOBBBBBBBBAAAAAAAALLLLLLLLIIIIIIIITTTTTTTTEEEEEEEE 2222222233333333 §§§§§§§§11111111........11111111 :::::::: LLLLLLLLEEEEEEEE NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUU IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL 2222222233333333 §§§§§§§§11111111........22222222 :::::::: LLLLLLLLEEEEEEEE NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUU CCCCCCCCOOOOOOOOMMMMMMMMMMMMMMMMUUUUUUUUNNNNNNNNAAAAAAAAUUUUUUUUTTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEE 2222222277777777 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEE NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUU NNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL :::::::: EEEEEEEENNNNNNNNTTTTTTTTRRRRRRRREEEEEEEE LLLLLLLLEEEEEEEEGGGGGGGGIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMIIIIIIIITTTTTTTTEEEEEEEE EEEEEEEETTTTTTTT IIIIIIIISSSSSSSSOOOOOOOOLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT 3333333344444444 §§§§§§§§22222222........11111111 :::::::: LLLLLLLLEEEEEEEE NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUU EEEEEEEETTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE 3333333344444444 §§§§§§§§22222222........22222222 :::::::: LLLLLLLLEEEEEEEE NNNNNNNNIIIIIIIIVVVVVVVVEEEEEEEEAAAAAAAAUUUUUUUU RRRRRRRREEEEEEEEGGGGGGGGIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLL 3333333377777777
  • CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIIIIIIIIIII :::::::: MMMMMMMMIIIIIIIISSSSSSSSEEEEEEEE EEEEEEEENNNNNNNN EEEEEEEEVVVVVVVVIIIIIIIIDDDDDDDDEEEEEEEENNNNNNNNCCCCCCCCEEEEEEEE DDDDDDDDUUUUUUUU RRRRRRRROOOOOOOOLLLLLLLLEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFEEEEEEEERRRRRRRREEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRVVVVVVVVEEEEEEEENNNNNNNNAAAAAAAANNNNNNNNTTTTTTTTSSSSSSSS PPPPPPPPAAAAAAAARRRRRRRR LLLLLLLL''''''''EEEEEEEEXXXXXXXXEEEEEEEEMMMMMMMMPPPPPPPPLLLLLLLLEEEEEEEE TTTTTTTTRRRRRRRREEEEEEEESSSSSSSS MMMMMMMMEEEEEEEEDDDDDDDDIIIIIIIIAAAAAAAATTTTTTTTIIIIIIIISSSSSSSSEEEEEEEE DDDDDDDDUUUUUUUU BBBBBBBBAAAAAAAANNNNNNNNIIIIIIIISSSSSSSSSSSSSSSSEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT DDDDDDDDEEEEEEEESSSSSSSS NNNNNNNNAAAAAAAAVVVVVVVVIIIIIIIIRRRRRRRREEEEEEEESSSSSSSS PPPPPPPPEEEEEEEETTTTTTTTRRRRRRRROOOOOOOOLLLLLLLLIIIIIIIIEEEEEEEERRRRRRRRSSSSSSSS SSSSSSSSIIIIIIIIMMMMMMMMPPPPPPPPLLLLLLLLEEEEEEEE CCCCCCCCOOOOOOOOQQQQQQQQUUUUUUUUEEEEEEEE 3333333388888888 §§§§§§§§33333333........11111111 :::::::: OOOOOOOOMMMMMMMMIIIIIIII,,,,,,,, LLLLLLLLEEEEEEEEAAAAAAAADDDDDDDDEEEEEEEERRRRRRRR DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN 3333333399999999 §§§§§§§§33333333........22222222 :::::::: AAAAAAAAPPPPPPPPPPPPPPPPAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEESSSSSSSS EEEEEEEETTTTTTTTAAAAAAAATTTTTTTTSSSSSSSS--------UUUUUUUUNNNNNNNNIIIIIIIISSSSSSSS EEEEEEEETTTTTTTT DDDDDDDDEEEEEEEE LLLLLLLL''''''''UUUUUUUUNNNNNNNNIIIIIIIIOOOOOOOONNNNNNNN EEEEEEEEUUUUUUUURRRRRRRROOOOOOOOPPPPPPPPEEEEEEEEEEEEEEEENNNNNNNNNNNNNNNNEEEEEEEE