DIYBio DiagnosticsPieter van Boheemen
ScienceBiology           DIY        Design           Bio          Education
DIY Bio Code of Ethics     European Delegation 09/07/2011       Transparency           Safety       Open Access         Ed...
A                      G                      T                      C                 AAGTAAGCGCTATATTTAGCCGA            ...
PikoReal
Cooling                   Heating    Sample   Temperature sensors
Lamp dimmer                              Air tube with sampleController                                                   ...
Controller     LEDPhotodiode
Notified cases of malaria (per 100,000 people) – World Bank
MIT, Boston                                         Business Plan                                         Competition     ...
Pieter van Boheemen    Wouter Bruins   Jelmer Cnossen        email       twitterinfo@amplino.org                website
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
DIY Diagnostics
Upcoming SlideShare
Loading in...5
×

DIY Diagnostics

1,323

Published on

DIY Diagnostics and Amplino presented at PICNIC Business Club @ Vodafone HQ Amsterdam 26/07/2012

0 Comments
1 Like
Statistics
Notes
  • Be the first to comment

No Downloads
Views
Total Views
1,323
On Slideshare
0
From Embeds
0
Number of Embeds
1
Actions
Shares
0
Downloads
0
Comments
0
Likes
1
Embeds 0
No embeds

No notes for slide

Transcript of "DIY Diagnostics"

  1. 1. DIYBio DiagnosticsPieter van Boheemen
  2. 2. ScienceBiology DIY Design Bio Education
  3. 3. DIY Bio Code of Ethics European Delegation 09/07/2011 Transparency Safety Open Access Education Modesty Community Peaceful Purposes Respect Responsibility Accountability
  4. 4. A G T C AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGAAAGTAAGCGCTATATTTAGCCGAAAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA AAGTAAGCGCTATATTTAGCCGA
  5. 5. PikoReal
  6. 6. Cooling Heating Sample Temperature sensors
  7. 7. Lamp dimmer Air tube with sampleController Fan Fan relais
  8. 8. Controller LEDPhotodiode
  9. 9. Notified cases of malaria (per 100,000 people) – World Bank
  10. 10. MIT, Boston Business Plan Competition November 2012The Next 4 Billion – World Bank Group
  11. 11. Pieter van Boheemen Wouter Bruins Jelmer Cnossen email twitterinfo@amplino.org website

×