Uploaded on

DIY Diagnostics and Amplino presented at PICNIC Business Club @ Vodafone HQ Amsterdam 26/07/2012

DIY Diagnostics and Amplino presented at PICNIC Business Club @ Vodafone HQ Amsterdam 26/07/2012

  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Be the first to comment
    Be the first to like this
No Downloads

Views

Total Views
1,259
On Slideshare
0
From Embeds
0
Number of Embeds
1

Actions

Shares
Downloads
0
Comments
0
Likes
0

Embeds 0

No embeds

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
    No notes for slide

Transcript

  • 1. DIYBio DiagnosticsPieter van Boheemen
  • 2. ScienceBiology DIY Design Bio Education
  • 3. DIY Bio Code of Ethics European Delegation 09/07/2011 Transparency Safety Open Access Education Modesty Community Peaceful Purposes Respect Responsibility Accountability
  • 4. A G T C AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGAAAGTAAGCGCTATATTTAGCCGAAAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA
  • 5. PikoReal
  • 6. Cooling Heating Sample Temperature sensors
  • 7. Lamp dimmer Air tube with sampleController Fan Fan relais
  • 8. Controller LEDPhotodiode
  • 9. Notified cases of malaria (per 100,000 people) – World Bank
  • 10. MIT, Boston Business Plan Competition November 2012The Next 4 Billion – World Bank Group
  • 11. Pieter van Boheemen Wouter Bruins Jelmer Cnossen email twitterinfo@amplino.org website