DDDDDDDDAAAAAAAANNNNNNNNSSSSSSSS LLLLLLLLEEEEEEEE DDDDDDDDOOOOOOOOMMMMMMMMAAAAAAAAIIIIIIIINNNNNNNNEEEEEEEE DDDDDDDDEEEEEEEE LLLLLLLL''''''''EEEEEEEELLLLLLLLAAAAAAAABBBBBBBBOOOOOOOORRRRRRRRAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEESSSSSSSS TTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEESSSSSSSS 4444444400000000 SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: DDDDDDDDOOOOOOOOMMMMMMMMAAAAAAAAIIIIIIIINNNNNNNNEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS TTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEESSSSSSSS EEEEEEEETTTTTTTT RRRRRRRREEEEEEEESSSSSSSSPPPPPPPPEEEEEEEECCCCCCCCTTTTTTTT DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA RRRRRRRREEEEEEEEGGGGGGGGLLLLLLLLEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN 4444444444444444 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS TTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEESSSSSSSS EEEEEEEEXXXXXXXXIIIIIIIISSSSSSSSTTTTTTTTAAAAAAAANNNNNNNNTTTTTTTTSSSSSSSS EEEEEEEETTTTTTTT LLLLLLLLEEEEEEEEUUUUUUUURRRRRRRR DDDDDDDDOOOOOOOOMMMMMMMMAAAAAAAAIIIIIIIINNNNNNNNEEEEEEEE 4444444444444444 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIII :::::::: LLLLLLLLEEEEEEEE FFFFFFFFAAAAAAAACCCCCCCCTTTTTTTTEEEEEEEEUUUUUUUURRRRRRRR HHHHHHHHUUUUUUUUMMMMMMMMAAAAAAAAIIIIIIIINNNNNNNNEEEEEEEE 4444444455555555 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEE FFFFFFFFAAAAAAAACCCCCCCCTTTTTTTTEEEEEEEEUUUUUUUURRRRRRRR TTTTTTTTEEEEEEEECCCCCCCCHHHHHHHHNNNNNNNNIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE 4444444488888888 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII ::::::::LLLLLLLLEEEEEEEESSSSSSSS AAAAAAAACCCCCCCCTTTTTTTTEEEEEEEEUUUUUUUURRRRRRRRSSSSSSSS DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA CCCCCCCCHHHHHHHHAAAAAAAAÎÎÎÎÎÎÎÎNNNNNNNNEEEEEEEE DDDDDDDDEEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE 5555555500000000 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS EEEEEEEETTTTTTTTAAAAAAAATTTTTTTTSSSSSSSS 5555555500000000 §§§§§§§§11111111........11111111 LLLLLLLL''''''''EEEEEEEETTTTTTTTAAAAAAAATTTTTTTT DDDDDDDDUUUUUUUU PPPPPPPPAAAAAAAAVVVVVVVVIIIIIIIILLLLLLLLLLLLLLLLOOOOOOOONNNNNNNN :::::::: OOOOOOOOBBBBBBBBLLLLLLLLIIIIIIIIGGGGGGGGAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN EEEEEEEETTTTTTTT DDDDDDDDEEEEEEEELLLLLLLLAAAAAAAAIIIIIIIISSSSSSSSSSSSSSSSEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT 5555555500000000 §§§§§§§§11111111........22222222........ LLLLLLLL''''''''EEEEEEEETTTTTTTTAAAAAAAATTTTTTTT DDDDDDDDUUUUUUUU PPPPPPPPOOOOOOOORRRRRRRRTTTTTTTT :::::::: SSSSSSSSUUUUUUUUBBBBBBBBSSSSSSSSTTTTTTTTIIIIIIIITTTTTTTTUUUUUUUUTTTTTTTT DDDDDDDDEEEEEEEE LLLLLLLL''''''''EEEEEEEETTTTTTTTAAAAAAAATTTTTTTT DDDDDDDDUUUUUUUU PPPPPPPPAAAAAAAAVVVVVVVVIIIIIIIILLLLLLLLLLLLLLLLOOOOOOOONNNNNNNN 5555555544444444 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS OOOOOOOORRRRRRRRGGGGGGGGAAAAAAAANNNNNNNNIIIIIIIISSSSSSSSMMMMMMMMEEEEEEEESSSSSSSS