• Share
  • Email
  • Embed
  • Like
  • Save
  • Private Content
DIY Diagnostics
 

DIY Diagnostics

on

  • 1,584 views

DIY Diagnostics and Amplino presented at PICNIC Business Club @ Vodafone HQ Amsterdam 26/07/2012

DIY Diagnostics and Amplino presented at PICNIC Business Club @ Vodafone HQ Amsterdam 26/07/2012

Statistics

Views

Total Views
1,584
Views on SlideShare
890
Embed Views
694

Actions

Likes
0
Downloads
0
Comments
0

2 Embeds 694

http://www.pietervanboheemen.nl 686
http://www.pietervanboheemen.com 8

Accessibility

Upload Details

Uploaded via as Adobe PDF

Usage Rights

© All Rights Reserved

Report content

Flagged as inappropriate Flag as inappropriate
Flag as inappropriate

Select your reason for flagging this presentation as inappropriate.

Cancel
  • Full Name Full Name Comment goes here.
    Are you sure you want to
    Your message goes here
    Processing…
Post Comment
Edit your comment

    DIY Diagnostics DIY Diagnostics Presentation Transcript

    • DIYBio DiagnosticsPieter van Boheemen
    • ScienceBiology DIY Design Bio Education
    • DIY Bio Code of Ethics European Delegation 09/07/2011 Transparency Safety Open Access Education Modesty Community Peaceful Purposes Respect Responsibility Accountability
    • A G T C AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGAAAGTAAGCGCTATATTTAGCCGAAAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA
    • PikoReal
    • Cooling Heating Sample Temperature sensors
    • Lamp dimmer Air tube with sampleController Fan Fan relais
    • Controller LEDPhotodiode
    • Notified cases of malaria (per 100,000 people) – World Bank
    • MIT, Boston Business Plan Competition November 2012The Next 4 Billion – World Bank Group
    • Pieter van Boheemen Wouter Bruins Jelmer Cnossen email twitterinfo@amplino.org website