PPPPPPPPRRRRRRRRIIIIIIIIVVVVVVVVEEEEEEEESSSSSSSS :::::::: 5555555599999999 §§§§§§§§22222222........11111111 LLLLLLLLEEEEEEEESSSSSSSS SSSSSSSSOOOOOOOOCCCCCCCCIIIIIIIIEEEEEEEETTTTTTTTEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEE CCCCCCCCLLLLLLLLAAAAAAAASSSSSSSSSSSSSSSSIIIIIIIIFFFFFFFFIIIIIIIICCCCCCCCAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS 5555555599999999 §§§§§§§§22222222........22222222 LLLLLLLLEEEEEEEESSSSSSSS AAAAAAAAUUUUUUUUTTTTTTTTRRRRRRRREEEEEEEESSSSSSSS AAAAAAAACCCCCCCCTTTTTTTTEEEEEEEEUUUUUUUURRRRRRRRSSSSSSSS 6666666633333333 DDDDDDDDEEEEEEEEUUUUUUUUXXXXXXXXIIIIIIIIEEEEEEEEMMMMMMMMEEEEEEEE PPPPPPPPAAAAAAAARRRRRRRRTTTTTTTTIIIIIIIIEEEEEEEE ::::::::VVVVVVVVEEEEEEEERRRRRRRRSSSSSSSS UUUUUUUUNNNNNNNNEEEEEEEE NNNNNNNNOOOOOOOOUUUUUUUUVVVVVVVVEEEEEEEELLLLLLLLLLLLLLLLEEEEEEEE IIIIIIIIDDDDDDDDEEEEEEEEEEEEEEEE DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE:::::::: LLLLLLLLAAAAAAAA SSSSSSSSUUUUUUUURRRRRRRREEEEEEEETTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE 6666666677777777 SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: EEEEEEEEMMMMMMMMEEEEEEEERRRRRRRRGGGGGGGGEEEEEEEENNNNNNNNCCCCCCCCEEEEEEEE DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA NNNNNNNNOOOOOOOOTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN DDDDDDDDEEEEEEEE SSSSSSSSÛÛÛÛÛÛÛÛRRRRRRRREEEEEEEETTTTTTTTEEEEEEEE 6666666677777777 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: LLLLLLLLEEEEEEEE CCCCCCCCOOOOOOOONNNNNNNNTTTTTTTTEEEEEEEEXXXXXXXXTTTTTTTTEEEEEEEE 6666666677777777 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIII :::::::: HHHHHHHHIIIIIIIISSSSSSSSTTTTTTTTOOOOOOOORRRRRRRRIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE 6666666677777777 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIII :::::::: LLLLLLLL''''''''AAAAAAAASSSSSSSSPPPPPPPPEEEEEEEECCCCCCCCTTTTTTTT EEEEEEEECCCCCCCCOOOOOOOONNNNNNNNOOOOOOOOMMMMMMMMIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE 7777777700000000 §§§§§§§§22222222........11111111 :::::::: CCCCCCCCOOOOOOOOUUUUUUUUTTTTTTTT DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA SSSSSSSSUUUUUUUURRRRRRRREEEEEEEETTTTTTTTEEEEEEEE MMMMMMMMAAAAAAAARRRRRRRRIIIIIIIITTTTTTTTIIIIIIIIMMMMMMMMEEEEEEEE 7777777700000000 §§§§§§§§22222222........22222222 :::::::: RRRRRRRREEEEEEEEPPPPPPPPAAAAAAAARRRRRRRRTTTTTTTTIIIIIIIIRRRRRRRR CCCCCCCCEEEEEEEE CCCCCCCCOOOOOOOOUUUUUUUUTTTTTTTT 7777777711111111 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEEMMMMMMMMAAAAAAAARRRRRRRRCCCCCCCCHHHHHHHHEEEEEEEESSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEESSSSSSSS 7777777733333333 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIII :::::::: DDDDDDDDUUUUUUUU CCCCCCCCOOOOOOOOTTTTTTTTEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS EEEEEEEETTTTTTTTAAAAAAAATTTTTTTTSSSSSSSS UUUUUUUUNNNNNNNNIIIIIIIISSSSSSSS 7777777744444444
  • CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEEMMMMMMMMAAAAAAAARRRRRRRRCCCCCCCCHHHHHHHHEEEEEEEESSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEESSSSSSSS DDDDDDDDEEEEEEEESSSSSSSS IIIIIIIINNNNNNNNSSSSSSSSTTTTTTTTAAAAAAAANNNNNNNNCCCCCCCCEEEEEEEESSSSSSSS IIIIIIIINNNNNNNNTTTTTTTTEEEEEEEERRRRRRRRNNNNNNNNAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNAAAAAAAALLLLLLLLEEEEEEEESSSSSSSS 7777777766666666 §§§§§§§§22222222........11111111 LLLLLLLL''''''''OOOOOOOOMMMMMMMMIIIIIIII 7777777766666666 §§§§§§§§22222222........22222222 LLLLLLLL''''''''OOOOOOOOIIIIIIIITTTTTTTT 7777777766666666 §§§§§§§§22222222........33333333 LLLLLLLL''''''''OOOOOOOOMMMMMMMMDDDDDDDD 7777777777777777 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIIIIIIIIIII :::::::: LLLLLLLLAAAAAAAA DDDDDDDDEEEEEEEEMMMMMMMMAAAAAAAARRRRRRRRCCCCCCCCHHHHHHHHEEEEEEEE SSSSSSSSEEEEEEEECCCCCCCCUUUUUUUURRRRRRRRIIIIIIIITTTTTTTTAAAAAAAAIIIIIIIIRRRRRRRREEEEEEEE DDDDDDDDEEEEEEEE LLLLLLLL''''''''EEEEEEEEUUUUUUUURRRRRRRROOOOOOOOPPPPPPPPEEEEEEEE 7777777788888888 SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEE MMMMMMMMIIIIIIIISSSSSSSSEEEEEEEE EEEEEEEENNNNNNNN OOOOOOOOEEEEEEEEUUUUUUUUVVVVVVVVRRRRRRRREEEEEEEE 8888888800000000 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEESSSSSSSS PPPPPPPPOOOOOOOOLLLLLLLLIIIIIIIITTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE OOOOOOOOUUUUUUUU DDDDDDDDIIIIIIIIPPPPPPPPLLLLLLLLOOOOOOOOMMMMMMMMAAAAAAAATTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE 8888888800000000 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIII :::::::: LLLLLLLLEEEEEEEE CCCCCCCCAAAAAAAASSSSSSSS DDDDDDDDEEEEEEEE LLLLLLLLAAAAAAAA CCCCCCCCSSSSSSSSIIIIIIII 8888888800000000 CCCCCCCCHHHHHHHHAAAAAAAAPPPPPPPPIIIIIIIITTTTTTTTRRRRRRRREEEEEEEE IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEE CCCCCCCCAAAAAAAASSSSSSSS DDDDDDDDUUUUUUUU CCCCCCCCOOOOOOOODDDDDDDDEEEEEEEE IIIIIIIISSSSSSSSPPPPPPPPSSSSSSSS 8888888822222222 SSSSSSSSOOOOOOOOUUUUUUUUSSSSSSSS SSSSSSSSEEEEEEEECCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN IIIIIIIIIIIIIIII :::::::: LLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDIIIIIIIIFFFFFFFFFFFFFFFFIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEE LLLLLLLLOOOOOOOOGGGGGGGGIIIIIIIISSSSSSSSTTTTTTTTIIIIIIIIQQQQQQQQUUUUUUUUEEEEEEEE 8888888833333333 CCCCCCCCOOOOOOOONNNNNNNNCCCCCCCCLLLLLLLLUUUUUUUUSSSSSSSSIIIIIIIIOOOOOOOONNNNNNNN 8888888866666666 BBBBBBBBIIIIIIIIBBBBBBBBLLLLLLLLIIIIIIIIOOOOOOOOGGGGGGGGRRRRRRRRAAAAAAAAPPPPPPPPHHHHHHHHIIIIIIIIEEEEEEEE 8888888888888888 TTTTTTTTAAAAAAAABBBBBBBBLLLLLLLLEEEEEEEESSSSSSSS DDDDDDDDEEEEEEEESSSSSSSS AAAAAAAANNNNNNNNNNNNNNNNEEEEEEEEXXXXXXXXEEEEEEEESSSSSSSS 9999999922222222 AAAAAAAANNNNNNNNNNNNNNNNEEEEEEEEXXXXXXXXEEEEEEEESSSSSSSS 9999999933333333 RRRRRRRREEEEEEEEMMMMMMMMEEEEEEEERRRRRRRRCCCCCCCCIIIIIIIIEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS 111111110000000066666666 TTTTTTTTAAAAAAAABBBBBBBBLLLLLLLLEEEEEEEE DDDDDDDDEEEEEEEESSSSSSSS MMMMMMMMAAAAAAAATTTTTTTTIIIIIIIIEEEEEEEERRRRRRRREEEEEEEESSSSSSSS 111111110000000077777777